ID: 1162028077

View in Genome Browser
Species Human (GRCh38)
Location 19:7905386-7905408
Sequence TTGGGGGTCCAGAGAAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162028067_1162028077 12 Left 1162028067 19:7905351-7905373 CCTGAGTCAGCGTGGGTTCCTCC 0: 1
1: 0
2: 0
3: 15
4: 104
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178
1162028066_1162028077 17 Left 1162028066 19:7905346-7905368 CCTGACCTGAGTCAGCGTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178
1162028060_1162028077 27 Left 1162028060 19:7905336-7905358 CCCTCCCTCTCCTGACCTGAGTC 0: 1
1: 1
2: 8
3: 60
4: 454
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178
1162028073_1162028077 -6 Left 1162028073 19:7905369-7905391 CCTCCTTGGGGAGTCTCTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178
1162028076_1162028077 -9 Left 1162028076 19:7905372-7905394 CCTTGGGGAGTCTCTTGGGGGTC 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178
1162028061_1162028077 26 Left 1162028061 19:7905337-7905359 CCTCCCTCTCCTGACCTGAGTCA 0: 1
1: 1
2: 2
3: 41
4: 362
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178
1162028062_1162028077 23 Left 1162028062 19:7905340-7905362 CCCTCTCCTGACCTGAGTCAGCG No data
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178
1162028063_1162028077 22 Left 1162028063 19:7905341-7905363 CCTCTCCTGACCTGAGTCAGCGT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG 0: 1
1: 0
2: 0
3: 21
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162028077 Original CRISPR TTGGGGGTCCAGAGAAATCA TGG Intronic
900540074 1:3198165-3198187 TCGGGGGTCCAGAGAACGCATGG - Intronic
900901223 1:5517313-5517335 GTGGGGGTTCAGGGAAAACAGGG + Intergenic
901006473 1:6174048-6174070 CTGGGGGTGCAGGGAAAGCAGGG + Intronic
904183608 1:28685097-28685119 ATGGGGGTTCAGAGAATTTATGG - Intronic
905540231 1:38754942-38754964 TTGGGGGCTCTGAGAACTCAAGG + Intergenic
905838278 1:41150004-41150026 ATGTGAGTCCAGAGAAACCAAGG - Intronic
906245277 1:44269024-44269046 TTGAGGGTCCAGGGAAGGCAGGG - Intronic
909866868 1:80685225-80685247 GTGGGGGACCAGATGAATCAAGG - Intergenic
910392171 1:86756755-86756777 TTGGGGGTCCAATGGGATCATGG - Intergenic
912661169 1:111532267-111532289 ATGGGAGTCCAGAGAAACCAAGG - Intronic
915910415 1:159911658-159911680 AGGAGGGTCCAGAGAGATCAGGG + Intergenic
916252430 1:162752255-162752277 ATGGGAGTCCAGAGAAGTAAAGG - Intronic
917404672 1:174692322-174692344 TTTGGGATTCAGAGAAAGCAGGG + Intronic
917494597 1:175528848-175528870 TTGGGAGTCCAGAGTGAGCATGG - Intronic
919256263 1:195128693-195128715 CTGTGGGTGCACAGAAATCAAGG - Intergenic
919441932 1:197645704-197645726 TTGGGAGTCCAGTTACATCAGGG + Exonic
920557275 1:206913325-206913347 GCGGGGTTCCAGAGAAATAAAGG + Intronic
1070615275 10:77964913-77964935 TTGGGGGAGAGGAGAAATCAGGG - Intergenic
1070753377 10:78976877-78976899 ATGGGGGTACTAAGAAATCAGGG - Intergenic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1074258618 10:111829316-111829338 TTGGGTGTTCAGAGAAATTGTGG + Intergenic
1074717591 10:116234300-116234322 TTGGGGATCTAGTGAAATGAAGG + Intronic
1075190744 10:120306113-120306135 CTGGGAGTCCAGAGAAACCAAGG - Intergenic
1076459451 10:130630753-130630775 TTGGGGGACCACATAAAACAGGG + Intergenic
1077511649 11:2968011-2968033 TTGGGGGTGCAGTGATAACAGGG - Intronic
1078744439 11:14097867-14097889 GTGGGAGACCACAGAAATCATGG - Intronic
1078996836 11:16710529-16710551 TTGGAGGCCAAGAGAACTCAGGG - Intronic
1081688051 11:45056452-45056474 CTGGGGGTCCACAGAAGTCTGGG - Intergenic
1084708043 11:70827190-70827212 GTGGGGAGCCAGAGAAGTCATGG - Intronic
1085388789 11:76171813-76171835 TTGGGGGTAGGGAGGAATCATGG - Intergenic
1089270716 11:117299869-117299891 TTTGGGGTCCAGTGATAGCAGGG - Intronic
1089949825 11:122515328-122515350 TTGGGTGTTCAGAGAAAACTAGG - Intergenic
1091786108 12:3244303-3244325 TTGGAGGTCCAGAAAAAGAAGGG - Intronic
1092230588 12:6773581-6773603 TTGGTGGTCAAGAGAACTCTTGG + Intronic
1093829112 12:23733947-23733969 TTGAGGGTTAAAAGAAATCATGG - Intronic
1094147373 12:27244427-27244449 TTGGGTGTCCAGGGAAAGCCGGG + Intronic
1094389883 12:29937727-29937749 TTGGAGAGCTAGAGAAATCATGG + Intergenic
1095734657 12:45543392-45543414 TTGGGGGCCCTGAGAAGCCAAGG + Intergenic
1095747050 12:45671342-45671364 TTAGAGGCCCAGAGAAAACATGG + Intergenic
1096463891 12:51837633-51837655 TGGAGGGTCCAGAGAAAACGTGG - Intergenic
1096613573 12:52818838-52818860 TTGGGGAACCAGAGACAACACGG + Intergenic
1097241018 12:57575372-57575394 TCTGGGGTCAAGTGAAATCAAGG + Intronic
1100219478 12:92489046-92489068 TTGGGGGCCCAGGGAATTGAGGG - Intergenic
1101358219 12:104001006-104001028 TTGGGAGGACAGAGGAATCAGGG - Intronic
1101762949 12:107674022-107674044 TGGGAGGTCAAGAGAAATCCAGG + Intergenic
1102008155 12:109601903-109601925 TTGGGGGTACAGAGGAGTCCCGG - Intergenic
1103674515 12:122644947-122644969 ATGGGGGGCCAGAGTAGTCATGG + Intergenic
1103795879 12:123502860-123502882 TTAGAGGTCCAGAGGAAGCATGG - Intronic
1104272233 12:127292937-127292959 TGGGGGATCCAGAGAAATAAGGG - Intergenic
1104460152 12:128948746-128948768 TTTGGGGTCCAGAGAGAACATGG + Intronic
1105296817 13:19095039-19095061 TGGCGGATACAGAGAAATCATGG + Intergenic
1105959497 13:25317483-25317505 TTGGGGGTCCATGGTAATCAGGG + Intronic
1106577877 13:30992716-30992738 ATGTGGCTCCAGAGAAATGAGGG + Intergenic
1107727358 13:43312415-43312437 CTGGGGGTGCAAAGAAAACATGG + Intronic
1107761570 13:43685065-43685087 TTGGGGATCCTGGGAAATCGAGG - Intronic
1111358114 13:87137959-87137981 TTTGGGATCAAGAGAAATCAAGG + Intergenic
1116794754 14:49378112-49378134 CTGGGGGTCTGGAGAAGTCAAGG - Intergenic
1117479585 14:56129530-56129552 TTGGGCCTCCAGGGAAAGCAAGG - Intronic
1117880964 14:60313185-60313207 TTGTGGGTCCAGGGAAGGCAAGG - Intergenic
1118791247 14:69094959-69094981 TTGGGGGTGGAGAGAAAACAAGG + Intronic
1119709595 14:76812445-76812467 CTGGGGGTGCAGAGAAATTGTGG - Intronic
1120233916 14:81868900-81868922 ATGGGCATCCAGAGAAGTCAGGG + Intergenic
1121546866 14:94769333-94769355 TTGGGGGTGCACGGGAATCAGGG + Intronic
1130093321 15:80838915-80838937 TTGGCTGTCCAGGGAAAGCAGGG - Intronic
1130359908 15:83173685-83173707 TTGGGAGTCCATAAAAATAATGG - Intronic
1130654130 15:85780151-85780173 TCTGGGGTCCAGAGAAAGCCTGG - Intronic
1131531832 15:93200376-93200398 TTGGGGGTCCTGTGAAGTGAGGG - Intergenic
1134237716 16:12480631-12480653 TTGAGGCTGCAGAGAAAGCATGG - Intronic
1135513605 16:23110824-23110846 ATGGGAGTAAAGAGAAATCAGGG + Intronic
1138098526 16:54232717-54232739 TTGGAGTCTCAGAGAAATCATGG - Intergenic
1141870258 16:86780508-86780530 TTGGGGCTTTAGAGAAATGATGG - Intergenic
1142722169 17:1783756-1783778 TTCAGGGTCAAGAGAAATCATGG - Intronic
1142808506 17:2384467-2384489 TTGGGGGGCCAAAGAAGGCAGGG - Exonic
1143576815 17:7798606-7798628 TTGGGTGTCCACAAAAATGAAGG - Exonic
1143636023 17:8164029-8164051 TTTGGGGTCCAGAGAGAGGAGGG - Intergenic
1144278600 17:13701217-13701239 TTGGCTGGCCAGAGAAATAAGGG + Intergenic
1148327747 17:46793617-46793639 TCAGGGGACCAGAGAATTCAAGG + Intronic
1151367770 17:73628494-73628516 TTGGGGTTCCCCAGAACTCAGGG - Intronic
1152249675 17:79205297-79205319 GTGGGGGTCCACAGAAACCCAGG + Intronic
1157985202 18:52429901-52429923 TTGGGGCTACAGAGAAATAATGG + Intronic
1158848514 18:61470183-61470205 TGGGGGGTGTGGAGAAATCAGGG + Intronic
1159404467 18:67982262-67982284 TTGGAGGTCCAGAAAAGTTAAGG + Intergenic
1161889585 19:7024951-7024973 TTGGGGATGCAGAGAAATACTGG - Intergenic
1161891867 19:7045795-7045817 TTGGGGATGCAGAGAAATACTGG + Intergenic
1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG + Intronic
1162343348 19:10105654-10105676 TTGGGGTGCCAGAGAGAGCAAGG + Intergenic
1164802947 19:31092821-31092843 TGGGGGGACCTGAGAAATGAAGG + Intergenic
1167037469 19:47002700-47002722 TTGGGGGTGGAGGGAAAGCATGG + Exonic
1167261989 19:48463929-48463951 ATGGAGGTCCAGAGAAAACATGG - Intronic
927200818 2:20577155-20577177 TTGGGGTTCCAGGGAGATTAAGG + Intronic
928077195 2:28275577-28275599 TTGTGTGTCTAGAGAATTCAGGG + Intronic
930949817 2:57126891-57126913 TTTGGGGTTCATAGAAATGAGGG + Intergenic
933477491 2:82809843-82809865 TTGTGGGTCCAGAGAATTGTGGG + Intergenic
934787141 2:97019587-97019609 TTGATGGTCCAGAAAAATCGAGG - Intergenic
938109174 2:128552692-128552714 TGGGGGGTGCACAGAAATCAGGG + Intergenic
938802802 2:134778384-134778406 TTGGTGGACCAGAGAAAGCCTGG + Intergenic
939270873 2:139937809-139937831 CTGGGGGTCCAGGGAAAATAAGG - Intergenic
942223597 2:173795117-173795139 TTGGGGGTCTAGCTAAATCATGG + Intergenic
942616787 2:177799656-177799678 TTGGGGGTGGAGATAAAGCATGG - Intronic
943282036 2:185946788-185946810 TTTGGGGTACAAAGAAATAAAGG - Intergenic
944193065 2:197023923-197023945 TTTTGAGTCCAGTGAAATCAGGG - Intronic
944968321 2:204961701-204961723 ATGGGGGCCCAGAGAAATAAGGG + Intronic
946080412 2:217113766-217113788 TTGGTGGTTGACAGAAATCATGG + Intergenic
946190370 2:218004619-218004641 TTGGTGGTTCTGAGAAGTCAGGG + Intergenic
946561022 2:220913888-220913910 TTGGAGGTCAAGAGAAATAAAGG + Intergenic
1168814796 20:728924-728946 GTGGGGGTCCAGGGAGATGAGGG + Intergenic
1169879276 20:10328942-10328964 CTTGGGGCCCAGAAAAATCAGGG - Intergenic
1170619582 20:17983979-17984001 TTTGGGCTTCTGAGAAATCATGG + Intronic
1175046484 20:56111137-56111159 ATGGGCATGCAGAGAAATCAGGG + Intergenic
1175306503 20:57979414-57979436 AGTGGGGTCCAGACAAATCAGGG - Intergenic
1177784662 21:25658276-25658298 TTGTAGAACCAGAGAAATCATGG + Intronic
1179576677 21:42312594-42312616 GTGGGGGTCCAGAGAAGGCCAGG - Intronic
1179770194 21:43609638-43609660 TTGGGGCTCCAGAGGACTCAAGG + Intronic
1180618705 22:17145813-17145835 TGGGGAGTCCAGAGGAGTCATGG + Intronic
1181331853 22:22098829-22098851 CTGGGGGACCACAGAAAACAGGG + Intergenic
1181790640 22:25263042-25263064 TTGGGTGTCCATGGAGATCATGG - Intergenic
1183215999 22:36480545-36480567 TTGGGGGTCCACAGAAGACTAGG - Intronic
1183826327 22:40390697-40390719 TTGGGGGCCCAGAGGAATAGGGG + Intronic
1183861409 22:40673066-40673088 CAGGGGGTTCAGAGAAATCTGGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185135825 22:49071612-49071634 TTGGGGGAATGGAGAAATCAGGG - Intergenic
949304143 3:2620522-2620544 TTAAGGGTCCATAGAAATCTAGG + Intronic
949776528 3:7638841-7638863 TTGGAAGTCAAGAGAAATCAAGG + Intronic
951103276 3:18714231-18714253 TTGGGGGAAAAGAGGAATCATGG - Intergenic
951144693 3:19213502-19213524 TTGGTGGGAAAGAGAAATCAAGG - Intronic
951539130 3:23765663-23765685 TTGGGAGTAAAGAGAAATCCTGG + Intergenic
953250354 3:41240637-41240659 TTAGGGGTCCAGCGTAATCCAGG - Intronic
954441164 3:50522893-50522915 TTGGGGGTGTAGAGTCATCAAGG + Intergenic
956012232 3:64844186-64844208 TTGGGGGACTAGAGAACTGATGG - Intergenic
961007908 3:123417192-123417214 TTGGGGATGCCAAGAAATCAGGG - Intronic
964932615 3:162045461-162045483 TTGAGGGGCCAGAGTAGTCAAGG + Intergenic
968731976 4:2273472-2273494 TCGGGAGTCGAGAGAGATCAGGG + Intronic
969186516 4:5478718-5478740 TTGGGGCTCCATAGAAGCCAAGG + Intronic
970040417 4:11790936-11790958 TTGGGGGTGCAGGGAAAATATGG - Intergenic
970383510 4:15532316-15532338 TTAGTGGTACAGAGAAATAAGGG - Intronic
974693307 4:65330773-65330795 TTGAGTGTCCAAAGAAATAATGG + Intronic
976104971 4:81606788-81606810 TTGAGGGGCCAGAGAGAGCATGG - Intronic
976881636 4:89932603-89932625 TTGAAGGTGCAGAGAAGTCAAGG - Intronic
978365096 4:107973117-107973139 TTGTGGGGCCAGACAAATGAGGG - Intergenic
980048549 4:128015433-128015455 CTGGGGGACCTGAGAATTCAAGG + Intronic
980653520 4:135751848-135751870 ATGGCAGTCCAGAGAAAGCATGG + Intergenic
981305357 4:143241414-143241436 TTAGGGGTCCAGGGAGGTCAAGG - Intergenic
984760126 4:183356574-183356596 TTGGTTGTCCAGAGAGAGCATGG - Intergenic
987544619 5:19297222-19297244 TTGGGGGTTCAGGGATATCAGGG - Intergenic
989190716 5:38667267-38667289 TTGGGGGCACAGAGAATCCATGG + Intergenic
993565608 5:89471214-89471236 TTGGCTTTCAAGAGAAATCATGG + Intergenic
995077818 5:108007978-108008000 TTGGGGCTACAGAAAATTCAGGG - Intronic
996351192 5:122543731-122543753 TTGGGGGAAAAGAGAGATCATGG - Intergenic
997713066 5:136022363-136022385 TGGAGGGTCCAGAGAAGTCTGGG + Intergenic
1000191997 5:158920315-158920337 TTTGGGGACCAGACAAATCTGGG - Intronic
1003317290 6:5024290-5024312 TTGGGGCTTGTGAGAAATCAAGG - Intergenic
1004628653 6:17400344-17400366 TTGGAGATCCAGAGAAATTCTGG + Intronic
1005987420 6:30883711-30883733 TTGGGAGCCCAGGGGAATCAGGG + Intronic
1007142368 6:39588748-39588770 TTGGGGATGAAGACAAATCAAGG - Intronic
1007291056 6:40787068-40787090 GTGGGGCTCCTGAGGAATCATGG - Intergenic
1007638372 6:43315312-43315334 TTGAGGATACTGAGAAATCATGG - Intronic
1010738713 6:79472806-79472828 GTGAGGGGCCAGAGAAAACAAGG - Intergenic
1010787461 6:80021122-80021144 TTGGAGGTCAACAGAATTCAAGG - Intronic
1014406996 6:121064690-121064712 CTGTGGGTGCACAGAAATCAAGG + Intergenic
1018422686 6:163652993-163653015 TTGGGAGTCCTGAGATAGCAGGG - Intergenic
1018462947 6:164016608-164016630 ATAGGGGTCCAGAGAGAGCAAGG - Intergenic
1022199412 7:28102101-28102123 TTGGGGGTGCTGGGCAATCAGGG - Intronic
1027191860 7:76001138-76001160 ATGGGCTCCCAGAGAAATCATGG - Intronic
1029215355 7:98944598-98944620 TTGGGGGCCCAGAGACAACAGGG + Intronic
1031669267 7:124522927-124522949 TTGGGGAACCAGTGAAATTAAGG - Intergenic
1034467770 7:151239869-151239891 CTGGGACTTCAGAGAAATCAGGG - Intronic
1037650479 8:20833618-20833640 TTGGTGGTCCAAACATATCATGG - Intergenic
1041672356 8:60504456-60504478 ATGGGTGTCCAGGCAAATCAGGG - Intergenic
1041778539 8:61552034-61552056 TTGAGGGTTCAGAGAAGTGAAGG - Intronic
1042741579 8:72053454-72053476 TGGTAGGTCCAGAGAAATGAAGG - Intronic
1042860226 8:73305665-73305687 TTGGGGGTCCAAAAACATCCTGG - Intronic
1043196347 8:77297057-77297079 TTGGAGCTACAGAGAAATCAAGG - Intergenic
1045699435 8:104849692-104849714 TGGAGAGTCCAGAGAAACCAAGG - Intronic
1046886070 8:119368527-119368549 GTGGGGGAAAAGAGAAATCAAGG - Intergenic
1046943959 8:119957506-119957528 TTGAGGGTCAAAAGAAATGAAGG + Intronic
1049235190 8:141508652-141508674 ATGGGAGCCCAAAGAAATCAGGG - Intergenic
1050919249 9:11179917-11179939 CTGGGTGTCTAGAGAAACCAAGG - Intergenic
1051376552 9:16408230-16408252 ATGGGTGCTCAGAGAAATCAAGG + Intergenic
1052015738 9:23463727-23463749 ATGGGGGTCCCGAGAAATGCTGG - Intergenic
1052998072 9:34562085-34562107 ATGGGGGTCCAGGGTCATCAAGG + Intronic
1053284994 9:36844560-36844582 TTAGGGGGCCAGAGACAGCATGG - Intronic
1054706800 9:68471207-68471229 CTGGGAGTCCTGAGACATCATGG + Intronic
1055305196 9:74922519-74922541 ATAGAGGTCAAGAGAAATCAAGG - Intergenic
1057529901 9:95835459-95835481 TTGGTGGAGCAGAGAATTCATGG + Intergenic
1058643115 9:107106142-107106164 TTGGAGGTGAAGAAAAATCAGGG + Intergenic
1059427221 9:114228589-114228611 TTAGGGCTCCAGCGATATCACGG - Intronic
1061187048 9:129060805-129060827 TGGGGGGTGCTGAGAAATCGGGG + Intronic
1061873338 9:133532075-133532097 GTGGGGTTCCAGGGAAAACACGG - Intergenic
1186063784 X:5739833-5739855 TTGAGGATGCAGAGAAAACAAGG + Intergenic
1188030333 X:25256334-25256356 TGGGGAGACCACAGAAATCATGG - Intergenic
1189795365 X:44641107-44641129 TTGGAGGTCATGAAAAATCAAGG + Intergenic
1192941319 X:75914707-75914729 TTGGGGGTCTAGAGAGGCCAAGG - Intergenic
1193292592 X:79793141-79793163 TTGGGGGTCCAGAGACTCCAAGG - Intergenic
1193508271 X:82370010-82370032 TTTGAGGTCCACAGAACTCATGG + Intergenic
1194564963 X:95474177-95474199 GGGGGGGGTCAGAGAAATCAAGG - Intergenic
1196049758 X:111292524-111292546 GTGGGGGTCATGAGTAATCAGGG + Intergenic
1197102116 X:122668645-122668667 TGGAGGGTGCAGAGAAAGCATGG + Intergenic
1198405165 X:136305061-136305083 TGGGGGCTCCAGAGAAGTTAGGG + Intronic
1198557935 X:137815929-137815951 CTGGGAGTCCAGAGAAGCCAGGG - Intergenic
1200122251 X:153796656-153796678 TTGGGGTGCCGGAGAGATCAGGG + Intronic