ID: 1162028797

View in Genome Browser
Species Human (GRCh38)
Location 19:7908700-7908722
Sequence CGTGTCAGGATTGGCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162028789_1162028797 22 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028797 19:7908700-7908722 CGTGTCAGGATTGGCTCCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 57
1162028793_1162028797 3 Left 1162028793 19:7908674-7908696 CCGTTGTCAGGGCCTCTAGGATG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1162028797 19:7908700-7908722 CGTGTCAGGATTGGCTCCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 57
1162028794_1162028797 -9 Left 1162028794 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1162028797 19:7908700-7908722 CGTGTCAGGATTGGCTCCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162028797 Original CRISPR CGTGTCAGGATTGGCTCCTC TGG Intronic
912336907 1:108871602-108871624 CATCTCAGGATTGGCTTCTAGGG + Intronic
915630095 1:157146927-157146949 GTTGGCAGGATTGGCTCCTTTGG - Intergenic
924302850 1:242657551-242657573 CATCACAGGATTGGTTCCTCTGG - Intergenic
1066459890 10:35603802-35603824 CTTCTCAGGGTTGGCTCCTCTGG - Intergenic
1075222790 10:120599327-120599349 GGTGTGAGGACTGGCTGCTCTGG + Exonic
1076549383 10:131267954-131267976 CCTGCCAGGGTTGGCTCCTCTGG + Intronic
1078544252 11:12235266-12235288 GCTGTCAGGCTTGTCTCCTCAGG - Intronic
1083146531 11:60763917-60763939 CCTGTCAGGAATGTCTCCACGGG - Exonic
1084535547 11:69754209-69754231 TGTGGCAGGACTGGCTCCTCCGG - Intergenic
1084586545 11:70065812-70065834 CTTGTCAGGGCTGGCTCCTGGGG + Intergenic
1085273223 11:75282583-75282605 CGTGGCAGGGCTGGCTCCTCTGG - Intronic
1093371712 12:18374327-18374349 GGAGTCAGGGTTGGCTACTCAGG - Intronic
1094219209 12:27974913-27974935 CGGGGCAGGCTTGGCTCCTGGGG + Intergenic
1097750738 12:63349422-63349444 AGTTACAGCATTGGCTCCTCTGG + Intergenic
1105876810 13:24561954-24561976 AGGGTCATGATTTGCTCCTCTGG + Intergenic
1111645245 13:91023947-91023969 CCTGTCAGGATGGCCTCCTAAGG + Intergenic
1117433832 14:55697700-55697722 GTCGTCAGGATTGGTTCCTCTGG + Intronic
1118492989 14:66279949-66279971 TGTGTCAGGGTTGGCTTCTAGGG - Intergenic
1124597129 15:31100898-31100920 CCCTTCAGGATTCGCTCCTCAGG + Intronic
1125640980 15:41230762-41230784 CGCGTGCTGATTGGCTCCTCGGG - Intergenic
1131750371 15:95499977-95499999 AATGTCAAGATTGGCTTCTCAGG - Intergenic
1137584624 16:49657084-49657106 CCTGTCAGGCTGGGCTCCACGGG - Intronic
1147372868 17:40005639-40005661 CTTGTGAGGCTGGGCTCCTCAGG - Intergenic
1148103936 17:45109348-45109370 CAGGTCAGCAGTGGCTCCTCTGG + Exonic
1148723040 17:49768596-49768618 AATGTCAGGACTGGCTCCTCAGG + Intronic
1151757942 17:76085438-76085460 GAGGACAGGATTGGCTCCTCAGG + Intronic
1151980788 17:77507242-77507264 CGTGCCAGGACTGGCTGATCAGG - Intergenic
1152874171 17:82776700-82776722 CGTGTCAGGATTGTTTCGTGAGG + Intronic
1160927465 19:1553766-1553788 GGTGTCAGGATGGGCCACTCCGG - Intergenic
1162028797 19:7908700-7908722 CGTGTCAGGATTGGCTCCTCTGG + Intronic
1165948419 19:39458906-39458928 CGTGGTGGGATTGGCTCCTGTGG + Intronic
1167296264 19:48651977-48651999 CGGGTCAGGCTTGGGCCCTCCGG - Intergenic
942479550 2:176369183-176369205 CTTGTCAGGATAAGCTCCTATGG + Intergenic
946189195 2:217998833-217998855 GGTGTCAGGAAAGACTCCTCGGG - Intronic
946547371 2:220759065-220759087 CCTGTAAAGCTTGGCTCCTCTGG - Intergenic
948676841 2:239601787-239601809 CGTGGCTGCTTTGGCTCCTCTGG + Intergenic
1168809898 20:698358-698380 TGTGTCAGGAGTTGCACCTCTGG + Intergenic
1185397857 22:50601563-50601585 GGGGGCAGGGTTGGCTCCTCCGG + Intronic
955399491 3:58581299-58581321 CCTGTCAGGACTGCCTCCCCTGG - Intronic
956014788 3:64870952-64870974 AGTGTCAGAACTTGCTCCTCTGG + Intergenic
966651038 3:182301356-182301378 AGTGTTAGGACTGGATCCTCAGG + Intergenic
968906539 4:3455170-3455192 GGTGTTAGGGTTGGCTCCTCAGG - Intergenic
982287746 4:153753075-153753097 AGTTTCAGAATTGGCTGCTCTGG - Intronic
989396330 5:40960937-40960959 AGTGTCAGGATTGGCACTTGTGG + Intronic
1003224761 6:4193223-4193245 CGTGTCAGGAAGGGCTCCTCAGG + Intergenic
1008009669 6:46452625-46452647 CGTGTCAGGATTGTATTCCCTGG - Intronic
1009611169 6:65943273-65943295 TGTGTCATTTTTGGCTCCTCAGG - Intergenic
1014087023 6:117358396-117358418 TTTGTCAGGATTAGCTCCTTGGG - Intronic
1015780273 6:136858187-136858209 CTTGTCAGGGTTGGCTGGTCAGG + Intronic
1017626186 6:156351552-156351574 CCTGTCATTTTTGGCTCCTCAGG - Intergenic
1020982673 7:15091169-15091191 TATTTCAGGATTGTCTCCTCAGG + Intergenic
1021086106 7:16421945-16421967 CGTGTCAGGACACGCTCCCCAGG - Intergenic
1025956665 7:66188309-66188331 TGTGTCTCGATTGGATCCTCTGG - Intergenic
1027833071 7:83205369-83205391 CTTGTCAGGATTGAGTCCTGAGG + Intergenic
1029963260 7:104710573-104710595 GGTGTCAGGATTGATGCCTCGGG - Intronic
1031580484 7:123468360-123468382 GGTTTCAGGATTAGCTCCTCTGG - Intronic
1034266302 7:149782734-149782756 CATGTCAGGATGGGCTGCTGGGG - Intergenic
1038681049 8:29668505-29668527 AGTTTCCGGAATGGCTCCTCAGG - Intergenic
1044555873 8:93561346-93561368 CTTCTCAGGAATGGCTCCTAAGG + Intergenic
1045656022 8:104387401-104387423 CATTTCAGGGCTGGCTCCTCTGG + Intronic
1055788898 9:79900398-79900420 AGTTTCAGAATTAGCTCCTCAGG - Intergenic
1062181649 9:135194218-135194240 CCTCTCAGGTTTGGCTGCTCTGG - Intergenic
1195338222 X:103878118-103878140 CTTGTCAGGATGGCTTCCTCCGG + Intergenic
1197928744 X:131674212-131674234 AGTGTATGTATTGGCTCCTCTGG + Intergenic
1200847452 Y:7845651-7845673 CGTGTCAAGATTGTCTTCTTAGG - Intergenic
1200963552 Y:9016340-9016362 TGTGTAAGGATTGGGTCCCCTGG + Intergenic