ID: 1162028792

View in Genome Browser
Species Human (GRCh38)
Location 19:7908671-7908693
Sequence TAGCCGTTGTCAGGGCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162028784_1162028792 15 Left 1162028784 19:7908633-7908655 CCCAGCTCCTGTGGGAGGGGCAC 0: 1
1: 0
2: 2
3: 43
4: 278
Right 1162028792 19:7908671-7908693 TAGCCGTTGTCAGGGCCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1162028785_1162028792 14 Left 1162028785 19:7908634-7908656 CCAGCTCCTGTGGGAGGGGCACC 0: 1
1: 0
2: 6
3: 24
4: 273
Right 1162028792 19:7908671-7908693 TAGCCGTTGTCAGGGCCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1162028787_1162028792 8 Left 1162028787 19:7908640-7908662 CCTGTGGGAGGGGCACCTTGGTA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1162028792 19:7908671-7908693 TAGCCGTTGTCAGGGCCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1162028783_1162028792 16 Left 1162028783 19:7908632-7908654 CCCCAGCTCCTGTGGGAGGGGCA 0: 1
1: 0
2: 5
3: 41
4: 356
Right 1162028792 19:7908671-7908693 TAGCCGTTGTCAGGGCCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1162028789_1162028792 -7 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028792 19:7908671-7908693 TAGCCGTTGTCAGGGCCTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162028792 Original CRISPR TAGCCGTTGTCAGGGCCTCT AGG Intronic
903228846 1:21909801-21909823 AGGCCCTTGCCAGGGCCTCTTGG - Intronic
903946221 1:26965157-26965179 TAGCCGTTATCAGGGGCTGGAGG + Intergenic
904566110 1:31429322-31429344 TAGCCATCCTCAGGGCCACTTGG + Intronic
912538896 1:110397269-110397291 TAGATGTTGACAGGGCATCTTGG - Intergenic
912805986 1:112757507-112757529 TAGCCATTGTCAAGGGCTCCTGG + Intergenic
914701512 1:150138156-150138178 TCGCTGTTGTCAGGGTCCCTAGG + Intronic
915035837 1:152924040-152924062 TAGCAGAAGTCAGGGCCACTAGG + Intergenic
915765910 1:158362223-158362245 TAGTGGTTGTCAGGGCCTAAGGG + Intergenic
916496719 1:165354249-165354271 GAGCCGGTGGCCGGGCCTCTCGG - Intronic
922482568 1:225949325-225949347 TAGGAGGTGTCAGGGCCGCTTGG - Intergenic
1067380880 10:45772216-45772238 TAGTGGTTGCCAGGGCCTGTGGG + Intronic
1067888580 10:50112870-50112892 TAGTGGTTGCCAGGGCCTGTGGG + Intronic
1068117018 10:52746828-52746850 TAGTCATTGTCAAGGCTTCTAGG + Intergenic
1076494542 10:130888311-130888333 CAGCCGTGGTCTGGGCCTCGGGG + Intergenic
1076816102 10:132915396-132915418 TGGCCTTTGTCTTGGCCTCTTGG - Intronic
1079248444 11:18770310-18770332 AAGCCGTTGCCAGGGGCTGTGGG - Intronic
1084288410 11:68146522-68146544 CAGCCGCTGTCAGAGCCCCTGGG - Intergenic
1085465875 11:76722988-76723010 AAGTCCTTGTCAGGGCCTCTGGG - Intergenic
1089321398 11:117629039-117629061 TAGCCGTGCTCAGGGCCTGCTGG - Intronic
1103702790 12:122856369-122856391 CAGCCGGTGGCAGGGCCTCTCGG + Intronic
1104865002 12:131948381-131948403 TAGTGGTTGTCAGGGACTGTGGG - Intergenic
1106234578 13:27851201-27851223 TAGCCTTGGTCAGTCCCTCTGGG + Intergenic
1115596182 14:34911641-34911663 TAGCAGTTGTCAAGGGCTGTAGG + Intergenic
1118885442 14:69861868-69861890 TAGTGGTTGTCAGGGCCTGGAGG - Intronic
1131558366 15:93418497-93418519 TAGAGGCTGGCAGGGCCTCTGGG + Intergenic
1134672851 16:16068413-16068435 CAGCCTTTGTCCGGGCCTCATGG - Intronic
1135587481 16:23681887-23681909 TAGCCAATGTCATGGCTTCTGGG + Intronic
1136501080 16:30669932-30669954 TTGCCCCTGTAAGGGCCTCTAGG + Exonic
1137951245 16:52785560-52785582 TAGTAGATGTGAGGGCCTCTGGG - Intergenic
1141041260 16:80674626-80674648 TAGCCGTTGCCAGGGGCTAAGGG - Intronic
1142116301 16:88357866-88357888 GAGCCGGTGGCAGGGCCTGTTGG + Intergenic
1142502189 17:339386-339408 TAGGAGTTTTCAGGGCCTCTAGG + Intronic
1143382535 17:6505416-6505438 TAGGCTTTGTCACGGCCCCTAGG - Intronic
1143679406 17:8465167-8465189 AAGCAGGTGTCAGGGACTCTGGG + Intronic
1144078043 17:11736530-11736552 TGGACGTTATCAAGGCCTCTTGG + Intronic
1150451351 17:65271562-65271584 TGGCCTTTGTCAGGGCTGCTGGG + Intergenic
1152878083 17:82799726-82799748 CAGCCGTTGCCAGGCCCTGTCGG + Intronic
1152920682 17:83065044-83065066 TGGCCGCTGTCCGGGCCTCCGGG - Intergenic
1157685261 18:49638235-49638257 AAGCAGTGCTCAGGGCCTCTAGG + Intergenic
1161877330 19:6921852-6921874 TTGCCGTTATCATGGCGTCTGGG + Exonic
1162028792 19:7908671-7908693 TAGCCGTTGTCAGGGCCTCTAGG + Intronic
1165648724 19:37467673-37467695 TAGCCGCTGTCAGGACCTTAAGG - Intronic
925102169 2:1256810-1256832 AAGCCGATGGCAGGGCCTCTGGG + Intronic
925342579 2:3147537-3147559 CAGCCGGGGTCTGGGCCTCTTGG - Intergenic
926534319 2:14092118-14092140 TAGTGGTTGTCAGGGCCTGGGGG + Intergenic
926747352 2:16169708-16169730 TAGACTCTGTCAGGGGCTCTGGG + Intergenic
933967348 2:87440784-87440806 TAGCGGTTGTCAGGGGCTGGGGG - Intergenic
936326447 2:111509711-111509733 TAGCGGTTGTCAGGGGCTGGGGG + Intergenic
941142556 2:161803533-161803555 CAGCAGTTGTCAGGGCTTCAGGG - Intronic
945625372 2:212198379-212198401 TAGTGGTTGTCAGGGGCTGTGGG - Intronic
946969748 2:225078790-225078812 TGGATGCTGTCAGGGCCTCTCGG + Intergenic
1169387653 20:5164819-5164841 GAGCCGTTGGCAGAGCCTCCTGG + Intronic
1176180368 20:63746946-63746968 AAGTCCTTGTCAGGGCCTCCTGG + Exonic
1180842236 22:18964800-18964822 TAGCCTGTGTCAGGACATCTGGG - Intergenic
1181823214 22:25492257-25492279 TAGTGGTTGTCAGGGCCTTTGGG + Intergenic
1183727419 22:39597464-39597486 TGGCCTTGGGCAGGGCCTCTGGG - Intronic
955330246 3:58041414-58041436 GAAATGTTGTCAGGGCCTCTGGG + Intronic
955485200 3:59428078-59428100 TGGGTGTTGTCAGGGCCTCCTGG + Intergenic
960593159 3:119384825-119384847 TAGTGGTTGCCAGGGCCTGTGGG - Intronic
960921780 3:122754455-122754477 TAGTTGTTGTCAGGGGCTGTGGG + Intronic
961574804 3:127825560-127825582 TAGCAGTTGCCAGGGGTTCTAGG - Intergenic
962322885 3:134406317-134406339 TACCCATTGTCCGGGCCTCTTGG - Intergenic
963828733 3:149984277-149984299 TGGCTGGTGTCAGGGGCTCTGGG - Intronic
967851829 3:194088240-194088262 GAGCTTGTGTCAGGGCCTCTGGG + Intergenic
975638409 4:76474259-76474281 TAGTGGTTGTCAGGGACTATGGG + Intronic
995006888 5:107208706-107208728 TAGCGGTTGTCAGGGGCTAAAGG + Intergenic
996261530 5:121476479-121476501 TAACATTTGTCATGGCCTCTGGG - Intergenic
997425011 5:133797114-133797136 TGCCCTTTGTCAGGACCTCTGGG - Intergenic
999718278 5:154379589-154379611 CAGCTGTGGTCAGGGCTTCTTGG + Intronic
1000511834 5:162192361-162192383 TAGCCATTTTCATGCCCTCTTGG - Intergenic
1003428017 6:6010339-6010361 GAGCAGTTGTCAAGGCCACTAGG + Intergenic
1004940413 6:20550621-20550643 TCGCTGTTGTGAGGTCCTCTTGG + Intronic
1005850956 6:29820976-29820998 AAGCCGTTTTCATGGCCTCGTGG - Intergenic
1023614555 7:42006607-42006629 TAGTCCTTGTCAGAGCCTTTTGG - Intronic
1024876663 7:54032652-54032674 CAGTGGTTGTCAGGGACTCTGGG - Intergenic
1025752817 7:64307824-64307846 TAGCAGTTGTCAGGCCTTTTGGG + Intronic
1026816520 7:73516817-73516839 TAGCCGTTGTTAGGGGTTGTAGG - Intronic
1029223720 7:99009763-99009785 TAGCAGCTGCCAGGGCCTATAGG + Intronic
1030134935 7:106237673-106237695 TAGCCGTTTTGAAGGCCTGTCGG + Intergenic
1034514018 7:151559779-151559801 CAGCCTTTGTCAGGGCCACATGG - Intronic
1034896409 7:154879089-154879111 CAGCCGTTGCCAGGGTCTCTGGG + Intronic
1035345773 7:158196670-158196692 TAGCCGTGGGCAGGGCCCCAGGG - Intronic
1037149131 8:15614459-15614481 AAGCAGTTGTCTGGGCCTCAAGG - Intronic
1041941780 8:63396447-63396469 TAGTCCTTAACAGGGCCTCTGGG + Intergenic
1042069930 8:64920738-64920760 TAGCTGTTATCAGGGGCTTTGGG - Intergenic
1042335085 8:67621505-67621527 TAGTCGGTGTCAAGCCCTCTAGG - Intronic
1043327319 8:79068629-79068651 TAGCGGTTGTCAGGGATTCAGGG + Intergenic
1055663001 9:78525072-78525094 TAGTGGTTGTCAGGGCCTTGGGG + Intergenic
1061077169 9:128348676-128348698 AAGCCCTTGTCAGGGCAACTGGG - Exonic
1188780069 X:34271327-34271349 TGGCTGTTGTCATTGCCTCTTGG + Intergenic
1199155051 X:144536984-144537006 TAGCCATTGCCAGGGCAGCTGGG + Intergenic
1201591949 Y:15625374-15625396 TAGCTGTTGTCAGGGGCTAAAGG + Intergenic