ID: 1162027198

View in Genome Browser
Species Human (GRCh38)
Location 19:7901049-7901071
Sequence TCTGGGGCCCAGGAGGATCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162027186_1162027198 20 Left 1162027186 19:7901006-7901028 CCAGGCCAGGAGATGGGGGGGGC 0: 1
1: 0
2: 2
3: 76
4: 754
Right 1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG 0: 1
1: 0
2: 3
3: 28
4: 357
1162027178_1162027198 30 Left 1162027178 19:7900996-7901018 CCAAGTGGGTCCAGGCCAGGAGA 0: 1
1: 0
2: 1
3: 20
4: 188
Right 1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG 0: 1
1: 0
2: 3
3: 28
4: 357
1162027190_1162027198 15 Left 1162027190 19:7901011-7901033 CCAGGAGATGGGGGGGGCGGGGG 0: 1
1: 0
2: 14
3: 124
4: 1107
Right 1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG 0: 1
1: 0
2: 3
3: 28
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162027198 Original CRISPR TCTGGGGCCCAGGAGGATCT GGG Exonic
900180990 1:1310880-1310902 TCTGGGTCACAGGTGGCTCTGGG + Intronic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
900462653 1:2808952-2808974 TCTGGGGCTGTGGAGGAGCTGGG + Intergenic
900572599 1:3366059-3366081 TGTGGGGCCAGGGAGGGTCTGGG + Intronic
900576619 1:3385749-3385771 TCAGAGGCCCCGGAGGCTCTAGG - Intronic
902705014 1:18198721-18198743 ACTGGGCCCCAGGTGGAACTGGG + Intronic
903019474 1:20383964-20383986 TCTGGGGCCCAGGAAGGATTTGG - Intergenic
903937240 1:26904885-26904907 TCTGTCGCCCAGGCAGATCTTGG + Intronic
904464344 1:30699010-30699032 CCTGGGGCCCTGCAGGCTCTGGG - Intergenic
905347660 1:37322242-37322264 TCTGGGGCTGAGGAGGCTCCAGG - Intergenic
905540788 1:38758823-38758845 TCTGGGGATCAGGATGATCTGGG - Intergenic
906283475 1:44569855-44569877 GCTGGGGCCCAGGACGATGCGGG - Intronic
907106865 1:51891203-51891225 ACTGGAGCACAGTAGGATCTTGG - Intergenic
907577373 1:55539426-55539448 TCTGGAGCCCACTAGGATTTAGG + Intergenic
907737743 1:57131472-57131494 TCTGGGACTCAGAAGTATCTGGG - Intronic
907818347 1:57942095-57942117 TCTGGCTCCCAGGATGCTCTGGG + Intronic
908930515 1:69312150-69312172 GCTCAGGCCCAGGAAGATCTGGG + Intergenic
909067299 1:70950747-70950769 TCTGTCGCCCAGGACGATCTTGG + Intronic
910851366 1:91652201-91652223 GCTGGGGCCAAGGAGGCTCTGGG + Intergenic
912470684 1:109904841-109904863 TCCAGGGGCCAGGAGGATGTGGG - Intergenic
914980520 1:152410741-152410763 TCTGGGGCCTCGCAGGAGCTGGG - Exonic
915678151 1:157551223-157551245 TCTGGGGTCAAACAGGATCTAGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917120497 1:171641138-171641160 TGTGGGGGCCAGTAGTATCTGGG + Intronic
917782361 1:178411848-178411870 TCTGGGCCACAGGAGGAAATAGG + Intronic
919162615 1:193850983-193851005 GCTGGGGCACAGCAGGGTCTGGG + Intergenic
922532874 1:226357744-226357766 TCTAGAGCCCAGGAGATTCTCGG - Intergenic
922774872 1:228210084-228210106 TCTGGGGCTGGGGAGGACCTGGG - Intronic
923620535 1:235575730-235575752 TCTGTGGCTCATGAGGCTCTGGG - Intronic
1062823709 10:553167-553189 ACTGGGGCCCAGGAAGAGCTGGG + Intronic
1067700584 10:48568618-48568640 TCTGGGACTCAGGTGGATATGGG + Intronic
1070143934 10:73760115-73760137 TCTGGATCCCAGGATGACCTTGG - Exonic
1071336989 10:84608381-84608403 TCTGGGTTACAGGAGGATGTAGG + Intergenic
1071365011 10:84890602-84890624 TCTGGGAGCCAGGTGGGTCTGGG + Intergenic
1072791442 10:98321070-98321092 ACTGGGGCCCCTGGGGATCTGGG + Intergenic
1073444158 10:103571001-103571023 GCTGAGGTCCATGAGGATCTGGG - Exonic
1073509339 10:104033683-104033705 TCTGGGACCCAGAACGAGCTAGG + Intronic
1073509470 10:104034281-104034303 CCTGCGGCCCAGGAGGGCCTGGG + Exonic
1074355630 10:112780993-112781015 TCTGTTGCCCAGGCTGATCTCGG + Intronic
1075206821 10:120456242-120456264 GCTGGAGCCCAGCAGGAGCTTGG - Intergenic
1075573654 10:123563008-123563030 ACTGGGGCCCTGGAGGATGCTGG - Intergenic
1076276525 10:129204195-129204217 TCTGGAGCCCACGAGGGTCTGGG + Intergenic
1076610379 10:131722508-131722530 TCAGGGGCCAACGATGATCTAGG - Intergenic
1076761005 10:132605597-132605619 GATGGGGCCCAGGAGGCCCTGGG + Intronic
1076810552 10:132884363-132884385 TCTGGGGTCCAGGGGGCCCTTGG - Intronic
1077184493 11:1230173-1230195 TGAGGGTCCCAGGAGGGTCTGGG - Intronic
1077257920 11:1597307-1597329 GCAGCGGCCCAGGAGGATCCAGG + Exonic
1078007115 11:7540381-7540403 TCTGGTGCCCAGTTGGATGTGGG + Intronic
1079073516 11:17368403-17368425 TATGGGGCCCAGGATGATCCTGG + Intronic
1079336831 11:19577478-19577500 TAGGGGGCCCAGGAGGAGCCGGG - Intronic
1080423631 11:32136362-32136384 GCTGGGGCCAAGGAGGAATTGGG + Intergenic
1081200575 11:40210215-40210237 TCTGTCGCCCAGGCCGATCTTGG - Intronic
1081813528 11:45926420-45926442 CCTGGGACCCAGGAGGGTGTTGG - Exonic
1081999996 11:47389065-47389087 TCTAGGTCTCAGGTGGATCTGGG - Intergenic
1083495462 11:63048035-63048057 TCTGAGGCCCTGGAGGATATGGG + Intergenic
1084288626 11:68147484-68147506 GCTGGGGGCCAGGAGGAAGTTGG + Intergenic
1084948094 11:72649796-72649818 TCTGTGGCTCAGGATGATCAGGG - Intronic
1085026529 11:73239771-73239793 GCTGGGGGCCTGGAGGGTCTTGG - Intergenic
1085427451 11:76417247-76417269 TCTGGAGTGCAGGAGGATTTAGG - Intergenic
1086054425 11:82630217-82630239 TCTTGGGCCCAGGAGAATGAAGG + Intergenic
1087062104 11:93989270-93989292 ACTGGAGCCCAGGAAGAGCTGGG + Intergenic
1087714110 11:101587145-101587167 TCTGTGGCCTATTAGGATCTGGG - Intronic
1088699122 11:112396413-112396435 TCCAGGGACCAGGAGGCTCTTGG - Intergenic
1089643248 11:119861298-119861320 CCTGGGCCCCAGGAGGCCCTGGG + Intergenic
1089683969 11:120135114-120135136 TCTGGTGGGCAGGAGGGTCTTGG - Intronic
1091205072 11:133815122-133815144 TGTGGGGGTCAGGAGGGTCTGGG + Intergenic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1091830978 12:3551116-3551138 GCAGGTGGCCAGGAGGATCTAGG - Intronic
1094852664 12:34389222-34389244 CCTGGGGCCCAGGAGACCCTGGG + Intergenic
1096103934 12:48985832-48985854 CCTGAGGCCCAGGAGGAAGTGGG + Intergenic
1096111627 12:49032237-49032259 TTGGGGGCCCAGAAGGTTCTGGG + Exonic
1096403128 12:51323910-51323932 TCAGGGGCCCCGAAGGGTCTGGG - Intronic
1096843050 12:54390800-54390822 TCCTGGGCCCAGAAGGATGTCGG + Intronic
1097185585 12:57194729-57194751 AGTGGGGCCCAGCAGGCTCTTGG - Intronic
1101772218 12:107761533-107761555 TCTGCTGCCCAGGAGGAATTGGG + Intergenic
1103516185 12:121509841-121509863 TCTGAGGACCAGGAGGCCCTCGG - Exonic
1103906082 12:124327866-124327888 CCTGGGGCCCCGGAAGCTCTTGG + Intronic
1104604787 12:130179951-130179973 GATGGGGTCCAGGAGGAGCTGGG - Intergenic
1104768951 12:131348387-131348409 TCTTGGGCACAGGAGGAACGGGG - Intergenic
1104810802 12:131619255-131619277 TCTTGGGCACAGGAGGAGCGGGG + Intergenic
1105063117 12:133172296-133172318 TCCAGGGCTCAGGAGGATCAAGG - Intronic
1105475096 13:20721911-20721933 GTTGGGGCCCAGCAGGAGCTTGG - Exonic
1105701170 13:22936590-22936612 TCCAGGGGCCAGGAGGATCGGGG + Intergenic
1105854003 13:24359641-24359663 TCCAGGGGCCAGGAGGATCGGGG + Intergenic
1106100832 13:26694345-26694367 CCTGGTGCCCAGGGGCATCTCGG - Intergenic
1106195441 13:27490391-27490413 TCTGGAGCCCAGGAGGCTTGTGG - Intergenic
1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG + Intergenic
1107976427 13:45693017-45693039 TGTGAGACCCAGAAGGATCTGGG + Intergenic
1108811790 13:54234661-54234683 TCTGTCGCCCAGGCTGATCTCGG + Intergenic
1111242349 13:85491841-85491863 CCTGTGGCCCAGGCTGATCTTGG + Intergenic
1111804339 13:93020761-93020783 GCTTGGGCCCAGGAGGTTCACGG + Intergenic
1113088800 13:106595849-106595871 TCTCGAGGCCAGGAGGAGCTGGG + Intergenic
1113273882 13:108706887-108706909 TCTGGGGCTAAGGTGGGTCTCGG + Intronic
1113800539 13:113084237-113084259 TCTGGGGTTCAGGAGGTTCTGGG - Intronic
1113800554 13:113084293-113084315 CCTGGGGTACAGGAGGTTCTGGG - Intronic
1113800560 13:113084310-113084332 TCTGGGGTACAGGAGGTCCTGGG - Intronic
1113800565 13:113084327-113084349 TCTGGGGTTCAGGAGGTTCTGGG - Intronic
1114317673 14:21523290-21523312 TCTGGGGCAGAGGAGGAGGTGGG - Exonic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1116805555 14:49490952-49490974 TCTGGTGCCCAGGAGATTTTGGG + Intergenic
1117450374 14:55844373-55844395 CCTGGGTCTCAGGAGGATGTCGG - Intergenic
1117624988 14:57626473-57626495 TCTGGGGTCCAGGGACATCTGGG + Intronic
1117625099 14:57628134-57628156 TCTGGGGTCCAGGGACATCTGGG - Intronic
1118346834 14:64947125-64947147 TTTGGGTCCCAGGAGAACCTTGG + Exonic
1118374912 14:65168336-65168358 ACTGAGGCCCAGAAAGATCTTGG + Intergenic
1118819056 14:69333214-69333236 TCAGGGGCCTGGGAGGCTCTTGG + Intronic
1118821613 14:69349592-69349614 TCTGAGGCACAGGAGCCTCTCGG - Intronic
1119310737 14:73644536-73644558 TCTGGCTCCCTGGAGGATCCGGG + Intergenic
1119473296 14:74912353-74912375 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1119473304 14:74912390-74912412 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1119485055 14:74981554-74981576 CCTTGGGCTCAGGCGGATCTTGG + Intergenic
1121422068 14:93823427-93823449 TCTGGGATCCTGGAGGGTCTGGG - Intergenic
1122239173 14:100350700-100350722 TGTGGGGCCCAGGAGGGGATGGG + Intronic
1122770116 14:104094050-104094072 CCTGGGGCCTGGGAGCATCTGGG + Intronic
1122791728 14:104186779-104186801 TCTGGGGGCCATGGGGACCTGGG - Intergenic
1123129916 14:105976741-105976763 GCTGTGGCTCAGGAGGACCTAGG + Intergenic
1123410440 15:20054486-20054508 GCTGTGGCTCAGGAGGACCTAGG - Intergenic
1123519773 15:21061193-21061215 GCTGTGGCTCAGGAGGACCTAGG - Intergenic
1124349916 15:28947650-28947672 TCTGGTTCCCAGGAGGCTGTGGG - Intronic
1124815852 15:32991222-32991244 TCAGGGACCCAGGAGATTCTGGG - Intronic
1125057747 15:35382393-35382415 TCTGTCGCCCAGGCTGATCTCGG - Intronic
1126032998 15:44518693-44518715 ACTGGGAGCCAGGAGGATCCTGG + Intronic
1126195334 15:45924386-45924408 TGTGCCACCCAGGAGGATCTGGG + Intergenic
1129244605 15:74271798-74271820 AGTGGGGCCCAGGTGGACCTGGG + Intronic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1129845994 15:78767971-78767993 TCTGGGTCCCTGGAGGCCCTGGG - Intronic
1129866066 15:78909743-78909765 TCTGGGACCCTGGAGGTTCCTGG + Intergenic
1130564170 15:84980736-84980758 CCTGGGGCCCATGAGGACCCCGG - Intronic
1130599080 15:85264094-85264116 TCTGGGTCCCCGGAGGCCCTGGG - Intergenic
1131092316 15:89632134-89632156 TCTGATGTCCAGGAGGATCCAGG - Intronic
1131259037 15:90879113-90879135 TCTGGGGCTCTGTAGGTTCTTGG + Intronic
1131270342 15:90943497-90943519 CCTGTGGCCCAGGAGGATGCTGG + Intronic
1132222225 15:100113533-100113555 TATGTGGCCCAAAAGGATCTGGG + Intronic
1132749751 16:1452089-1452111 GCTGGAGCCCAGGAGGCTCTGGG - Intronic
1132793525 16:1706798-1706820 TATGGGGTCCAGGCGGGTCTCGG - Intronic
1134031417 16:10995411-10995433 CCAGGGGCCCAGGAGCATGTTGG + Intronic
1134043514 16:11085196-11085218 CCTGGGTTCCAGGAGGATCACGG + Intronic
1134156072 16:11844397-11844419 TATGGGACCCATGAGTATCTGGG - Intronic
1134213460 16:12297247-12297269 GCTGAGGCCCTGGAGGCTCTGGG + Intronic
1134419105 16:14070128-14070150 TCAGGAGCCCTGGAGGTTCTAGG - Intergenic
1135536110 16:23295864-23295886 CCTGGGGAAGAGGAGGATCTGGG - Intronic
1136368827 16:29823033-29823055 TCTGGTGCACAGTAGGAACTGGG - Intronic
1136990166 16:35147174-35147196 TCTGGGGCCCCAGGGGATCAGGG - Intergenic
1137538394 16:49344693-49344715 TCTGGGGCACAGTGGGGTCTTGG + Intergenic
1137650363 16:50114736-50114758 TCTGTGGCAAAGGAGGACCTGGG - Intergenic
1138512848 16:57518591-57518613 GATGGGACCCAGGAGGACCTGGG - Intronic
1138537347 16:57667057-57667079 TCTGGGGCTCAGGAAGCCCTGGG + Intergenic
1139282225 16:65780692-65780714 TCTGGGGCCCAATAGTAGCTTGG - Intergenic
1139315533 16:66064900-66064922 TCTGAGGCCAAGAAGGATCCAGG + Intergenic
1140469059 16:75204660-75204682 ACTGGGCCCCAGGAGGGTGTGGG + Intronic
1141079340 16:81036398-81036420 TCTGGGGGGGAGGAGGAGCTGGG + Intronic
1141544205 16:84753180-84753202 TGTGTGGCCCAGGCTGATCTTGG + Intronic
1141613367 16:85196542-85196564 TCTGGTGCCCAGGGGGAGTTTGG + Intergenic
1141768136 16:86072143-86072165 TCCGGGAACCAGGAGGACCTGGG - Intergenic
1141840613 16:86571931-86571953 TCTGGTCCTCAGGAGGTTCTGGG + Intergenic
1142255822 16:89013455-89013477 TGTGGGGACCAGGAGGAAGTGGG + Intergenic
1142473680 17:177773-177795 ACTGGGGCCAAAGAGGTTCTGGG + Intronic
1142513212 17:410758-410780 TGTGGGGAGCAGGAGGACCTCGG - Intronic
1143473674 17:7191484-7191506 TCTGTGGCCCCAGAGGATATTGG - Intronic
1143902619 17:10185438-10185460 TCTGAGGGCCAGGAGAAGCTGGG - Intronic
1145279261 17:21456107-21456129 ACTGAGGCCCAGCAGGACCTGGG + Intergenic
1145398595 17:22514338-22514360 ACTGTGGCCCAGCAGGACCTGGG - Intergenic
1145902631 17:28498323-28498345 TCTGGAGTCCATGAGGATGTGGG - Intronic
1146054873 17:29576016-29576038 TCTGAGCCCCAGGGGGTTCTGGG - Intronic
1146123913 17:30217428-30217450 ACTGAGGCCCAGGAAGAGCTGGG + Intronic
1146273356 17:31498627-31498649 TCTGTGGCAGAGGAGGAGCTGGG + Intronic
1146314793 17:31798367-31798389 TCCTGGGCCCAGGAGAACCTGGG + Intergenic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147689036 17:42304300-42304322 CCTGGGGCCCATGTGGAGCTGGG + Intronic
1148825016 17:50386567-50386589 TCTGGTGCCCAGCTGGAACTTGG - Intronic
1149434993 17:56626115-56626137 TCTGGTGCCCAGGAGGACAAGGG - Intergenic
1149594283 17:57855017-57855039 TCTGAGGACCAGGAGGATGAAGG + Intergenic
1149605993 17:57925686-57925708 TCTGGGGCACAGGAGCCTCCTGG + Intronic
1150230156 17:63545351-63545373 TCTGGGGCCACAGAGGCTCTGGG - Intronic
1150566015 17:66340866-66340888 TGTGGGCCCAAGGAGGAACTTGG + Intronic
1150621347 17:66809898-66809920 CCTGGGGACCAGGCGGGTCTGGG - Exonic
1150622890 17:66821801-66821823 CCTGGGGCCCTGGAGGATCCAGG - Intergenic
1151473516 17:74332359-74332381 TCTGGGGCCCCAGAGGAGCCAGG + Intronic
1151727503 17:75893283-75893305 TCAGTGGCCCAGGAGGCCCTGGG + Intronic
1152320861 17:79608355-79608377 TCTGGGTGCCAGGAGGAGCCAGG - Intergenic
1152442322 17:80316509-80316531 CGTGTGTCCCAGGAGGATCTAGG + Intronic
1152500267 17:80703541-80703563 TGTGAGACCCAGGAGGATCAAGG + Intronic
1152677810 17:81650738-81650760 TCTGGGGTCCAGCAGGCTCCCGG + Exonic
1152847841 17:82613530-82613552 TCCGGGGCACAGGAGGTTCGTGG + Intronic
1155213401 18:23621390-23621412 TTGGGAGCCCAGGAGGATCTGGG + Intronic
1155219539 18:23671791-23671813 TCAGTGTCCCAGGGGGATCTGGG + Intergenic
1155537197 18:26829998-26830020 TGTTCTGCCCAGGAGGATCTTGG + Intergenic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1157758330 18:50238757-50238779 TCTGGTGCCCAGAAAGATGTTGG - Intronic
1160580744 18:79883540-79883562 TCTGGGGCCCAGGGTGGTCCAGG - Intronic
1161073220 19:2272627-2272649 TCTGGGCCCCAGGGGGACCCTGG + Intronic
1161106188 19:2445201-2445223 TCAGGGGCCCAGAGGGGTCTGGG - Intronic
1161405115 19:4087169-4087191 TCTGAGGCCCACGTGGACCTGGG - Intergenic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162339832 19:10085949-10085971 TCTGGCGCTCATGAGGACCTGGG - Intergenic
1162378775 19:10320128-10320150 TCTCGAGCCCTGGAGGATCTTGG - Intronic
1162909943 19:13843116-13843138 TATGGGGCCCAGGCTGATTTCGG - Intergenic
1163115401 19:15185854-15185876 TTTGGGGACCAGAATGATCTGGG - Intronic
1163375948 19:16930671-16930693 TCTGTGGCCCACGAGGATCTAGG - Intronic
1165247289 19:34504935-34504957 TGTGGGGCCCAGGAGAACCTTGG + Exonic
1165349876 19:35269559-35269581 CCTGGGGCCGAGGAGGGTCGGGG - Exonic
1165712875 19:38024545-38024567 TCTGGGGCCCAGGGCCAGCTGGG - Intronic
1165825173 19:38701647-38701669 CGTGGGGCCCAGGAGGATCCTGG - Intronic
1165969164 19:39611131-39611153 TTTGGGACCCAGGAGGTTTTTGG + Intergenic
1167294992 19:48644737-48644759 TCTGGGTCCTAGAAGAATCTTGG + Intronic
1167515849 19:49922803-49922825 TCAGGGGCCCAGGTGCTTCTGGG + Intronic
925635069 2:5934790-5934812 GCTGGTGCCCTGGAGGAGCTGGG - Intergenic
926013293 2:9425134-9425156 TGGGGGGCCCAGGATGTTCTAGG + Intronic
927072156 2:19542115-19542137 CCTGAAACCCAGGAGGATCTTGG - Intergenic
927394414 2:22632758-22632780 TTTGGGGCCAAGGAGGATGCTGG - Intergenic
927600457 2:24435925-24435947 GCTGGGGCTCAGGAGGCTCTGGG + Intergenic
927677160 2:25114584-25114606 TCTGGGGCCCAGGACTGCCTAGG - Intronic
927847060 2:26477104-26477126 TCTGGGGCCCCTCAGGATCAGGG - Intronic
927967196 2:27278101-27278123 TCTGGGTGCCAGGAGGATTGAGG + Intronic
928299780 2:30114920-30114942 TCTGGGCCCCACCAGGATATGGG + Intergenic
929018268 2:37524167-37524189 ACTGGGGCCCAGAGGGATTTGGG - Intergenic
929901607 2:46008526-46008548 TCTGGGGACCAGGAAGCTCCTGG + Intronic
930032952 2:47069482-47069504 TTTGAGGCCCAGGGGGCTCTGGG + Intronic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
931853378 2:66276181-66276203 CCTGGGGCCCTGCAGGATGTTGG + Intergenic
932236366 2:70124157-70124179 GCTGGGGCTCTGGAGGAGCTTGG + Intergenic
933425969 2:82112633-82112655 TCTGGTGTCCAGGAAGAACTGGG - Intergenic
933763620 2:85692737-85692759 TTTGGGGCCCAGGAGGCTGAGGG - Intronic
933906171 2:86895495-86895517 TCTGTTGCCCAGGGTGATCTCGG + Intergenic
934015876 2:87881264-87881286 TCTGGGGGCCTGGAGGATGGTGG + Intergenic
934729944 2:96650124-96650146 CCTGGGGCCCAGGAGGTTTGAGG - Intergenic
934884012 2:98008563-98008585 GCTTGGGGCCAAGAGGATCTTGG + Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
937019719 2:118639452-118639474 TTTGTGGGCCAGGAGGCTCTAGG - Intergenic
937084346 2:119160676-119160698 TCTGGGTGCCGGGAGGATCCTGG - Intergenic
937437138 2:121889976-121889998 TCTGGGACCCACGAGGAGGTGGG + Intergenic
938195598 2:129324708-129324730 TCAGGGGCCCAGGACTGTCTGGG - Intergenic
938972463 2:136445033-136445055 TCTGTGGCCCATTAGGAACTAGG + Intergenic
941737840 2:168999492-168999514 GCTGGGGCTAAGGAGGATATGGG - Intronic
946241238 2:218357292-218357314 TCTGAGTCCCAGGAGAATCAAGG - Intronic
947485684 2:230546390-230546412 ACAGGGGCCCCAGAGGATCTGGG - Intergenic
947749499 2:232525126-232525148 TCTGGGGCCCAGGGGGAGAGGGG + Intronic
948080749 2:235203278-235203300 GCTGTGGCCCAGGTGGACCTGGG - Intergenic
948151938 2:235751393-235751415 TCTGGTGCCCAGGGGGTTGTCGG + Intronic
948555099 2:238804150-238804172 TCTCTGGCCCAGGAGGCTGTGGG - Intergenic
948643094 2:239387740-239387762 TTTAGGGCCCAGGTGCATCTTGG - Intronic
948861726 2:240755830-240755852 CCTGGGGCCCAGGAGGTGCAGGG + Intronic
1168940780 20:1709352-1709374 GCTGGGTCCCAGGAGGACCAGGG - Intergenic
1169405425 20:5317421-5317443 ACTGGTGCCCAGGAAGCTCTGGG + Intergenic
1169833449 20:9851590-9851612 TCTATTGCCCAGGATGATCTCGG - Intergenic
1170473187 20:16688593-16688615 TGTGGGCGCCAGGAGGAGCTGGG + Intergenic
1170817898 20:19730181-19730203 TCAGGGGGCCAGCAGGCTCTGGG + Intergenic
1170901071 20:20463986-20464008 GCTGGGCCCCAGAAGAATCTCGG - Intronic
1170901073 20:20463996-20464018 TCTGGGGCCCAGCAGGCTTCTGG + Intronic
1171420687 20:25015344-25015366 TCTGTCTCCCAGGATGATCTTGG + Intronic
1172583152 20:36064423-36064445 GCTGGGGCTCCGGAGGGTCTGGG + Intergenic
1172836979 20:37879295-37879317 CCTGGGGCCCAGGAGAGCCTGGG + Intergenic
1174194542 20:48763766-48763788 CCTGGGGCCGAGCAGGCTCTGGG - Intronic
1174261626 20:49300190-49300212 TCTGTGGCCCAGGATGATCTCGG + Intergenic
1174517200 20:51101752-51101774 TCTCGGGGCCAGGCGGACCTGGG - Intergenic
1175265660 20:57701985-57702007 TTTGGGGCCCAGGAGCACCCTGG - Intronic
1175783160 20:61696345-61696367 TCCTGGGCGCAGGAGGAACTGGG + Intronic
1175905010 20:62375354-62375376 TCGGGGGCCCAGTGGGATCCTGG - Intergenic
1177478416 21:21653805-21653827 TCTGGGGGCAGGGAAGATCTTGG - Intergenic
1177941543 21:27417741-27417763 TCTGTTGCCCAGGGGGCTCTGGG - Intergenic
1179898131 21:44374804-44374826 TCTGTGGCCTGTGAGGATCTGGG - Intronic
1180007131 21:45028012-45028034 TCTGGGGCCCAGGGGGAGCAGGG - Intergenic
1180147373 21:45928909-45928931 CCTGGGGCTCAGGAGGACCCTGG - Intronic
1180244680 21:46539133-46539155 TCTGGGGCCCAGGACTGTCCAGG + Intronic
1183483443 22:38077161-38077183 TCTAGGCCCCAGGAAGGTCTGGG - Intergenic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1184195250 22:42923348-42923370 CCTGCGGGCCAGGAGGACCTGGG - Intronic
1184383904 22:44163551-44163573 TCTGGGGCAGAGCAGGCTCTTGG + Intronic
1184681605 22:46075125-46075147 CGTGTGGCCCAGGAGGAACTGGG + Intronic
950116023 3:10450727-10450749 TCTGGAGCCCAGGAGGAGGTGGG + Intronic
952536062 3:34310259-34310281 TCCAGGGCCCGGGAGGCTCTGGG + Intergenic
952997050 3:38894675-38894697 TCAGAGACCCAGGAGGAGCTTGG - Exonic
954136143 3:48583083-48583105 CCAAGGGCCCTGGAGGATCTGGG - Intronic
954307870 3:49739962-49739984 TCTGTTGCCCAGGCTGATCTTGG - Intronic
955515327 3:59720761-59720783 ACTGGAGCACAGGAGGATTTTGG + Intergenic
955869617 3:63423572-63423594 TCTGTTGGCCAGGAAGATCTGGG - Intronic
959286486 3:104418427-104418449 TCTGTTGCCCAGGCTGATCTTGG - Intergenic
959620759 3:108396541-108396563 TCTGGGGCCTATTAGGAACTGGG - Intronic
961390589 3:126550336-126550358 GCTGGGGCTCAGGAGGCACTGGG - Intronic
961569757 3:127789188-127789210 TGTGGTGGCCAGGAGGAGCTGGG + Intronic
962388116 3:134949276-134949298 TCTGGGGTCCAGGAGGACCCTGG + Intronic
962709912 3:138077652-138077674 TCAGGTGCCCAGGCTGATCTGGG - Intronic
965890883 3:173512283-173512305 TCTGGTGCCCAAGAGGATTGAGG + Intronic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
967486141 3:190033242-190033264 TCTGTGGCCCATTAGGAACTGGG - Intronic
968642696 4:1722254-1722276 TCTGGCGGCCTGGAGGAGCTCGG - Intronic
969163910 4:5287922-5287944 TCTGGGGGCTAGGAGGAGCAGGG - Intronic
969285965 4:6201933-6201955 TCAGGGGGTCAGGAGGAACTAGG + Intergenic
969626459 4:8308057-8308079 TCTGGGGTCCTGTAGGTTCTGGG + Intergenic
969710204 4:8838960-8838982 TCACGGGCCCAGCAGGATCCCGG + Intergenic
969849244 4:9943478-9943500 TCGGGGGCCCAGGAGGGCCAGGG + Intronic
969849671 4:9946438-9946460 TCTGGGGGCCATGAGCATATTGG - Intronic
969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG + Intergenic
972724331 4:41732904-41732926 TTTGGGGCCCAGGAGGCACCTGG + Intergenic
979282776 4:118886079-118886101 TCTTGGGCCCAGCAAGCTCTAGG - Intronic
983289936 4:165789440-165789462 TCTGGAGCTCAGAAGGACCTTGG + Intergenic
983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG + Intergenic
985167223 4:187109562-187109584 TCTGGGTCCCAGGAGCAGTTGGG + Intergenic
985516159 5:345784-345806 GCGGGGCCCCAGGAGGAGCTGGG + Intronic
986306353 5:6519798-6519820 TCTGGGGTACAGGATGTTCTGGG - Intergenic
986306360 5:6519831-6519853 TCTGGGGTACAGGATGCTCTGGG - Intergenic
986576674 5:9220321-9220343 TCTGGGGCACAGGTGGTTTTTGG - Intronic
986576685 5:9220411-9220433 TCTGGGGCACAGGTGGTTTTTGG - Intronic
986576694 5:9220501-9220523 TCTGGGGCACAGGTGGTTTTTGG - Intronic
988602139 5:32649794-32649816 TCTTGGGCCCAGCTGGACCTTGG - Intergenic
988706946 5:33735827-33735849 TCTGGTGCCCAGGAACATCCTGG + Intronic
989115168 5:37945536-37945558 TCAGGAGCCCAGGAGTTTCTGGG + Intergenic
997373719 5:133382186-133382208 TCTGAGAACCAGGAGGATTTTGG - Intronic
998037717 5:138930964-138930986 CCTGAGCCCCAGGAGGAGCTTGG - Intronic
999427675 5:151501471-151501493 TCTGGGTCCCAGGAGGGACCAGG + Intergenic
1001010645 5:168094761-168094783 TCTGTGGCCCATTAGGAACTGGG + Intronic
1001385557 5:171335803-171335825 TCTGGGGTGCAGGAAGCTCTGGG - Intergenic
1001494645 5:172179307-172179329 TTTGGGGCTCAGTAGGATCTGGG - Intronic
1001957824 5:175860337-175860359 TCTTGAGCCCAGGAGGTTTTAGG + Intronic
1002457772 5:179355493-179355515 TCTTGTGCCCAGGAGGATGCAGG - Intergenic
1002561684 5:180086702-180086724 TCTGGAACTCAGGAGGATCATGG + Intergenic
1003152187 6:3562273-3562295 TCTGGGGCTCAGGAAGACCCAGG + Intergenic
1005385928 6:25284112-25284134 TCTGGTGCCCAGCAGCCTCTGGG - Intronic
1006360669 6:33585410-33585432 TCTGGGGCCCAGCCTGATGTGGG - Intergenic
1007110737 6:39312290-39312312 TCTGGTGCTCAGAAAGATCTGGG + Intronic
1007765079 6:44155230-44155252 CCTGGGGGGCAGGTGGATCTGGG + Exonic
1011706804 6:90008761-90008783 ATTGAGGCCCAGGAGGATGTTGG + Exonic
1011899516 6:92275005-92275027 TCTGGGGTCCAGGAGGAATGAGG + Intergenic
1012950292 6:105511229-105511251 TCTGGGGCCCAGCTAGATTTGGG - Intergenic
1015088836 6:129329785-129329807 CCTGGGCCACAGGAGGATATTGG + Intronic
1016648649 6:146439023-146439045 TCTGGACCCCATAAGGATCTTGG - Intergenic
1016889649 6:148993280-148993302 GCTGGGGGCCAGGAAGATCTTGG + Intronic
1018197428 6:161367392-161367414 TCAAGGGCCCAGGCAGATCTTGG + Intronic
1018630088 6:165814929-165814951 TCTGGGGCCAGGGATCATCTGGG - Intronic
1019409308 7:899703-899725 TCTGGGGCCCAGGGAGGGCTGGG - Intronic
1019594106 7:1850489-1850511 TCTGGAGCCCTGCAGGAACTTGG - Intronic
1019618127 7:1975805-1975827 TCTGGGTCCCGGGAGGTGCTGGG - Intronic
1020364274 7:7363829-7363851 TCTGTTGCCCAGCACGATCTCGG + Intronic
1021929107 7:25562039-25562061 TCAGGGGCTCAGGAGGCTCCAGG - Intergenic
1022723102 7:32957923-32957945 TCTGGGGTCCGGGAGGATCTGGG - Intronic
1023847766 7:44132372-44132394 GCTGGGGCACAGCAGGAACTGGG + Intergenic
1024603617 7:51008038-51008060 TGTGGGGCCCAGAAGGGACTTGG - Intergenic
1026807821 7:73438761-73438783 TCCTGGGAGCAGGAGGATCTTGG - Intergenic
1030059868 7:105613807-105613829 TCTGGGGGGCAGGGGGAGCTGGG - Intronic
1032906470 7:136373213-136373235 CCTGGGGCCCAGGAGAATGTTGG + Intergenic
1032919434 7:136528464-136528486 TCTGGGGAGGAGGAGGAGCTAGG - Intergenic
1032924164 7:136584036-136584058 TCTGTCGCCCAGGCTGATCTTGG + Intergenic
1032963726 7:137071276-137071298 GATGGGGCACAGGAGCATCTGGG - Intergenic
1034416784 7:150969480-150969502 TGTGGGGCACAGGAGCATCTGGG - Intronic
1034552033 7:151827192-151827214 TCTGGGGTCCAGTGGGAACTGGG + Intronic
1035184002 7:157111707-157111729 TCTGGCGCCCAGGAGGAATGAGG + Intergenic
1035721509 8:1796719-1796741 TCTGGGACCTAGGAGTGTCTTGG - Intergenic
1037609908 8:20467286-20467308 CCTGGGGCACAGTGGGATCTTGG - Intergenic
1037823717 8:22148214-22148236 GCTGGGGGCCAGGAGTAGCTGGG + Exonic
1038257773 8:25966393-25966415 TCTGAGTCCCAGGAGCTTCTAGG - Intronic
1039416177 8:37395978-37396000 CCTGGGGCCTAGGAGAATGTGGG + Intergenic
1039869924 8:41537371-41537393 GCTGGGGCCCAGGAGGGTCCAGG + Intronic
1040584645 8:48727508-48727530 AATGAGGCCCAGGAGGGTCTGGG + Intronic
1040675183 8:49740722-49740744 TCTGGTGCCCAGAAGAATGTTGG - Intergenic
1041071723 8:54131870-54131892 TCTGTTGCCCAGGCTGATCTTGG + Intergenic
1042860575 8:73309153-73309175 TCTGGGGCCCACTCTGATCTAGG + Intronic
1047354589 8:124108478-124108500 CCTGGGGCCCAGAAGGAGATGGG - Intronic
1047764111 8:127976504-127976526 TCTGGGGGCCAGGTGGAGATGGG - Intergenic
1048607203 8:135982010-135982032 TCTGTGGCCCATTAGGAACTAGG + Intergenic
1049296138 8:141840483-141840505 GATGGTGCCCAGAAGGATCTGGG - Intergenic
1049646680 8:143738804-143738826 TCTGTGGCCAGGGAGGGTCTGGG - Intergenic
1049987543 9:965772-965794 TGTGGGGCCCAGGAGAAGGTTGG + Intronic
1050388191 9:5111845-5111867 TCGGGAGCCCAGGAGGTTGTCGG - Intronic
1052849583 9:33368857-33368879 CCTGGGGACCAGGACGCTCTTGG - Intronic
1053173225 9:35905510-35905532 TCTGGGAGGCAGGAGGGTCTGGG - Intergenic
1056795273 9:89654913-89654935 GAGGGGGCCAAGGAGGATCTTGG - Intergenic
1059179911 9:112201849-112201871 TCTCAGTCCCAGGAGGAGCTGGG - Intergenic
1060768488 9:126312795-126312817 TCTGGGGCCCTTGAGCATATTGG - Intergenic
1061677069 9:132223451-132223473 TGTGGTGTCCAGGAGGATTTGGG + Intronic
1061773659 9:132946091-132946113 TCAAGGGCCCAGGAGGGTTTGGG - Intronic
1061892684 9:133631054-133631076 GCTCTGGCCCAGGAGGGTCTCGG - Intergenic
1061920265 9:133778733-133778755 CCTGGGGCCCGGGAGGGTCGAGG - Intronic
1062045638 9:134423277-134423299 TCTTGGGCCCAGGGGGACATGGG - Intronic
1062210273 9:135359853-135359875 TCTGGGGCCCAGTAGAATCCAGG - Intergenic
1062439901 9:136565034-136565056 ACTGAGGCCCAGCAGGGTCTGGG + Intergenic
1062472724 9:136713346-136713368 GCTGGGGTCCTGGAGGGTCTGGG - Intronic
1062478906 9:136742561-136742583 TCGGGGGCCCAGGGGGGTCAGGG - Intronic
1186512896 X:10143702-10143724 TCTGTTGCCCAGGCTGATCTTGG + Exonic
1188092187 X:25977248-25977270 TCTAAGGCCCAGGGAGATCTGGG - Intergenic
1188548640 X:31337758-31337780 TCTGGGCCTCATGAGGAGCTAGG - Intronic
1188973060 X:36640494-36640516 TCTGGGGCCCAGCAGGAAACAGG + Intergenic
1190107481 X:47570520-47570542 TCTGGGGCCTAGAGGGTTCTAGG - Intronic
1190290560 X:48989470-48989492 TCTGGGGCCCCCCAGGAGCTAGG - Intronic
1190365047 X:49684838-49684860 TGTTGGGCCCAGGAGTATATAGG - Intergenic
1190787511 X:53665951-53665973 TCTGTGGCCCAGGCTGGTCTCGG - Intronic
1192056750 X:67781237-67781259 ACTGGGGCCCAAGAGGCTCTAGG - Intergenic
1192575276 X:72238757-72238779 TCGGGTCCCCAGGAGGATCCGGG + Intronic
1192988692 X:76428085-76428107 GCAGAGGCCCTGGAGGATCTGGG - Exonic
1199128616 X:144157282-144157304 TCTGGGGGCCTGGAGGATGGTGG - Intergenic