ID: 1162009511

View in Genome Browser
Species Human (GRCh38)
Location 19:7803758-7803780
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162009506_1162009511 0 Left 1162009506 19:7803735-7803757 CCTGGTGGCCTAACTGCTTGCTG No data
Right 1162009511 19:7803758-7803780 AGCTGGGTTAAGTGGCAATTTGG No data
1162009503_1162009511 30 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009511 19:7803758-7803780 AGCTGGGTTAAGTGGCAATTTGG No data
1162009509_1162009511 -8 Left 1162009509 19:7803743-7803765 CCTAACTGCTTGCTGAGCTGGGT No data
Right 1162009511 19:7803758-7803780 AGCTGGGTTAAGTGGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162009511 Original CRISPR AGCTGGGTTAAGTGGCAATT TGG Intergenic