ID: 1162017522

View in Genome Browser
Species Human (GRCh38)
Location 19:7853484-7853506
Sequence CTGGCCTAACAGGTGAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162017522_1162017534 26 Left 1162017522 19:7853484-7853506 CCGTCCTTCACCTGTTAGGCCAG 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1162017534 19:7853533-7853555 CGCGGTAACCAAGACAGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1162017522_1162017526 8 Left 1162017522 19:7853484-7853506 CCGTCCTTCACCTGTTAGGCCAG 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1162017526 19:7853515-7853537 GCCTCCCCCGCCTGACGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162017522 Original CRISPR CTGGCCTAACAGGTGAAGGA CGG (reversed) Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
903443327 1:23404572-23404594 CTGGCCTTACAGGTCAAAAATGG + Intronic
903778685 1:25808665-25808687 CTGGCCTGGCGGGGGAAGGAAGG - Exonic
904754722 1:32761828-32761850 CTGGCCTAAGAGGGGAAGAGTGG + Intronic
906632998 1:47388045-47388067 CTTTCATAACAGGTAAAGGAAGG + Intergenic
906811285 1:48829531-48829553 CTGCCCTATGGGGTGAAGGAGGG + Intronic
907409216 1:54273022-54273044 CTGGCCTCCCAAGTGCAGGATGG - Intronic
912229418 1:107774936-107774958 CTGGGATAAAAGGTGAAGTAGGG - Intronic
912999106 1:114562100-114562122 CAGGCCTTAAAGATGAAGGAAGG - Intergenic
916001341 1:160619246-160619268 CTGGACTAAGAAGTGAAGGATGG - Intronic
916184089 1:162113830-162113852 CCTTCCTAAGAGGTGAAGGATGG - Intronic
916362750 1:163989622-163989644 CTGTCCTAGCAGGCAAAGGAAGG + Intergenic
916399181 1:164427524-164427546 CTGGCCTCAAAGTTGATGGATGG - Intergenic
916416197 1:164593974-164593996 CTGGTATGACAGGTGAAAGAAGG - Intronic
917237280 1:172907856-172907878 GGGGCCTAACAGATGATGGAAGG - Intergenic
917545267 1:175960458-175960480 CTGGCTTAGCAGTTCAAGGAAGG + Intronic
919894098 1:201997591-201997613 CTGGCCCCACAGGTTAAGAATGG - Intronic
922473518 1:225890705-225890727 CTGGCCCACCAGGGGCAGGAGGG - Intronic
922474739 1:225899174-225899196 CTGGCCTATCAGGGGCAGGAGGG + Intronic
1064196017 10:13244655-13244677 CAGGCCTCAGAGGTGAAGGCTGG - Intergenic
1064243635 10:13652565-13652587 CTGGCCAAACAGGTGAGAGCTGG + Intronic
1064288240 10:14011361-14011383 CTGGCCTAAGGGGTCAAGGGAGG + Intronic
1067412979 10:46080803-46080825 CTGGCCTAACATCTGAAGGATGG - Intergenic
1067842474 10:49691896-49691918 CTTGCCTCACAGGTGGAGGTTGG + Intronic
1074118605 10:110476589-110476611 CTGGCTTTGAAGGTGAAGGAAGG - Intergenic
1074338997 10:112607515-112607537 CTGGCCTAAAATGGGAAGGTAGG + Intronic
1074585925 10:114767999-114768021 CGGGCCGAACAGGTGCGGGAGGG - Intergenic
1074914397 10:117941540-117941562 CTGGCCTTGAAGGTGGAGGAAGG - Intergenic
1075399732 10:122152110-122152132 CTGGGCTAAGAGGCAAAGGATGG + Intronic
1075462762 10:122629627-122629649 CAGGCCTAACAGGGAAAGCAGGG + Intronic
1077140420 11:1021889-1021911 CTGGCCCAAGTGGTGGAGGAGGG - Intronic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1081714874 11:45242731-45242753 CTGGCCAAACAGGTGCTGAAGGG + Exonic
1084089408 11:66870291-66870313 CTCGCTAAACAGGTGAAGGGTGG - Exonic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1086218313 11:84409848-84409870 CTGGCCTTCCCGGTGAAGGGAGG - Intronic
1087860925 11:103154731-103154753 CTGGCATGACAGATTAAGGAAGG + Exonic
1087958316 11:104317516-104317538 CTGGCCTGGTAGATGAAGGAAGG - Intergenic
1090348421 11:126090070-126090092 CTTGCCCAATAGGTGAAGTAGGG + Intergenic
1092604279 12:10101670-10101692 CTGGCTTCTCAGGTGATGGATGG - Intronic
1092881062 12:12888179-12888201 CTGGCCTTGCAGCTGAATGAAGG + Intergenic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1096273830 12:50188785-50188807 CTGGCCAAGCAGTTGAACGAGGG + Intronic
1102224070 12:111215631-111215653 CTGTTCTAAAAGGCGAAGGAAGG - Intronic
1102297677 12:111749436-111749458 CAGTCCTAGCAGGTGAAGCAAGG + Intronic
1102787097 12:115613862-115613884 CTGGCCTTGAAGGTGGAGGACGG + Intergenic
1102940406 12:116936546-116936568 CTGGCCTTGAAGGTGGAGGAAGG + Intronic
1103992296 12:124807356-124807378 CTGGCCTCAAAGGTGGAGGAAGG + Intronic
1105059374 12:133134399-133134421 CTGGCCTTGCAGGTGGAGGAAGG + Intronic
1108502915 13:51084508-51084530 CTGGCCTTGAAGGGGAAGGACGG + Intergenic
1110597784 13:77338100-77338122 CTGGCTTTAAAGGTGGAGGAAGG + Intergenic
1112363929 13:98741137-98741159 CTGGCCTGACAAGTGAGCGAGGG + Intronic
1116859396 14:49981656-49981678 TTGGTCTAACAGATGATGGAAGG - Intergenic
1121036157 14:90705411-90705433 CTGGCCCAACAGCTCTAGGAGGG + Intronic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG + Intergenic
1133573783 16:7067983-7068005 CTGGCTTTAAAGATGAAGGAAGG - Intronic
1134012227 16:10863384-10863406 CTGGCTTCAGAGATGAAGGAAGG - Intergenic
1135561586 16:23480704-23480726 CTGTACAAACAGGTGATGGAGGG - Exonic
1136288645 16:29258713-29258735 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1138971658 16:62151494-62151516 CTGGTCTAATAGAGGAAGGAAGG - Intergenic
1142094360 16:88231619-88231641 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG + Exonic
1146545463 17:33734299-33734321 CTGGCCTCACAGGGGAGGAAAGG - Intronic
1147253196 17:39165770-39165792 CGGGCCGGACAGGTGCAGGAGGG + Intronic
1148907019 17:50918384-50918406 CTGGCCCCAGAGGTGAAGGAGGG + Intergenic
1148974832 17:51518496-51518518 CTAGCCTGACTGGTGAAGCAGGG + Intergenic
1149682054 17:58513897-58513919 CTGGCATGCCAGGTGAGGGATGG + Intronic
1151679795 17:75617191-75617213 CTGGCCAAACAGGTCCAGAAGGG - Intergenic
1152033502 17:77857869-77857891 GTGGGCTGACATGTGAAGGAAGG + Intergenic
1152584278 17:81182114-81182136 GCGGCCTAGCAGGGGAAGGAGGG - Intergenic
1156015488 18:32542480-32542502 CTGGCCTCACCTATGAAGGATGG + Intergenic
1157285279 18:46373366-46373388 CTGGCCTGCCAGGTACAGGAGGG + Intronic
1158416260 18:57251983-57252005 CTGCCCTAACAGCTAAAGTAGGG - Intergenic
1158500327 18:57995173-57995195 CTGGACTAGCAGGTCAGGGATGG - Intergenic
1160802678 19:977511-977533 CTCGCCTAGGAGGTGAAGGAGGG - Intergenic
1162017522 19:7853484-7853506 CTGGCCTAACAGGTGAAGGACGG - Intronic
1164109359 19:22140420-22140442 CTGGCCCCACAGGTCAAGGAGGG + Intergenic
1164378092 19:27707162-27707184 CTTGCCAAACAGGGGAAGGCAGG - Intergenic
1165245051 19:34493917-34493939 CTGGCCTGGCAGGGGATGGAGGG - Intronic
1167278012 19:48550487-48550509 CTCACCTAACAGATGCAGGAAGG - Intergenic
1167765383 19:51479094-51479116 CTGGCCTGAGAGGTGGGGGAGGG - Intronic
1168271849 19:55254449-55254471 CTGTCCAAGCAGGGGAAGGAAGG - Intronic
1168345856 19:55649927-55649949 TTGGCCAAAGAGATGAAGGAAGG - Intronic
932232469 2:70094201-70094223 ATGGCCTAACAGCTGGAGGCAGG - Intergenic
933989927 2:87626874-87626896 TTGGTTTCACAGGTGAAGGAAGG - Intergenic
936303918 2:111323950-111323972 TTGGTTTCACAGGTGAAGGAAGG + Intergenic
939888814 2:147711243-147711265 CTGGGCTGAGAGCTGAAGGAGGG - Intergenic
939952267 2:148489530-148489552 CTTGGTCAACAGGTGAAGGATGG + Exonic
941159145 2:162015939-162015961 CTGACCCAGCAGGTCAAGGAAGG - Intronic
942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG + Intronic
944295839 2:198061468-198061490 GTTGCCTAAGAGGGGAAGGAAGG + Intronic
944763908 2:202844980-202845002 CTGGCCTTAAAGATGGAGGAAGG - Intronic
945268987 2:207919819-207919841 CTGGCATAACAAGGGAAGGAGGG + Intronic
946027483 2:216680532-216680554 CTGGCCTAACCTGGGCAGGATGG + Intronic
948026582 2:234782814-234782836 CTGGCTTAGAAGATGAAGGATGG + Intergenic
948223315 2:236290311-236290333 CTGGTGGAACAGGTGAGGGAAGG - Intergenic
949073860 2:242042608-242042630 CTGGCCTGAGAGGTGATTGATGG + Intergenic
1170198060 20:13711408-13711430 CAGGCCTCACATGTGACGGAGGG - Intergenic
1171412847 20:24958297-24958319 CTGGCCTACCCGGAGAAGGAGGG - Intronic
1173767700 20:45628890-45628912 CTTCCCTAACAGGAGAAAGAGGG - Intronic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1174266842 20:49338124-49338146 CTGGCAGAGCAGGTGACGGAAGG + Intergenic
1174433538 20:50488983-50489005 CTGGCTTTAAAGATGAAGGATGG - Intergenic
1175530534 20:59671810-59671832 TTGGCCTAACTGGAGAAGGCAGG - Intronic
1184244694 22:43230125-43230147 CTGGGCTAAAATCTGAAGGATGG + Intronic
949718894 3:6965663-6965685 CTGACCTATCAGGTGCAGGCAGG - Intronic
951862837 3:27273027-27273049 CTGGGTTAACATCTGAAGGAAGG + Intronic
952721664 3:36540121-36540143 CTGGCCTTGAAGGTGAAGGAAGG + Intronic
953389637 3:42526847-42526869 CTGGCCTTTCCGGTGGAGGAGGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956319135 3:67975939-67975961 CTGGCCTTTAAGGTGGAGGAAGG - Intergenic
957012648 3:75025994-75026016 TTGGCCTAACACTTGAAGGGTGG + Intergenic
959127685 3:102309489-102309511 CTGGCCTAAAAGAAGAAGCAGGG + Intronic
959198585 3:103216749-103216771 ATGGCATATCAGGTGAAGTAAGG + Intergenic
960673765 3:120175700-120175722 CTGGCTTAGAAGGTGGAGGAGGG + Intronic
962936916 3:140089892-140089914 ATGGCTTAACAGTTAAAGGAAGG + Intronic
966191984 3:177279861-177279883 CTGGCTTTACAGGTGATGAATGG + Intergenic
966649603 3:182284888-182284910 CCTGCTGAACAGGTGAAGGAAGG - Intergenic
968356002 3:198107963-198107985 CTGGCCAAACTGGGGAGGGAGGG + Intergenic
968356016 3:198108043-198108065 CTGGCCAAACTGGGGAAGGAGGG + Intergenic
970554560 4:17218122-17218144 CTGGCTTTAAAGATGAAGGATGG - Intergenic
970694247 4:18657826-18657848 CGGGTCTACCAGGAGAAGGATGG - Intergenic
976783665 4:88791026-88791048 CTGGCCTAAGAGGAGAAGGAAGG - Intronic
978938791 4:114412969-114412991 CTGGTCTAATAGGGGAAAGAGGG + Intergenic
984281388 4:177674854-177674876 CTGGCCTAAGAGGAGGAGGTTGG + Intergenic
984868849 4:184309703-184309725 CTGGCCGCAGAGGTGGAGGACGG + Intergenic
986329768 5:6709088-6709110 CTGGCCAATCAGCTGAAGGCTGG - Intergenic
986580986 5:9265433-9265455 CAGGCCTTACAGTGGAAGGAAGG - Intronic
990327492 5:54692584-54692606 CTGGCCTAGGATGTGGAGGATGG + Intergenic
992754616 5:79892575-79892597 CTGGCTTAGAAGATGAAGGAAGG + Intergenic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993201955 5:84828244-84828266 CTGGCCAAACTGGTGAGGAAGGG - Intergenic
993727079 5:91380769-91380791 CCGGCCTTACAGGTGCTGGATGG - Intronic
995056868 5:107769192-107769214 CTTGCCCCACAGGTGAAGGCTGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
998094170 5:139388010-139388032 CTGGCCTACCAGGTGATGCCCGG - Exonic
1000163693 5:158626509-158626531 CTGGCTGAACGGGTGAGGGAAGG - Intergenic
1001962845 5:175890647-175890669 GTGGCCGCACAGGTGCAGGAGGG - Intergenic
1004720798 6:18265976-18265998 CAGGCCTACCAGCTGCAGGAAGG - Intergenic
1006824401 6:36923764-36923786 CTGGCCATGCAGGTGAAGAAAGG - Intronic
1007724962 6:43910091-43910113 CTGGACTTGCAGGTGAAGGAGGG - Intergenic
1008960185 6:57258610-57258632 GTGTCCTAACAGGTCAAGAATGG - Intergenic
1012449870 6:99343778-99343800 ATGGCATTACAGGTGAAAGAAGG - Intronic
1015005600 6:128277632-128277654 CTGGCCAAAGAAGTGAAGGTTGG + Intronic
1015427155 6:133084386-133084408 CTGGAGTAACACATGAAGGATGG - Intergenic
1015472683 6:133623654-133623676 CTGGCATAAAATGTGAAAGAAGG - Intergenic
1015701025 6:136036418-136036440 CCTTCCTAACAGGTGAAGAAGGG - Intronic
1018127074 6:160692037-160692059 CTGGCCCACCAGGTGAATCAGGG - Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021848711 7:24787250-24787272 CAGGCATCACAGGGGAAGGAGGG + Intergenic
1022141977 7:27500571-27500593 CTGACCTAACGGGGGAGGGATGG + Intergenic
1022488115 7:30795804-30795826 CTGGCTTCAAAGGTGAAGGAAGG - Intronic
1023285684 7:38616589-38616611 AATGCCTAACAGGTGAAGAATGG + Intronic
1024098551 7:46006026-46006048 CTGTCCTCACAGGTGAGAGAGGG - Intergenic
1030062835 7:105636642-105636664 CTGGCCTAACAGAGAAAGAAGGG - Intronic
1032161255 7:129512598-129512620 CTGGCATAACAGAGGAAGTAAGG - Exonic
1032397600 7:131601858-131601880 CTGGCAAAACAGGTTATGGACGG + Intergenic
1033190388 7:139273069-139273091 CTGACCTAAAAGGTGAATGTTGG + Intronic
1034183329 7:149155488-149155510 CTGACCTAATAGGTCCAGGATGG + Intronic
1034725363 7:153330733-153330755 CTGGGATAACAGGTCAAGGTAGG + Intergenic
1035767623 8:2119737-2119759 GAGGACTCACAGGTGAAGGAAGG + Intronic
1036491032 8:9225699-9225721 CTGGCCTACCAGGTAGATGAAGG + Intergenic
1040557591 8:48494997-48495019 CTCACCTAATAGGTCAAGGAAGG - Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1043064790 8:75555055-75555077 ATGGCCTCACAGGTGATGGGAGG - Intronic
1043165074 8:76893434-76893456 CTGGCCTTACAAGGAAAGGAAGG - Intergenic
1050119361 9:2292520-2292542 CTGGCCTAGCAGGAGAACAAAGG + Intergenic
1050841248 9:10151755-10151777 CTGGGCTTAGAGGTGAAGAAAGG - Intronic
1053513373 9:38708483-38708505 CTGGCCTGACAGGGGAGGTAGGG - Intergenic
1057556494 9:96092415-96092437 CTGGCCCCACAGCTGAAGGGTGG + Intergenic
1057771860 9:97975216-97975238 CTGGCCTCGAAGGTGGAGGAAGG - Intergenic
1059811353 9:117858927-117858949 CTAGCCAATCAGGTGAAGTAGGG - Intergenic
1060144862 9:121243209-121243231 CTGGCCTTGAAGATGAAGGAAGG - Intronic
1060682991 9:125582273-125582295 CTCACCAAACAGATGAAGGAAGG - Intronic
1061017276 9:127989179-127989201 CTGGCCTCCCAGCTGAAGGAGGG - Intergenic
1061158673 9:128880841-128880863 TTGGCTTAACACGTGATGGATGG + Intronic
1062069665 9:134548763-134548785 CTGGCCTGACGGGTGACAGAGGG - Intergenic
1187787918 X:22914107-22914129 CTTGCCTAATAGTAGAAGGATGG - Intergenic
1189147959 X:38674414-38674436 CTGGACTAAGAGTTGAAGAACGG - Intronic
1189573550 X:42325383-42325405 GTGGGCTCACAGGTAAAGGAAGG + Intergenic
1189594022 X:42545013-42545035 GTGGCCTAAGAGTTGAATGAAGG - Intergenic
1199604941 X:149569786-149569808 CTGACCTAACTGGAGATGGAGGG - Intergenic