ID: 1162019092

View in Genome Browser
Species Human (GRCh38)
Location 19:7860592-7860614
Sequence CTCCAGCTCGGTCTCCAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 237}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162019092_1162019101 9 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019101 19:7860624-7860646 CTGCGGGAGACGGAGACACTGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1162019092_1162019098 -7 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019098 19:7860608-7860630 GCTGGAGCAGTCGAGGCTGCGGG 0: 1
1: 0
2: 4
3: 35
4: 394
1162019092_1162019105 20 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019105 19:7860635-7860657 GGAGACACTGGGGGCCCTTCGGG 0: 1
1: 1
2: 2
3: 27
4: 207
1162019092_1162019099 -1 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019099 19:7860614-7860636 GCAGTCGAGGCTGCGGGAGACGG 0: 1
1: 0
2: 0
3: 35
4: 252
1162019092_1162019102 10 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019102 19:7860625-7860647 TGCGGGAGACGGAGACACTGGGG 0: 1
1: 0
2: 0
3: 12
4: 215
1162019092_1162019106 29 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019106 19:7860644-7860666 GGGGGCCCTTCGGGAGATGCAGG 0: 1
1: 0
2: 1
3: 20
4: 188
1162019092_1162019104 19 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019104 19:7860634-7860656 CGGAGACACTGGGGGCCCTTCGG 0: 1
1: 0
2: 2
3: 16
4: 157
1162019092_1162019103 11 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019103 19:7860626-7860648 GCGGGAGACGGAGACACTGGGGG 0: 1
1: 0
2: 1
3: 18
4: 219
1162019092_1162019100 8 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019100 19:7860623-7860645 GCTGCGGGAGACGGAGACACTGG 0: 1
1: 0
2: 2
3: 12
4: 191
1162019092_1162019097 -8 Left 1162019092 19:7860592-7860614 CCCACCTGGAGACCGAGCTGGAG 0: 1
1: 0
2: 2
3: 24
4: 237
Right 1162019097 19:7860607-7860629 AGCTGGAGCAGTCGAGGCTGCGG 0: 1
1: 0
2: 7
3: 40
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162019092 Original CRISPR CTCCAGCTCGGTCTCCAGGT GGG (reversed) Exonic
900525630 1:3127031-3127053 CTCCAGCTCGGGGCCCAGGCTGG - Intronic
902056560 1:13605650-13605672 GTCCTGCTCTGTCACCAGGTTGG + Intronic
903154417 1:21434428-21434450 CTCCAGCTGGGTCTGCAGCAGGG - Intergenic
904684125 1:32248489-32248511 CTCCAGCTCCAGCTCCAGCTCGG - Exonic
905884867 1:41486199-41486221 AGCCAGCTCAGTCTCCAGGAAGG - Intergenic
906140393 1:43530957-43530979 CTCCGGCTCCGGCTCCAGCTCGG + Exonic
907045993 1:51300332-51300354 CTTCAGCTTGGTCCCCAGGCAGG + Intronic
907833371 1:58086388-58086410 TTCCAGCTATGTCTACAGGTAGG - Intronic
908827673 1:68149230-68149252 CTCCAGGTGGGGCCCCAGGTGGG + Intronic
912273114 1:108229964-108229986 GTCCAGGTCGGTCTCAAGATGGG + Intronic
912295106 1:108464358-108464380 GTCCAGGTCGGTCTCAAGATGGG - Intronic
915238180 1:154501466-154501488 GTCCAGCTCGGGCCCCAGGGAGG + Exonic
918210539 1:182347309-182347331 CTGCAGCAAGGTCTGCAGGTAGG - Intergenic
919361764 1:196605470-196605492 CTCCAGCTTGTTCTCCAAGCAGG + Intronic
920170594 1:204070082-204070104 CTCCATCCTGGTCTCCAGGTGGG - Intergenic
921277917 1:213537598-213537620 CTCTAGCTCAGACTCCTGGTAGG - Intergenic
921358081 1:214305329-214305351 TTCCAGCTCTGGCTCCAGGAGGG - Intronic
921980498 1:221252186-221252208 CTCCAGCTCAGTCTGCAAGGAGG + Intergenic
922667280 1:227481509-227481531 GTCTAGCTCTGTCTCCAGGCTGG - Intergenic
923163429 1:231337491-231337513 GTACATCTCGCTCTCCAGGTAGG + Exonic
1063812961 10:9735401-9735423 GTCCAGCTCTGTCGCCAGGCTGG + Intergenic
1064951460 10:20855197-20855219 CTCTCGCTCTGTCTCCAGGATGG - Intronic
1067080253 10:43208651-43208673 CCCCAGGTGGGTCTCCAGGTAGG - Intronic
1070580307 10:77713984-77714006 CCCCAGCTCAGTCTTCAGGAAGG + Intergenic
1070589145 10:77789214-77789236 CCCCAGCACAGTCTCCATGTGGG + Intergenic
1073215013 10:101831254-101831276 CCCCAGCCCGGTCCCCAGATGGG - Intronic
1074459258 10:113622061-113622083 CTCCAGCTCACTCTGCAGCTTGG + Exonic
1075288697 10:121209605-121209627 CTCCAGGGCGGTCCTCAGGTTGG - Intergenic
1076896665 10:133316579-133316601 TTCCATCTCTGTGTCCAGGTCGG - Intronic
1077229505 11:1452313-1452335 TTCCAGCTGGGTGCCCAGGTCGG + Intronic
1077737677 11:4808432-4808454 CTCTAGCACAGTCTCCAGCTTGG + Intronic
1078484073 11:11705783-11705805 CTACATCCCGCTCTCCAGGTAGG - Intergenic
1081329737 11:41788544-41788566 GGCCAGCTGGGGCTCCAGGTGGG - Intergenic
1083013251 11:59424375-59424397 GTCTCGCTCGGTCACCAGGTTGG - Intergenic
1083410833 11:62491246-62491268 CTCCAGCTCACCCTCCATGTGGG + Intronic
1083668379 11:64287251-64287273 CTCCAGCTCGCCCTCCATGGTGG - Intronic
1084567305 11:69938455-69938477 CTCCACCCCGCTCTGCAGGTAGG + Intergenic
1085051079 11:73380598-73380620 CCCCAGCCTGGTCTCCAGGCAGG + Intronic
1085423609 11:76383747-76383769 GTCTAGCTCTGTCGCCAGGTTGG - Intronic
1088624766 11:111721923-111721945 CTGCAGCACAGACTCCAGGTGGG + Exonic
1089647028 11:119887056-119887078 CTCCAGCTAGAACTCCAGCTGGG + Intergenic
1089732428 11:120527505-120527527 CCCCAGCACGGGCTCCAGGAAGG - Intronic
1090296254 11:125591245-125591267 GTCCAGCTCTGTCGCCAGGCTGG + Intergenic
1092391293 12:8082284-8082306 CTCCAACTCGGTCGCCATCTTGG - Exonic
1095085869 12:38056818-38056840 CACCAGCTCTGACTCCAGGAAGG + Intergenic
1099142953 12:79002553-79002575 CTCAATTTCGGTATCCAGGTAGG + Intronic
1099273931 12:80551148-80551170 CTCCAACTAGGTCTTCAGTTGGG - Intronic
1099563261 12:84206106-84206128 CTCCAGCTTGGGCGACAGGTAGG - Intergenic
1101090664 12:101281732-101281754 GTCTCGCTCCGTCTCCAGGTTGG + Intronic
1102956622 12:117063218-117063240 CTCCAGCTCTGCCTCCAGGCTGG + Intronic
1102990202 12:117310015-117310037 TCCCACCTCGGTCTCCAGGGTGG + Intronic
1103967887 12:124651902-124651924 CTCCAGATTGATCTCCAGCTGGG + Intergenic
1105326299 13:19373355-19373377 CTCAAGCTCGGTCTACAGTCCGG - Intergenic
1108245108 13:48506159-48506181 CTCCAGCTCTGCCTGCATGTTGG - Intronic
1108710629 13:53028971-53028993 CTTCAGCTCCAGCTCCAGGTCGG + Exonic
1114490079 14:23095032-23095054 CTCCAGTGCGGCCTTCAGGTCGG + Exonic
1114508761 14:23238705-23238727 GTCTGGCTCTGTCTCCAGGTTGG - Intronic
1114517276 14:23308150-23308172 AGCCAGCTGCGTCTCCAGGTAGG - Exonic
1115332334 14:32211902-32211924 GTCTCGCTCTGTCTCCAGGTTGG + Intergenic
1115771659 14:36668416-36668438 GTCTAGCTCTGTCGCCAGGTTGG + Intronic
1116203482 14:41830765-41830787 CTCCTGCTCTGTCTCCTGGTGGG + Intronic
1117186177 14:53243200-53243222 GTCTAGCTCTGTCTCCAGGCTGG + Intergenic
1117574571 14:57085202-57085224 CTTTATCACGGTCTCCAGGTTGG - Intergenic
1117963937 14:61188426-61188448 CTCCGGCTCCGGCTCCGGGTCGG + Intronic
1119019518 14:71096286-71096308 GTCTAGCTCTGTCTCCAGGCTGG - Intronic
1121455971 14:94039039-94039061 CCCCAGCAGGGACTCCAGGTAGG - Exonic
1121463284 14:94098346-94098368 CTCCATCTCTGTCTTCACGTGGG + Intronic
1122884751 14:104706049-104706071 CTCCAGCTGGATCAGCAGGTCGG - Exonic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1125905997 15:43393237-43393259 GTCTTGCTCTGTCTCCAGGTTGG + Intronic
1129369597 15:75081763-75081785 CTCTAACTCTGTCTCCAGGCTGG - Intronic
1129424479 15:75454187-75454209 CTCCAGCCCGGCCTCCCGATAGG + Intronic
1129458563 15:75688629-75688651 CTCCAGGGTGGCCTCCAGGTGGG + Exonic
1129725230 15:77898243-77898265 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1129857519 15:78835234-78835256 GTCTTGCTCTGTCTCCAGGTTGG + Intronic
1130050212 15:80478254-80478276 CCCCAGCTGGGTCTCCAGACTGG - Intronic
1130273279 15:82463449-82463471 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1130465630 15:84190820-84190842 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1130487061 15:84404000-84404022 CTCCAGGGTGGCCTCCAGGTGGG + Intergenic
1130498635 15:84482716-84482738 CTCCAGGGTGGCCTCCAGGTGGG + Intergenic
1130587920 15:85195415-85195437 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1133257902 16:4529277-4529299 CTCCTGCTGGGTCTCCTGGCGGG - Intronic
1134372641 16:13639475-13639497 GTCTAGCTCCGTCTCCAGGCTGG - Intergenic
1134625200 16:15718372-15718394 CTCCAGCTCCTCCTCCAGCTGGG + Exonic
1135463264 16:22663396-22663418 CTCCTGCTCCTTCTCAAGGTAGG - Intergenic
1136392383 16:29973856-29973878 CTCCCGCCCGGTCTCCATCTTGG + Exonic
1136548977 16:30971702-30971724 CTCCAGCAAGGCCTGCAGGTAGG + Exonic
1139416152 16:66812545-66812567 CTCTTGCTCTGTCTCCAGGCTGG + Intronic
1140263465 16:73400470-73400492 CCACAGCTCGGTCTCCACGGGGG + Intergenic
1141523823 16:84598765-84598787 CTCCCGCTTGGTCTCCTGCTTGG - Intronic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1142006541 16:87692059-87692081 GTCCTGCCCGGTCTCCAGCTGGG + Intronic
1142218878 16:88843099-88843121 CTTCTGCTTGGTCTTCAGGTGGG + Intronic
1142230436 16:88897684-88897706 TTGCAGCTGGGACTCCAGGTAGG + Intronic
1142636310 17:1259921-1259943 GTCTCGCTCGGTCTCCAGGCTGG - Intergenic
1142722306 17:1784797-1784819 GTCTCGCTCGGTCTCCAGGCTGG + Intronic
1143125320 17:4638217-4638239 CTCCAGCTCCTTCTCCAGCTGGG + Exonic
1143403184 17:6658892-6658914 CTCCAGCTCCTTCTCCAGCTGGG - Intergenic
1144071889 17:11681518-11681540 CTCCAGCTTGGCCTCCTGGTTGG - Intronic
1145991160 17:29080271-29080293 CTCCAGGTCTGGGTCCAGGTAGG + Intronic
1146645803 17:34576917-34576939 CTCCAGCCCGGGCTCCAGTTGGG + Exonic
1146835673 17:36108660-36108682 CCCCAGCTCACTCTCCAGATGGG + Intergenic
1146850305 17:36215930-36215952 CCCCAGCTCACTCTCCAGATGGG + Intronic
1147539647 17:41346567-41346589 CGCCAGCTGGGACTCCACGTTGG + Exonic
1147541597 17:41364898-41364920 CGCCAGCTGGGACTCCACGTTGG + Exonic
1147545074 17:41394967-41394989 CGCCAGCTGGGACTCCACGTTGG + Exonic
1147545272 17:41396465-41396487 CTCCACCTGGGCCTCCAGGTCGG + Exonic
1147548714 17:41422823-41422845 CTCCTGCTGGGCCTCCAGGTCGG + Exonic
1147550671 17:41439248-41439270 CTCCTGCTGGGCCTCCAGGTCGG + Exonic
1147898365 17:43767334-43767356 GTGCAGCTCTTTCTCCAGGTGGG - Exonic
1148863902 17:50618821-50618843 CTCCAGCTCAGCCTCTAGCTCGG - Exonic
1151040173 17:70850415-70850437 CTCTTGCTCTGTCTCCAGGCTGG + Intergenic
1151426828 17:74036147-74036169 GTCTAGCTCTGTCTCCAGGGTGG - Intergenic
1151905230 17:77043608-77043630 ATCTAGCTCTGTCTCCAGGCTGG - Intergenic
1152388803 17:79991169-79991191 GCCCAGCTGGGTCTCCAGGGTGG - Intronic
1152391643 17:80007252-80007274 CCCCAGCACGGTCTCCGGGTGGG + Intronic
1155007228 18:21740620-21740642 CTCCAGCCCCGCCTCCAGGACGG + Intronic
1157538979 18:48485617-48485639 CTCTTGCTCTGTCTCCAGGCTGG - Intergenic
1157569169 18:48700812-48700834 CTCCACCTCTGTCTCCAAGAGGG - Intronic
1161477471 19:4494447-4494469 CTCCAGCTCGGCCTCGGGCTCGG - Exonic
1162019092 19:7860592-7860614 CTCCAGCTCGGTCTCCAGGTGGG - Exonic
1162226522 19:9227257-9227279 GTCCTGCTCTGTCACCAGGTGGG + Intergenic
1164509956 19:28888970-28888992 CTCCAGCTCCGGCTGCAGATGGG + Intergenic
1164808618 19:31138556-31138578 CTCCAGCTAGGTCCACAGCTTGG + Intergenic
1166789868 19:45392300-45392322 CTCCGGCTCAGGCTCCAGCTCGG + Exonic
1166792209 19:45405032-45405054 CTCCAGCTCGGGCTCCGGCTTGG + Intronic
1166851113 19:45761807-45761829 CTCCAGCTCCAGCTCCAGCTCGG + Exonic
1168136167 19:54353450-54353472 CTGCAGCTCGGTCTGCTGGGAGG - Exonic
1168153412 19:54460789-54460811 GGCCAGCTCGGCCTGCAGGTAGG - Exonic
927786871 2:25980733-25980755 CTCCAGCTGGGCCTTCAGGCGGG + Exonic
928095838 2:28404503-28404525 CTCCAGCTCGGCCTCCAGTAAGG - Intronic
928708256 2:33975931-33975953 GTCTAGCTCTGTCTCCAGGCTGG + Intergenic
932589898 2:73059031-73059053 GTCCAGCTCTGCCTCCAGGGGGG + Intronic
933720204 2:85392813-85392835 CTGCAGCTCGGCCTCCACTTTGG + Intergenic
934113762 2:88765394-88765416 CTGCAGCTCGGGCTCCGGCTGGG - Intergenic
935059258 2:99593603-99593625 CTCCTGCTCGGACTCCAGGTCGG + Exonic
935639711 2:105279285-105279307 GTCTAGCTCTGTCTCCAGGCTGG + Intronic
935645600 2:105330873-105330895 CACCGGCTCAGCCTCCAGGTAGG + Intergenic
935845833 2:107164703-107164725 CTCCTGCTGTGTCCCCAGGTTGG - Intergenic
937273744 2:120671335-120671357 CACCCGCTCGGTCTCCAGCCAGG - Intergenic
937557853 2:123181070-123181092 CTCCAGCTCAATGTCCAGGTGGG + Intergenic
940895791 2:159080980-159081002 CTCCACCTCGGGCTCCCTGTGGG + Intronic
941137724 2:161738380-161738402 CTCCAGCACTGTCTCATGGTTGG + Intronic
942070585 2:172312228-172312250 CTCCCCCTCGGTATCAAGGTAGG - Intergenic
943464581 2:188213373-188213395 GTCTAGCTCTGTCGCCAGGTTGG + Intergenic
946423092 2:219575898-219575920 GTCCAGCTCTGTCTCCAAGGTGG - Intergenic
946819697 2:223617105-223617127 GTCTAGCTCTGTCACCAGGTTGG - Intergenic
947549700 2:231037561-231037583 CTCCAGCTCGCGCTCCATGCTGG - Exonic
948776755 2:240293207-240293229 CTCCAGCTCAGTCTGCCGGGAGG - Intergenic
948781137 2:240322672-240322694 CTCCACCTCGGGCCCCAGCTGGG + Intergenic
1171182212 20:23099076-23099098 GTCCCGCTCTGTCACCAGGTTGG + Intergenic
1172654762 20:36529932-36529954 CCCCAGCTGGGTCTCAGGGTAGG - Intergenic
1173015746 20:39223980-39224002 CTCCAGCTGTGTCACCAGGGAGG - Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174295297 20:49541214-49541236 CTCCTGCTAGGTTTCCAGGTGGG - Intronic
1174503812 20:51004162-51004184 CTCCTGCTTGAGCTCCAGGTAGG + Exonic
1174795209 20:53516708-53516730 CTCTCGCTCTGTCACCAGGTGGG + Intergenic
1175421982 20:58840474-58840496 CTCAGGCTCGGTCTCGAAGTCGG - Intronic
1177076162 21:16575858-16575880 GTCTAGCTCCGTCTCCAGGATGG - Intergenic
1177643025 21:23868227-23868249 GTCCAGCTCTGTCACCAGGTTGG - Intergenic
1179056326 21:37938398-37938420 GTCTCGCTCTGTCTCCAGGTTGG - Intergenic
1180701821 22:17785351-17785373 CACCAGCTCGGTGTCCTGGCGGG - Intergenic
1182549604 22:31093713-31093735 CTCCAGCTCAGGCTCAAGGCCGG - Intronic
1183184791 22:36285715-36285737 CTCCAGCTCCTCCTCCAGCTGGG + Exonic
1183347236 22:37314667-37314689 AGCCAGCTCTGTCTCCAGGGAGG + Exonic
1184084592 22:42252479-42252501 GTCCAGCTCTGTCGCCAGGCTGG + Intronic
1185039747 22:48497929-48497951 CTTCAGCCCCGCCTCCAGGTGGG - Intronic
1185039761 22:48497964-48497986 CTTCAGCCCCGCCTCCAGGTGGG - Intronic
1185039775 22:48497999-48498021 CTTCAGCCCCGCCTCCAGGTGGG - Intronic
1185039824 22:48498136-48498158 CTTCAGCCCCGCCTCCAGGTGGG - Intronic
1185039873 22:48498273-48498295 CTTCAGCCCCGCCTCCAGGTGGG - Intronic
1185340727 22:50289790-50289812 CTGCAGGTCCATCTCCAGGTAGG + Exonic
1185398432 22:50604108-50604130 CTCCAGCTCCGTCTCCGAGATGG - Exonic
950452848 3:13074943-13074965 TTCCAGCTCAGTGTCCTGGTAGG + Intergenic
950518450 3:13482009-13482031 GCCCAGTTCGGTCTACAGGTGGG - Intronic
950522459 3:13505193-13505215 CTGGAGCTAGGTCTCCAGGTGGG + Exonic
952280277 3:31916118-31916140 ATCCAGCACTGTCTCCAGGAGGG + Intronic
953420781 3:42751677-42751699 CTCCAACTCTGTCTCCAGAAAGG - Intronic
954365689 3:50144966-50144988 CTCTGGCTCGGTGTCCAGGCTGG - Intergenic
957479717 3:80775618-80775640 GTCCAGCTCTGTCGCCAGGCTGG - Intergenic
958555365 3:95668482-95668504 GTCCCGCTCGGTCGCCAGGCTGG + Intergenic
960993903 3:123328798-123328820 CTCCTGCTCCATCCCCAGGTTGG - Exonic
961081467 3:124032725-124032747 CTTCAGATCGGTCTCCAAGCTGG - Intergenic
961231465 3:125315677-125315699 GTCCTGCTCTGTCACCAGGTTGG - Intronic
961415445 3:126753365-126753387 CTCCTCCTCAGCCTCCAGGTGGG - Intronic
965941896 3:174194417-174194439 GTCTAGCTCTGTCTCCAGGCTGG - Intronic
967247866 3:187506016-187506038 CTCCAGCTTTGGCTCCAGTTAGG - Intergenic
968127017 3:196167570-196167592 CTCCATGTTGGTCTCCAGGCTGG + Intergenic
968679323 4:1905773-1905795 CTTCAGCTCTGTCTCCATGGAGG + Intronic
969227500 4:5808305-5808327 CTGTAGCTGGGTCTCCAGCTGGG - Exonic
969319042 4:6399954-6399976 TTCCTGCTCTGTCTCCATGTTGG + Intronic
969476586 4:7425679-7425701 GCCCAGCTCAGTCTTCAGGTGGG + Intronic
969802507 4:9580510-9580532 GTCTAGCTCTGTCACCAGGTTGG + Intergenic
970859985 4:20691408-20691430 GTCCTGCTCTGTCACCAGGTTGG + Intergenic
971788344 4:31134428-31134450 GTCTAGCTCTGTCACCAGGTTGG - Intronic
974093492 4:57336730-57336752 CTCCAGCTCTTTCACCATGTGGG + Intergenic
974469763 4:62303042-62303064 CTCCACCTCTGGCTCCAGGCAGG + Intergenic
975999814 4:80360319-80360341 CTCCAGCACAGTCTTCAGGAGGG - Intronic
979758765 4:124374117-124374139 ATCCAGCTGGGGATCCAGGTTGG + Intergenic
981087209 4:140696425-140696447 CTCTTGCTCTGTCTCCAGGCTGG - Intronic
984376658 4:178938951-178938973 GTCCCGCTCTGTCACCAGGTTGG - Intergenic
985041017 4:185891861-185891883 GTCTTGCTCTGTCTCCAGGTTGG + Intronic
988160054 5:27508005-27508027 GTCTCGCTCTGTCTCCAGGTTGG + Intergenic
988441982 5:31243676-31243698 CTCCAGCTCAGACTCCAGGCAGG + Intronic
988568969 5:32344918-32344940 GTCCTGCTCTGTCTCCAGGCTGG - Intergenic
988650378 5:33142235-33142257 GTCTTGCTCTGTCTCCAGGTTGG - Intergenic
994280221 5:97893063-97893085 CTCCAGTTCAGCCTCCAAGTTGG - Intergenic
996563006 5:124850863-124850885 GTCTCGCTCTGTCTCCAGGTTGG - Intergenic
998051043 5:139035676-139035698 CTCCTGCTCAGTCGCCAGGCTGG + Intronic
998165231 5:139838847-139838869 CCCCAGCTCTGTCTCTAGGCTGG + Intronic
999831183 5:155321821-155321843 CTGGAGCTCTGTCACCAGGTGGG - Intergenic
1001137349 5:169113683-169113705 GTCTTGCTCTGTCTCCAGGTTGG + Intronic
1002172877 5:177385181-177385203 CTCCTCCTTGCTCTCCAGGTGGG + Intronic
1002377833 5:178800997-178801019 CTCTTGCTCTGTCTCCAGGCTGG - Intergenic
1005824392 6:29623925-29623947 CTGCAGCTCTGTCTCCACGCTGG - Exonic
1006119755 6:31796524-31796546 CTGCAGCTCTGTCGCCAGGCTGG - Intergenic
1006459914 6:34152316-34152338 CTCCAGCACGGACACCAGGCAGG + Intronic
1007429816 6:41770422-41770444 CTCCTGGTCTGTCTCCAGGCTGG - Exonic
1007447758 6:41920410-41920432 CTCCAACCCTGTCTGCAGGTGGG + Intronic
1010819635 6:80397847-80397869 GTCTTGCTCTGTCTCCAGGTTGG - Intergenic
1011458556 6:87578928-87578950 CTCTCGCTCTGTCTCCAGGCTGG - Intronic
1012912277 6:105131993-105132015 GTCTAGCTCTGTCGCCAGGTTGG + Intronic
1013658785 6:112273219-112273241 GTCCAGCTCTGTCGCCAGGCTGG + Intergenic
1014504635 6:122240181-122240203 ATCTAGCTCTGTCTCCAGGCTGG + Intergenic
1015595758 6:134865070-134865092 CTCCATCTGGGACTACAGGTGGG - Intergenic
1015720071 6:136232282-136232304 CTCTAGCTCTGTCGCCAGGCTGG + Intronic
1017576025 6:155805398-155805420 CTCTAGCTCTGTCCCCAGGCTGG - Intergenic
1018114983 6:160574266-160574288 CTCCAAGTCTGTTTCCAGGTGGG + Intronic
1019110178 6:169702827-169702849 CTCGAACTCGCTCTCCAGGTGGG - Exonic
1019619027 7:1980524-1980546 CTTCAGCTCCATCTCCAGCTAGG + Exonic
1019724370 7:2593054-2593076 CTCCAGCTCCTTCTCCAGGTCGG - Exonic
1024700327 7:51899509-51899531 CTCCAGCTCCTTCTGCAGGCTGG - Intergenic
1026155786 7:67824523-67824545 GTCTTGCTCGGTCTCCAGGCTGG + Intergenic
1026611890 7:71867462-71867484 GTCTAGCTCTGTCTCCAGGCTGG + Intronic
1026798770 7:73383942-73383964 GTCTTGCTCTGTCTCCAGGTTGG - Intergenic
1032117831 7:129132047-129132069 GTCTAGCTCTGTCTCCAGGCTGG + Intergenic
1033315693 7:140295433-140295455 CTCCCGCTATGTCTCCAGTTAGG - Intronic
1034335613 7:150321812-150321834 CTCCAGCTTGGGCTACAGCTGGG - Intronic
1035318004 7:158009195-158009217 CACCATCTCACTCTCCAGGTCGG + Intronic
1039163897 8:34654646-34654668 ATCTTGCTCGGTCTCCAGGCTGG - Intergenic
1043932142 8:86103541-86103563 CTCCAGCAGTGTCTTCAGGTAGG + Intronic
1045015306 8:97996404-97996426 CTACAGATTGGTCCCCAGGTGGG + Intronic
1047625429 8:126651506-126651528 GTCTAGCTCTGTCTCCAGGCTGG + Intergenic
1049023823 8:139975044-139975066 CTCCAGCTCACTCTCCAGGCTGG + Intronic
1049375992 8:142289446-142289468 CCCCAGCTCGGTCGCCAGGAGGG - Intronic
1049682481 8:143925819-143925841 CTCCAGCGCGGCCTCCACCTCGG + Exonic
1050135787 9:2462172-2462194 TTCCATCTCGGTCTCCAGAGGGG - Intergenic
1054458720 9:65450453-65450475 CTCCAGCCCTGGCTCCAGATGGG - Intergenic
1056141973 9:83690700-83690722 CTCCAGCTTGGTCAACAGCTTGG + Intronic
1057164482 9:92914990-92915012 CTCCAGCTCCTTCTCCAGCTGGG - Intergenic
1059311060 9:113389450-113389472 CTCCCGCACGATGTCCAGGTAGG + Exonic
1059455271 9:114396647-114396669 GTCTAGCTCTGTCTCCAGGCTGG - Intergenic
1059487562 9:114638451-114638473 CTTCTGCTCGGTCTGCAGCTTGG + Intronic
1062278910 9:135743363-135743385 CTTCAGCGCGGTCTCCAGGAGGG + Intronic
1062431090 9:136527180-136527202 CTCCAGCTCTGTGGCCATGTGGG - Intronic
1062509845 9:136898805-136898827 TTCCAGCTTGGTCCCCAGGAGGG - Exonic
1203792824 EBV:160771-160793 CTCCAGCTCGGCCAGCAGGCCGG + Intergenic
1186757528 X:12688268-12688290 CTTTACCTCGGTCTTCAGGTGGG - Intronic
1187872311 X:23774853-23774875 CTCTCGCTCTGTCTCCAGGCTGG + Intergenic
1190078388 X:47335855-47335877 GTCTAGCTCTGTCTCCAGGCTGG + Intergenic
1197205696 X:123788208-123788230 GTCTCGCTCGGTCTCCAGGCCGG + Intergenic
1198111522 X:133506498-133506520 CTTCATCTCTGTCTCCAAGTTGG - Intergenic
1199684975 X:150257648-150257670 CTCCATCTTGTTCTCCAGGGAGG + Intergenic
1202605484 Y:26636258-26636280 CTCAAGCTCGGTCTACAGTCCGG + Intergenic