ID: 1162028789

View in Genome Browser
Species Human (GRCh38)
Location 19:7908655-7908677
Sequence ACGGCTACACACACCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162028789_1162028796 13 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028796 19:7908691-7908713 AGGATGTGACGTGTCAGGATTGG No data
1162028789_1162028792 -7 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028792 19:7908671-7908693 TAGCCGTTGTCAGGGCCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1162028789_1162028795 8 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028795 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1162028789_1162028797 22 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028797 19:7908700-7908722 CGTGTCAGGATTGGCTCCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 57
1162028789_1162028798 25 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028798 19:7908703-7908725 GTCAGGATTGGCTCCTCTGGAGG 0: 1
1: 0
2: 1
3: 20
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162028789 Original CRISPR ACGGCTACACACACCTACCA AGG (reversed) Intronic
900726980 1:4222970-4222992 CAGGCTACACACACCTTCCTGGG - Intergenic
900998319 1:6134655-6134677 GCGGCCACAGGCACCTACCATGG + Intronic
901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG + Intergenic
902439677 1:16421369-16421391 ACAGCCACACACACCTTCCTTGG + Intronic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
919205800 1:194420638-194420660 AAGGGTGCACACACCTACCCAGG + Intergenic
921480888 1:215663509-215663531 CACGCTACACACACCAACCACGG - Intronic
1065006863 10:21388182-21388204 ACAGCTACAAATACCTTCCAGGG - Intergenic
1065907494 10:30271192-30271214 ACTGCAACATCCACCTACCAGGG - Intergenic
1070663544 10:78327830-78327852 AATACTACACACACCAACCAGGG - Intergenic
1070846356 10:79525191-79525213 ACGGCTACATCCACCTTCAAAGG - Intergenic
1070927440 10:80235115-80235137 ACGGCTACATCCACCTTCAAAGG + Intergenic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1103703168 12:122858427-122858449 CTGGCTACACTCACCTGCCAAGG - Exonic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1121937110 14:98030004-98030026 ACAGCTACTCACCTCTACCATGG + Intergenic
1128659680 15:69489585-69489607 ACAAGTACACACATCTACCATGG - Intergenic
1131668409 15:94594761-94594783 ACGGCCACACACATCCAGCAAGG - Intergenic
1136508766 16:30723123-30723145 CCGGCTACCCACACCTACTCTGG + Exonic
1142407015 16:89895935-89895957 ATGGCCACACACAGCAACCACGG - Intronic
1144125037 17:12195383-12195405 ACACCTACACACACATACCTAGG - Intergenic
1146737945 17:35255436-35255458 ACGCATACACACACATATCATGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1152785195 17:82244134-82244156 ACGGGCACACACACACACCACGG + Exonic
1152872195 17:82761652-82761674 ACTGATACACACACCAACAATGG - Intronic
1160014354 18:75129057-75129079 ACGGCAACACACCTCCACCATGG - Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
925040583 2:730614-730636 ACTGCTTCAGACACCTTCCACGG - Intergenic
927182477 2:20456418-20456440 AGGGCTACAAACACAGACCATGG + Intergenic
927326331 2:21809874-21809896 TAGGCTACAAACACCAACCAAGG - Intergenic
929713541 2:44288528-44288550 ACAGATACAGACACCTACCAGGG - Intronic
932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG + Intergenic
935808229 2:106770078-106770100 ACGGATTCACACACATACCTTGG - Intergenic
937553305 2:123122280-123122302 ACGCATACACACACACACCATGG + Intergenic
941554469 2:166959302-166959324 AGGGCTACAGAGACCTTCCATGG + Intronic
1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177724280 21:24946940-24946962 ACTGCTCCACATACTTACCAAGG + Intergenic
1179674761 21:42974196-42974218 CCGGCTACACACACCTCTCCTGG + Intergenic
1184259495 22:43306542-43306564 ACGAACACACACTCCTACCAAGG + Intronic
1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG + Intergenic
956445182 3:69319098-69319120 ACCTCTACACAAACCTATCAAGG + Intronic
979357415 4:119721406-119721428 CTAGCTACACACACATACCATGG + Intergenic
983090112 4:163493420-163493442 ACAGCTGCACACACATATCAAGG + Intergenic
999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG + Intronic
1004327192 6:14686167-14686189 ACGACTTGACACACCTAGCAAGG + Intergenic
1006131147 6:31870254-31870276 ACTGCCACACACACCTGCCAAGG - Intronic
1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG + Intronic
1008312619 6:49995058-49995080 AAGGCTACACAATGCTACCAGGG + Intergenic
1012729148 6:102858215-102858237 ACACATACACACACATACCATGG - Intergenic
1015643321 6:135362099-135362121 ACACCTACACACACACACCATGG - Intronic
1016980165 6:149846503-149846525 ACGCCTCCACTCACATACCATGG - Intronic
1019960220 7:4452829-4452851 ACGGATCCATACACCTAACACGG + Intergenic
1021231723 7:18093207-18093229 AAGTCTCCACACACCTGCCAGGG - Intronic
1045257134 8:100535713-100535735 ATGGATACACACAGCTACCCTGG - Intronic
1045398090 8:101782297-101782319 ATGGCTACTCACACCTACGGAGG + Intronic
1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG + Intronic
1050460877 9:5876324-5876346 GAGGCTACACATGCCTACCATGG - Intergenic
1059062778 9:111051045-111051067 ACAGTTACACATACCTACCCAGG - Intergenic
1061440806 9:130602218-130602240 ATGGCTTCAGCCACCTACCAGGG + Intronic
1062560612 9:137139995-137140017 ACGTCTACACACACCAGTCAGGG - Intronic
1186193595 X:7089772-7089794 AAGGCTTCACACATATACCATGG + Intronic