ID: 1162028796

View in Genome Browser
Species Human (GRCh38)
Location 19:7908691-7908713
Sequence AGGATGTGACGTGTCAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162028793_1162028796 -6 Left 1162028793 19:7908674-7908696 CCGTTGTCAGGGCCTCTAGGATG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1162028796 19:7908691-7908713 AGGATGTGACGTGTCAGGATTGG No data
1162028787_1162028796 28 Left 1162028787 19:7908640-7908662 CCTGTGGGAGGGGCACCTTGGTA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1162028796 19:7908691-7908713 AGGATGTGACGTGTCAGGATTGG No data
1162028789_1162028796 13 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028796 19:7908691-7908713 AGGATGTGACGTGTCAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162028796 Original CRISPR AGGATGTGACGTGTCAGGAT TGG Intronic
No off target data available for this crispr