ID: 1162028798

View in Genome Browser
Species Human (GRCh38)
Location 19:7908703-7908725
Sequence GTCAGGATTGGCTCCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162028793_1162028798 6 Left 1162028793 19:7908674-7908696 CCGTTGTCAGGGCCTCTAGGATG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1162028798 19:7908703-7908725 GTCAGGATTGGCTCCTCTGGAGG 0: 1
1: 0
2: 1
3: 20
4: 137
1162028789_1162028798 25 Left 1162028789 19:7908655-7908677 CCTTGGTAGGTGTGTGTAGCCGT 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1162028798 19:7908703-7908725 GTCAGGATTGGCTCCTCTGGAGG 0: 1
1: 0
2: 1
3: 20
4: 137
1162028794_1162028798 -6 Left 1162028794 19:7908686-7908708 CCTCTAGGATGTGACGTGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1162028798 19:7908703-7908725 GTCAGGATTGGCTCCTCTGGAGG 0: 1
1: 0
2: 1
3: 20
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162028798 Original CRISPR GTCAGGATTGGCTCCTCTGG AGG Intronic
900564492 1:3325658-3325680 GTCAGGGTTGGCTCCTTCTGAGG + Intronic
903262822 1:22140594-22140616 GCCAGGAATGGCAGCTCTGGGGG - Intronic
905339189 1:37266621-37266643 GTTATGATTGGTTCCTCTGTAGG - Intergenic
906578345 1:46911608-46911630 GGCAGGAATGGCTTCCCTGGTGG - Intergenic
907912666 1:58840518-58840540 GGCAGCACTGGCTACTCTGGAGG - Intergenic
912280991 1:108313402-108313424 GGCAGGGTTGGCTCCTTTTGAGG + Intergenic
915643184 1:157245808-157245830 TTCAGGATTAGCTTCTCTGTAGG + Intergenic
918934390 1:190901360-190901382 GTGAGAATTTGCTTCTCTGGTGG + Intergenic
919438217 1:197591046-197591068 GTTAGGATTCGCTCCTATAGAGG - Intronic
920709503 1:208281545-208281567 TTCAGTGGTGGCTCCTCTGGGGG + Intergenic
922060105 1:222080912-222080934 GGCAGAGTTGGTTCCTCTGGGGG + Intergenic
1063543050 10:6953982-6954004 GGCAGGGTTGGCTCTTTTGGAGG - Intergenic
1063961968 10:11314271-11314293 GTGAGTATTTGCTGCTCTGGTGG + Intronic
1067223498 10:44360765-44360787 CTCAGGGCTGGCTGCTCTGGAGG - Intergenic
1069048853 10:63771097-63771119 GACAGGAAAGGCTCATCTGGAGG - Intergenic
1070930420 10:80256934-80256956 CTCAGGTTTGCCTCCTCTGTGGG + Intergenic
1071353482 10:84769544-84769566 GGCAGGATGGACTTCTCTGGGGG + Intergenic
1074617360 10:115082725-115082747 GTTAGCACTGGCTTCTCTGGTGG + Intergenic
1075071594 10:119323561-119323583 ATGAGGATTGGCTTGTCTGGAGG + Intronic
1075567919 10:123518174-123518196 GTCAGGACTGGCTTCTTTGGAGG + Intergenic
1076901655 10:133341864-133341886 GGCAGGGTTGGCTCCTCCTGAGG + Intronic
1078519794 11:12053717-12053739 GTCATGATTGCCTCACCTGGAGG + Intergenic
1081658537 11:44873881-44873903 ATGAGGATTGGCCCCTCAGGGGG + Intronic
1083591641 11:63898847-63898869 GTCAGGCCTAGCTCCTATGGAGG - Intronic
1085273222 11:75282580-75282602 GGCAGGGCTGGCTCCTCTGGAGG - Intronic
1086928559 11:92667585-92667607 ATCAGCACTGGCTCCTCTGCAGG - Intronic
1086998510 11:93388294-93388316 GTCAGGCTTGACTATTCTGGAGG - Intronic
1089731955 11:120524832-120524854 GTCAGGATTGGGTACTGTGGTGG + Intronic
1090172364 11:124616246-124616268 ATCAGTATTGGCTCCTCTGAAGG + Intronic
1090364004 11:126191346-126191368 GGCAGGCTTGGTTTCTCTGGAGG - Intergenic
1091314608 11:134604626-134604648 GTCAAGACTGGCTCCTCAGCTGG - Intergenic
1092448580 12:8581336-8581358 GGCTGATTTGGCTCCTCTGGGGG + Intergenic
1093643854 12:21559154-21559176 GTCAGGAATTTCTCCTCTGCAGG + Exonic
1096183333 12:49563265-49563287 GTCAGGCTTGGCTCTTCCTGAGG + Intronic
1096437438 12:51606019-51606041 GTCAAGATTTTCTCCTCTGTGGG + Intronic
1096530074 12:52236826-52236848 GCCAGGAGTGGCTCCTTGGGAGG + Intronic
1100037365 12:90269206-90269228 GTCAGAATTGGCTTCTATAGTGG + Intergenic
1103871975 12:124098767-124098789 GACAGGAATGGTTGCTCTGGAGG + Intronic
1109945008 13:69421159-69421181 GTCAGGATTGTGTGCTCTGCAGG - Intergenic
1111545837 13:89734744-89734766 CTCAGGACTGGTTCCTGTGGAGG + Intergenic
1113068204 13:106392913-106392935 TGCAGGGTTGGTTCCTCTGGAGG + Intergenic
1116984748 14:51206570-51206592 ATCAGGCTTGGTTTCTCTGGTGG + Intergenic
1117538651 14:56725509-56725531 GTCAGGTGTGGCTCCTATGAAGG + Intronic
1121038563 14:90726750-90726772 GCCAGGATTGCCGCCTCTGAGGG - Intronic
1122190289 14:100037031-100037053 GGCAGGTTTGCCTTCTCTGGAGG - Intronic
1126865117 15:52927865-52927887 GGCAGGGCTGCCTCCTCTGGAGG + Intergenic
1128245758 15:66131598-66131620 GGCAGCATGGGCACCTCTGGAGG + Intronic
1131040184 15:89257425-89257447 GTCAGGGTTGGTTCCTTTTGAGG + Intronic
1132756267 16:1486982-1487004 GACAGGGCTGGTTCCTCTGGAGG + Intronic
1134188868 16:12106005-12106027 CTCAGCCGTGGCTCCTCTGGAGG + Intronic
1137584623 16:49657081-49657103 GTCAGGCTGGGCTCCACGGGAGG - Intronic
1141385512 16:83619517-83619539 GGCAGGGTTGGTTCCTTTGGAGG + Intronic
1142765435 17:2061607-2061629 AGCCGGATTGGCTCCTCTGTGGG + Exonic
1143310664 17:5985809-5985831 GGCAGGGTTGGCTTCTCTGAAGG - Intronic
1143769980 17:9162349-9162371 GGCAGGGTTGGTTGCTCTGGAGG + Intronic
1143986753 17:10921294-10921316 TTCACTCTTGGCTCCTCTGGAGG - Intergenic
1147654519 17:42081248-42081270 CTCAGGAGGGGCCCCTCTGGAGG + Intergenic
1148103937 17:45109351-45109373 GTCAGCAGTGGCTCCTCTGGTGG + Exonic
1148879515 17:50715014-50715036 GGCAGGTTTGGTTTCTCTGGAGG + Intergenic
1150473830 17:65459594-65459616 CTTAGGATTGGCTCTCCTGGGGG + Intergenic
1150557540 17:66267953-66267975 GTCAGGCTTTGCTGCTCTGGGGG + Intergenic
1150862845 17:68818934-68818956 GTCAAGGTTTGCTCCTATGGAGG + Intergenic
1150925383 17:69526994-69527016 CTCAGGATAGGCTTTTCTGGAGG + Intronic
1152114606 17:78377990-78378012 GTCAAGATTGACTCCTCGGCCGG - Intergenic
1152513441 17:80805787-80805809 GACAGGAATGGCCACTCTGGAGG - Intronic
1159891610 18:73958506-73958528 GTTAGGATTGCCTCCTGTTGGGG - Intergenic
1162028798 19:7908703-7908725 GTCAGGATTGGCTCCTCTGGAGG + Intronic
1163646754 19:18493867-18493889 TTCAGGATTGTCCCCACTGGTGG - Intronic
1164932811 19:32188231-32188253 GTCAGGGCAGGCTCCTCTGAAGG - Intergenic
1167296263 19:48651974-48651996 GTCAGGCTTGGGCCCTCCGGTGG - Intergenic
929457334 2:42075207-42075229 ATCAGGACTGGCTCCTGGGGTGG - Intergenic
929623981 2:43387527-43387549 GTCAGGAATGGTTTCTTTGGTGG + Intronic
934067655 2:88354386-88354408 GGCAGGGTTGGCTCCTTCGGAGG - Intergenic
934565675 2:95339241-95339263 GTCAGGCCTGGCTCCCCTTGTGG - Intronic
938063457 2:128269097-128269119 GCCTGGCCTGGCTCCTCTGGAGG + Intronic
938138264 2:128776521-128776543 GTCAGGATGGGCTCTTCAGGTGG - Intergenic
938265175 2:129923210-129923232 AACAGGAGTGGCTCCTCAGGGGG + Intergenic
938292321 2:130156755-130156777 GTGAGGGTTGGCTCCGCCGGGGG + Intronic
940512557 2:154637062-154637084 GTCCAGATTGTCTCCTTTGGTGG + Intergenic
945224462 2:207519371-207519393 GTTAGGATTTGCTCCACTGCTGG - Intergenic
945522723 2:210848304-210848326 GCTAGGTTTGGCTACTCTGGGGG + Intergenic
946058415 2:216920595-216920617 TTCAGAACGGGCTCCTCTGGGGG - Intergenic
946189194 2:217998830-217998852 GTCAGGAAAGACTCCTCGGGAGG - Intronic
948259326 2:236591180-236591202 TTCAGGGTTGGTTCTTCTGGAGG + Intergenic
1175067214 20:56299599-56299621 TTCTGGATTGGCTGCTCTTGTGG - Intergenic
1175544446 20:59769141-59769163 GTCAGGGCTGGCTCCCCTGGAGG - Intronic
1176038923 20:63054286-63054308 GGCAGGGCTGGCTCCTGTGGAGG + Intergenic
1176389590 21:6156702-6156724 GTCAGGAATGGCTGCTCAAGTGG + Intergenic
1177836213 21:26188829-26188851 AGCAGGATTGGCTTCTCTGGGGG - Intergenic
1177859632 21:26437728-26437750 GACAGGATTGGCACCTCCTGTGG - Intergenic
1179251397 21:39674126-39674148 GTCAGGGCTGGCTCCTCCTGAGG + Intergenic
1179721818 21:43320638-43320660 GTCAGGGCTGGCTCCTCCTGGGG - Intergenic
1179733878 21:43381536-43381558 GTCAGGAATGGCTGCTCAAGTGG - Intergenic
1180257917 21:46646060-46646082 GGCAGGAGTGGCTCCCCTGTTGG + Intronic
1181506975 22:23365586-23365608 GTTAGGAAAGGCTCCTCTGGGGG - Intergenic
1181734054 22:24868275-24868297 GTCTGGCTTGGCACCCCTGGGGG + Intronic
1182626416 22:31649977-31649999 GTCAGGGTTGCTTCCTTTGGAGG - Intronic
1184586952 22:45454366-45454388 TTTAGGATGGGCTCCTCTGTGGG - Intergenic
1184889444 22:47370827-47370849 GTCAGGTGTGGCTGCTGTGGGGG + Intergenic
949838305 3:8292851-8292873 GTCAGGGTGGGCCCCTCTGCTGG + Intergenic
949879067 3:8647770-8647792 GGCAGTCTTGGCTCCTGTGGGGG - Intronic
950459369 3:13112136-13112158 GTCAGGAATGGCTCCAGGGGAGG - Intergenic
950750162 3:15122122-15122144 AGCAGGGTTGGTTCCTCTGGAGG - Intergenic
951201828 3:19883881-19883903 AGCAGGATTGGTTCCTCTGGTGG - Intronic
952006770 3:28850238-28850260 GGCAGGCTTGGGTCATCTGGAGG + Intergenic
955236371 3:57143421-57143443 TTCAGGACTGGCTCCTCTGAGGG - Intronic
957988922 3:87606851-87606873 GACAGGATTGGGACTTCTGGAGG + Intergenic
960609911 3:119546221-119546243 GTCAGGACTGACTTCTCTTGGGG - Intronic
961743306 3:129047061-129047083 GTCTGGGTTGCCTGCTCTGGAGG + Intergenic
962353778 3:134676824-134676846 GCCAGGCTAGGTTCCTCTGGGGG - Intronic
962851844 3:139313991-139314013 GTCTCCTTTGGCTCCTCTGGAGG + Intronic
964515996 3:157508353-157508375 CTCAGCATTGGCACCTGTGGGGG + Intronic
968565289 4:1309439-1309461 GGCTGGCCTGGCTCCTCTGGGGG + Intronic
969497553 4:7534763-7534785 GGCAGGGCTGGTTCCTCTGGAGG - Intronic
969501217 4:7554463-7554485 GTCAGGAGTAGGGCCTCTGGGGG - Intronic
971355527 4:25891394-25891416 GTCTGGATAGGCATCTCTGGAGG - Intronic
974317109 4:60296612-60296634 GTCATGAGTGGCTCCTCTCCAGG - Intergenic
975646372 4:76549935-76549957 TTTAGGAGTGGATCCTCTGGAGG + Intronic
977400883 4:96530675-96530697 GTCACCATTGGATCATCTGGTGG - Intergenic
984707941 4:182861522-182861544 GGCAGGGTTGGCTCCTCCTGGGG - Intergenic
986269820 5:6220686-6220708 GTCAGGGCTGTTTCCTCTGGAGG + Intergenic
986951886 5:13098193-13098215 TTCAGTCTTAGCTCCTCTGGTGG - Intergenic
995787383 5:115843916-115843938 GGCAGGAGTGGCAGCTCTGGTGG + Intronic
997207149 5:132056658-132056680 GGCAGGACTGTCGCCTCTGGAGG + Intergenic
999240419 5:150124416-150124438 GTCAGAATAGGCTCCTGTGGTGG - Intronic
999823906 5:155256015-155256037 GTCAGGGTTGGTTCCTCTCGAGG + Intergenic
1001664556 5:173421684-173421706 GTCAGGGTTGGCTTCTCCTGAGG + Intergenic
1002970177 6:2008440-2008462 GTCAGGACTGGCTGATCTAGTGG + Intronic
1003218273 6:4135289-4135311 GTCAGGATGGGCGCGTCGGGAGG - Intronic
1003224762 6:4193226-4193248 GTCAGGAAGGGCTCCTCAGGAGG + Intergenic
1005351336 6:24938348-24938370 GGCAGGATTGGTTCTTCTGAGGG - Intronic
1007808020 6:44465225-44465247 ATCAGGGTTGGCTCTTCTGGGGG + Intergenic
1007925021 6:45643473-45643495 GGCAGTACTGGGTCCTCTGGAGG + Intronic
1010108971 6:72202308-72202330 GGCAGGGTTGGTTCCTTTGGAGG + Intronic
1012245387 6:96920373-96920395 GTCAGGATAGGCCCCTCTTAGGG - Intergenic
1014087022 6:117358393-117358415 GTCAGGATTAGCTCCTTGGGTGG - Intronic
1017917919 6:158846975-158846997 GACAGGGCTGGCTCCTCTTGCGG + Intergenic
1018200619 6:161391378-161391400 TTCAGGATTGTCTTCTCTTGTGG + Intronic
1025942211 7:66082821-66082843 GCCTGGGTTGACTCCTCTGGGGG + Intronic
1026503895 7:70965988-70966010 GGCAGGGTTGGTTCCTTTGGAGG - Intergenic
1031571927 7:123369770-123369792 GCCAGCATTCGCTCCTCTTGAGG - Intergenic
1032114789 7:129107787-129107809 ATCAGGGTTGGTTCTTCTGGAGG + Intergenic
1034426266 7:151015859-151015881 GTCAGTATTGCCTCCTGTGAGGG - Intronic
1035075788 7:156176475-156176497 AGCAGGATTGGTTCCTCTTGGGG - Intergenic
1035655064 8:1299227-1299249 GTCAGGACTGGCATCTATGGCGG - Intergenic
1037191239 8:16128481-16128503 GGCAGGATTGGCTTCTCCTGAGG - Intronic
1039596841 8:38797995-38798017 TGCTGGATTGGCTTCTCTGGAGG + Intronic
1043729546 8:83657484-83657506 GTCAGCATTTGCTCCTATGTTGG - Intergenic
1044950508 8:97431370-97431392 GGCAGGGCTGGTTCCTCTGGAGG - Intergenic
1048501435 8:134979075-134979097 GTCAGGCTTGTTTCCCCTGGTGG + Intergenic
1052333977 9:27300955-27300977 GGCAGGATTGGCTCCTCCTGAGG - Intergenic
1056135319 9:83624564-83624586 GTCAGGGATGTCTCCTCTGGGGG + Intronic
1056938022 9:90932748-90932770 GTCAGGAATGGCTCTCCTGTTGG + Intergenic
1060309145 9:122443811-122443833 GTCAGGATTGGTTCCTTCTGAGG + Intergenic
1062579533 9:137223192-137223214 GTCTGGCTTGGCCCCTCTGTGGG + Intergenic
1192713903 X:73618929-73618951 GTCAGAAATGGCTTCTTTGGGGG + Intronic
1196016888 X:110949149-110949171 GTGAGGATTGGCTCATTTGGTGG + Intronic
1197928745 X:131674215-131674237 GTATGTATTGGCTCCTCTGGTGG + Intergenic
1198879449 X:141263530-141263552 GCCAGGACTGCCTACTCTGGTGG - Intergenic