ID: 1162009507

View in Genome Browser
Species Human (GRCh38)
Location 19:7803741-7803763
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162009503_1162009507 13 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009507 19:7803741-7803763 GGCCTAACTGCTTGCTGAGCTGG No data
1162009502_1162009507 14 Left 1162009502 19:7803704-7803726 CCCAGGTGGGGGATGGAAGTCGA No data
Right 1162009507 19:7803741-7803763 GGCCTAACTGCTTGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162009507 Original CRISPR GGCCTAACTGCTTGCTGAGC TGG Intergenic