ID: 1162009510 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:7803750-7803772 |
Sequence | GCTTGCTGAGCTGGGTTAAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162009502_1162009510 | 23 | Left | 1162009502 | 19:7803704-7803726 | CCCAGGTGGGGGATGGAAGTCGA | No data | ||
Right | 1162009510 | 19:7803750-7803772 | GCTTGCTGAGCTGGGTTAAGTGG | No data | ||||
1162009503_1162009510 | 22 | Left | 1162009503 | 19:7803705-7803727 | CCAGGTGGGGGATGGAAGTCGAA | No data | ||
Right | 1162009510 | 19:7803750-7803772 | GCTTGCTGAGCTGGGTTAAGTGG | No data | ||||
1162009506_1162009510 | -8 | Left | 1162009506 | 19:7803735-7803757 | CCTGGTGGCCTAACTGCTTGCTG | No data | ||
Right | 1162009510 | 19:7803750-7803772 | GCTTGCTGAGCTGGGTTAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162009510 | Original CRISPR | GCTTGCTGAGCTGGGTTAAG TGG | Intergenic | ||