ID: 1162028795

View in Genome Browser
Species Human (GRCh38)
Location 19:7908686-7908708
Sequence CCTCTAGGATGTGACGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162028789_1162028795 8 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028795 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1162028787_1162028795 23 Left 1162028787 19:7908640-7908662 CCTGTGGGAGGGGCACCTTGGTA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1162028795 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1162028785_1162028795 29 Left 1162028785 19:7908634-7908656 CCAGCTCCTGTGGGAGGGGCACC 0: 1
1: 0
2: 6
3: 24
4: 273
Right 1162028795 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1162028784_1162028795 30 Left 1162028784 19:7908633-7908655 CCCAGCTCCTGTGGGAGGGGCAC 0: 1
1: 0
2: 2
3: 43
4: 278
Right 1162028795 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162028795 Original CRISPR CCTCTAGGATGTGACGTGTC AGG Intronic
904405390 1:30285059-30285081 CATCTACCATGTGTCGTGTCTGG + Intergenic
904963892 1:34356698-34356720 ACTCTAGTATGTGGCTTGTCTGG - Intergenic
908616874 1:65931695-65931717 CCTGTGGGATTTGATGTGTCTGG - Intronic
910703839 1:90105346-90105368 GCTCTAGGATGTGAGCGGTCTGG - Intergenic
912481355 1:109984434-109984456 GCTGTAGGATGTGTCGTGTGGGG + Intergenic
914892375 1:151637613-151637635 CTTGTAGGATGTGAAATGTCAGG + Intronic
918135250 1:181667694-181667716 CCTCTATGATGTGATGTTTCTGG - Intronic
922354143 1:224760339-224760361 ACCCTAGGATGTGACCTGACTGG - Intergenic
1069739324 10:70677547-70677569 GCTCTAGGAAGTGACTTGCCTGG + Intronic
1076294361 10:129373296-129373318 TCTCTAGGATGTCACATGGCTGG - Intergenic
1081307751 11:41534385-41534407 CCTTTAAGATGTGCAGTGTCTGG - Intergenic
1089584476 11:119501718-119501740 CCTCTAGATTGTCACGTCTCAGG + Intergenic
1090778343 11:129984556-129984578 ACTCTAGAATGTGCCGTCTCAGG - Intronic
1096491861 12:52017056-52017078 CCTCTTTGAAGTGACCTGTCGGG + Intergenic
1097023361 12:56036078-56036100 CCTCTAGGATGTGATAGATCTGG + Exonic
1097328832 12:58311178-58311200 GCTCTGGGATGTGCCGTGACTGG - Intergenic
1098272662 12:68784045-68784067 CCTCAAGAATGTGACGTGGTGGG - Intronic
1099027628 12:77485599-77485621 CATCTAGGATGTTTCATGTCTGG + Intergenic
1107315202 13:39123863-39123885 TCTCTAGCATGTGAAGTATCTGG + Intergenic
1112309241 13:98303174-98303196 CCTCTAAGATTTGACTTTTCTGG - Intronic
1112398945 13:99058977-99058999 CCTCCAGGAGGTCAGGTGTCAGG - Intronic
1118798390 14:69166616-69166638 CCTCAAGGATGAGAAGTGTAAGG - Intergenic
1120519431 14:85509295-85509317 CCTCCAGGATGAGCCGTCTCCGG + Intergenic
1121007284 14:90498603-90498625 CCACTAGGATATGAGCTGTCTGG - Intergenic
1124831426 15:33153455-33153477 CCTCTGGGTTGTGAGGAGTCAGG + Exonic
1132590480 16:724292-724314 CCGCTGGGATGGGAGGTGTCAGG - Intronic
1137727587 16:50667504-50667526 CCTCACGGAAGTGAAGTGTCAGG - Intronic
1142898468 17:2997288-2997310 CCTGGAGGAGGAGACGTGTCAGG - Intronic
1146256699 17:31395587-31395609 CCTCTCGGATGGGATTTGTCTGG - Intronic
1154056828 18:11021054-11021076 ACTGTAGGAAGTGACTTGTCTGG + Intronic
1162028795 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG + Intronic
1162919819 19:13894145-13894167 TCCCTAGAATGTGCCGTGTCAGG - Intronic
1163522911 19:17802562-17802584 CCTCTCGGAGGTGACATTTCAGG + Intronic
1164761717 19:30733200-30733222 CCTATAGGATGTGAAGTATATGG - Intergenic
930095826 2:47565716-47565738 CCTTTAGGATGTGAAGTGATGGG + Intronic
935220756 2:101010416-101010438 CCTCAAAGATGTGAAGTGTGTGG + Intronic
944088482 2:195876881-195876903 CCTCTTGCATGTGACTTCTCTGG + Intronic
1173656609 20:44704152-44704174 CCTCGAGGAGGTCACGTGTCCGG - Intergenic
1174183999 20:48692817-48692839 CATCTGGGAGGTGACGTGTAGGG - Intronic
1174510643 20:51049441-51049463 CCTCAAGAATGTGAGGGGTCAGG + Intergenic
1174520201 20:51123501-51123523 CCTCTATGAAGTGACTTGTCTGG - Intergenic
1181718492 22:24754054-24754076 CCTCTCGGATGTTTCCTGTCTGG + Exonic
949847684 3:8388616-8388638 CCTCTCAGATGTGAGGTGCCTGG - Intergenic
970913034 4:21300629-21300651 GCTCTAGAATTTGACGTGTGGGG - Intronic
981714742 4:147741720-147741742 CCTTTAGAATGTAAAGTGTCTGG - Intronic
988439749 5:31219357-31219379 CCTACAGGATGTGATGTGTGTGG - Intronic
995822301 5:116250542-116250564 CCTCTATGAGGTGAGGTGTCAGG - Intronic
1001936618 5:175710037-175710059 CCTCAAGGAAGTGACATTTCAGG - Intergenic
1003142373 6:3482278-3482300 CCTCTAGGATGTGAAGAGGGTGG - Intergenic
1003583112 6:7360328-7360350 CCTCTATGATTTGAGGTGCCAGG + Intronic
1004747731 6:18528251-18528273 CCTCAGGAATGTGACATGTCAGG + Intergenic
1005946130 6:30597270-30597292 CCACTAGGTTGTGACATGTTTGG + Intergenic
1008869309 6:56253224-56253246 CCTCTGGGCTGTGATGTTTCTGG - Intronic
1012699313 6:102433234-102433256 CATCTAGGATATAACCTGTCAGG + Intergenic
1014919752 6:127200202-127200224 CCTCTAGAACTTGACGTCTCAGG - Intergenic
1018778769 6:167043693-167043715 GCTCTAGGAAGGGACGTGTTTGG + Exonic
1021939541 7:25666023-25666045 CCCATAGAATGTGACCTGTCAGG + Intergenic
1029218447 7:98969465-98969487 CCTCAAGGAGCTGAAGTGTCAGG - Intronic
1032937465 7:136749514-136749536 CCTCTAGGGTGGGTCATGTCAGG + Intergenic
1037357284 8:18034743-18034765 AGTCTAGGAAGTGACGGGTCTGG - Intergenic
1037892225 8:22629454-22629476 CCTCTAGCTTGTGACCTGTTGGG - Intronic
1038536239 8:28354587-28354609 CTTCTAGGATGTGAGATGTAAGG - Intronic
1039226917 8:35398405-35398427 CCACTAGGCTGTGAAGTTTCAGG + Intronic
1057034294 9:91800488-91800510 CCTCAAGGAGTTGACGTTTCTGG - Intronic
1189346284 X:40243937-40243959 TGTCTCTGATGTGACGTGTCAGG + Intergenic
1190521060 X:51279878-51279900 CATCTAGGAAGTGAAGAGTCGGG + Intergenic
1197673369 X:129303187-129303209 CTTACAGGATGTGAGGTGTCAGG - Intergenic