ID: 1162031123

View in Genome Browser
Species Human (GRCh38)
Location 19:7917674-7917696
Sequence GGGAAGTGCCACGCTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162031123_1162031128 3 Left 1162031123 19:7917674-7917696 CCAGTCTCAGCGTGGCACTTCCC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1162031128 19:7917700-7917722 GGGCCGCCCAAGAGTGTCCCCGG 0: 1
1: 0
2: 1
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162031123 Original CRISPR GGGAAGTGCCACGCTGAGAC TGG (reversed) Intronic
900938755 1:5784189-5784211 GGGAAGTACCACAAGGAGACAGG + Intergenic
902853380 1:19180078-19180100 CGGATGTGCCAGGCAGAGACAGG + Intronic
903198348 1:21711480-21711502 ATGAAGTGACAAGCTGAGACAGG + Intronic
903738267 1:25543900-25543922 GGAAAGGGCCACGCCGGGACCGG - Intronic
904418448 1:30376663-30376685 ACCAAGTGCCAAGCTGAGACTGG + Intergenic
907157066 1:52344273-52344295 AGGAAGAGCCAGGCTGAGCCTGG - Intronic
913341334 1:117760469-117760491 GGAAAGTCCCATGCTGAGGCTGG + Intergenic
915599281 1:156912553-156912575 GAAAAGTGCCACCCAGAGACTGG + Exonic
916918623 1:169438729-169438751 GCGAATAGCCACCCTGAGACAGG + Intronic
917149401 1:171928727-171928749 GGGAATTGCCAAGCTGCTACTGG + Intronic
918421367 1:184367191-184367213 AAGAAGCGTCACGCTGAGACCGG + Intergenic
922194588 1:223348977-223348999 GGGAGGTGCCAAGCAGAGAGGGG + Intronic
923098447 1:230793786-230793808 GCAAAGTGCCAGGCTGAGAAGGG + Intronic
1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG + Intergenic
1072732083 10:97852987-97853009 GGGAAGTGCCTGGCTGGGAGGGG + Intronic
1073868951 10:107839434-107839456 GGGGAGGGCCACAGTGAGACAGG + Intergenic
1074747133 10:116545946-116545968 CGGAACTGCCACGGTGAGTCGGG + Exonic
1076437085 10:130453848-130453870 GGGCTGTGTCACGGTGAGACTGG + Intergenic
1076711562 10:132338547-132338569 GGGAAGGGCCAGGCTGAGGAGGG - Intronic
1076939338 10:133591061-133591083 GGGAAGGGGCATGCTGAGTCGGG + Intergenic
1077092781 11:787248-787270 GCCAAGGGCCACGCTGGGACTGG + Exonic
1083731404 11:64654327-64654349 GGGAAATGCCAGGCTGCTACTGG + Intronic
1086501209 11:87455846-87455868 GGGAAGGGCCAAGATGATACAGG - Intergenic
1087141591 11:94769628-94769650 GGTATTTGCCACGCGGAGACAGG - Intronic
1089674777 11:120082343-120082365 GGGAAATGCCAAGGTGAGGCAGG - Intergenic
1089675154 11:120084326-120084348 GGGAAATGCCAAGGTGAGGCAGG - Intergenic
1089675444 11:120085621-120085643 GGGAAATGCCAAGGTGAGGCAGG - Intergenic
1089949739 11:122514527-122514549 GGGAAGGGCTAGGATGAGACTGG + Intergenic
1091022474 11:132113213-132113235 GAGAAGTGCCTCGCTGAGACTGG - Intronic
1093498496 12:19783736-19783758 GGGAAGTGCAAAGCTGCTACCGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1097187130 12:57201999-57202021 CAGCAGGGCCACGCTGAGACCGG - Intronic
1098592677 12:72232161-72232183 GGGAAGTGCCAGGGTCAGTCAGG + Intronic
1098763690 12:74457456-74457478 GTAAAGGTCCACGCTGAGACTGG - Intergenic
1102984452 12:117266981-117267003 GGGAAGGGACAAGTTGAGACAGG - Intronic
1103950626 12:124549228-124549250 GGCATGTGCCGCACTGAGACAGG + Intronic
1105349363 13:19601958-19601980 GCGCAGTGCCACGCTCAGGCAGG - Intergenic
1106181957 13:27376933-27376955 GGGATTTGCCACGCTGTGCCCGG + Intergenic
1117090603 14:52246312-52246334 GGGAAGAGAGACGCTGGGACAGG - Intergenic
1119383042 14:74240603-74240625 GGGAATTGCCAAGCTCAAACAGG - Intronic
1121523245 14:94600462-94600484 GGTAAGTGCCAAGCTGAGCCAGG - Intronic
1123467601 15:20528288-20528310 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1123650513 15:22472754-22472776 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123740921 15:23281596-23281618 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123746077 15:23320962-23320984 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124278346 15:28344279-28344301 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1124602430 15:31146259-31146281 TGTGAGTGACACGCTGAGACTGG + Intronic
1124691813 15:31829631-31829653 GGGAATGGCCACCCTGAGGCTGG - Intronic
1125260684 15:37821407-37821429 GGGAAGTGCCACTCATAGAACGG + Intergenic
1127350821 15:58150160-58150182 GGCAAATGCCCCTCTGAGACAGG - Intronic
1128450841 15:67805108-67805130 GGGCAGGGACCCGCTGAGACTGG - Intronic
1129379324 15:75155326-75155348 GGGAGATGCCAGGCTGAAACAGG + Intergenic
1129388390 15:75208153-75208175 GGGCAGTGCCAGGCTGAAGCAGG - Exonic
1132860031 16:2065887-2065909 GGCAAGCGCCACGCTGAGGATGG - Intronic
1135140099 16:19913832-19913854 GGAAAGTGCCACCCTAAGAATGG - Intergenic
1139181398 16:64752614-64752636 GGGATGTGGCATGCTGAGGCAGG - Intergenic
1141041453 16:80676108-80676130 GGAAAGTGCCAGGCTGTGATGGG - Intronic
1141722318 16:85763287-85763309 GGGAAGCCCCACGCTGACCCGGG - Intergenic
1142102102 16:88278973-88278995 GTGGTGTGCCACGCTGACACTGG + Intergenic
1142376394 16:89709057-89709079 GGGAAGAGCCACGGTGACCCTGG + Intronic
1144705253 17:17363748-17363770 GGGGAGGGCCAGGCGGAGACAGG - Intergenic
1148105138 17:45114903-45114925 GGGGAGTGGCACGCTGAGGGCGG - Intronic
1149470299 17:56910830-56910852 GGGCATTGCCCAGCTGAGACTGG + Intronic
1150240938 17:63632119-63632141 GGGAAGGGACACGCTCAAACAGG - Intronic
1151382126 17:73733094-73733116 GGGAACTGCCAGGCTGGGAGAGG - Intergenic
1152649065 17:81483605-81483627 GGCAAGCGCCATGCTGAGAGGGG - Intergenic
1152723560 17:81934528-81934550 GGGCAGTGCCCCGCAGAGGCAGG - Intronic
1152932415 17:83116590-83116612 GGGGTGTCCCACGCTGACACCGG + Intergenic
1154083275 18:11278574-11278596 GAGAAGGGCCCCGCTGAGACAGG + Intergenic
1155197178 18:23486160-23486182 GGAGAGTCCCATGCTGAGACAGG - Intronic
1155954409 18:31944809-31944831 GGGAAAAGTCACGCTGGGACTGG - Intronic
1160172088 18:76563352-76563374 GGGCAGGGCCAACCTGAGACAGG + Intergenic
1160757195 19:764031-764053 GAGAAGTCCCAAGCTGAGAGGGG + Exonic
1161537320 19:4828023-4828045 GAGAAGGGCCATGCTGGGACAGG + Intronic
1162031123 19:7917674-7917696 GGGAAGTGCCACGCTGAGACTGG - Intronic
1162546829 19:11335837-11335859 GGGCAGTGCCCCTCTAAGACAGG - Intronic
1163725565 19:18921467-18921489 GGGATGTTCCAGGCTGAGCCTGG + Intronic
1164865478 19:31601040-31601062 GGGAGTTGCCAGGCTGACACTGG + Intergenic
927022856 2:19035482-19035504 GGGAAGGGCCCAGCTCAGACAGG - Intergenic
931388338 2:61817133-61817155 GTCAAGTGCCACGCGGGGACAGG + Intergenic
938199777 2:129363194-129363216 GGGAAGTGGCACGGAGAGCCAGG - Intergenic
939380961 2:141435695-141435717 TAGAAGTGCCACAATGAGACAGG - Intronic
943343552 2:186710174-186710196 GGGAACTGAGACACTGAGACAGG + Intronic
1174411490 20:50339522-50339544 GGGATGTGCCAGGCAGAGCCAGG + Intergenic
1175321106 20:58088995-58089017 GGGAAGGGCCATTCTGAGAAAGG - Intergenic
1176119745 20:63448917-63448939 GGAAATTGCAAGGCTGAGACAGG - Intronic
1178261206 21:31101159-31101181 GGGAAGTGGAAGGCTGAGGCAGG + Intergenic
1181371979 22:22425927-22425949 GGGAAGTGGCTCGGTGAGCCGGG - Intergenic
1182740936 22:32567079-32567101 TGGAAATGCCACAGTGAGACTGG + Intronic
1184217258 22:43076022-43076044 GGGGAGGGCCACCCTGAGAAGGG + Intronic
1184649271 22:45912293-45912315 GGGAACTGCCAAGGTGAGGCTGG + Intergenic
950452140 3:13071543-13071565 TGGAAGTTCCACGCTGGGAAAGG + Intronic
953024638 3:39137822-39137844 GGGAAGAGGCAGGCTGAGAGGGG + Intronic
956390764 3:68770771-68770793 GGGAAGTGCCAGGTAGAGAAGGG + Intronic
957556573 3:81769498-81769520 GGGGAGAGCCCAGCTGAGACTGG + Intergenic
961402587 3:126657678-126657700 GGCAAAGGCCACGCTGAGAAAGG - Intergenic
969279887 4:6162616-6162638 GGGCAGTGCCACACTGAGCTTGG - Intronic
969560312 4:7942499-7942521 GGGAGATGCCATGCTGAGAAAGG + Intergenic
969643203 4:8411512-8411534 GGGGAGGGCCTGGCTGAGACTGG - Intronic
969694427 4:8726540-8726562 GAGAAGTGCCAGGCTCAGGCTGG + Intergenic
972957917 4:44415549-44415571 GGGAAGTGGCACTCTGGGCCTGG - Intronic
974184778 4:58431330-58431352 GGGAGGTGCCACACTGCTACTGG + Intergenic
976648444 4:87409832-87409854 GGGAGGTTCCAAGCTGAGATTGG - Intergenic
982467932 4:155753527-155753549 GGGAAGTTCCAGGCTCAGACAGG + Intergenic
984205413 4:176781944-176781966 AGTGAGTGCCACTCTGAGACAGG - Intronic
987332819 5:16872162-16872184 GGGCAGTGGCACCCAGAGACTGG + Intronic
988769127 5:34413284-34413306 GGGAAAAGCCAAGCTGAGAATGG - Intergenic
1001565209 5:172695682-172695704 GGGAAGGCCCAAGCTGAGAGGGG - Intergenic
1002423569 5:179163092-179163114 GGGAGGAGCCAGGCTGAGGCAGG + Intronic
1002441878 5:179268647-179268669 GAGGACTGCCAGGCTGAGACTGG + Intronic
1004707291 6:18136306-18136328 GGGAAGTGCAAAGCAGACACTGG + Intronic
1004893101 6:20120748-20120770 GGTAAGAGCCACGCTGAAAGAGG + Intronic
1005690901 6:28304455-28304477 GGGGAGTGACACCCTAAGACTGG + Intergenic
1006372204 6:33652084-33652106 GGGAGGTGCTGAGCTGAGACCGG - Intronic
1007785949 6:44279448-44279470 AAGAAGTGCCACACTGGGACAGG - Exonic
1008905377 6:56672104-56672126 TGGTAGTGCCAGGCTCAGACAGG + Intronic
1010028454 6:71246097-71246119 GGGAAGTGCTAAGCAGAGAAAGG - Intergenic
1012855729 6:104498979-104499001 GGGAAGTGCCAAGGTCAGGCTGG + Intergenic
1017386480 6:153890802-153890824 GGGGAATGACATGCTGAGACCGG + Intergenic
1030237893 7:107286689-107286711 GAGAAGTGCCACGTTGAGAAAGG - Intronic
1032308000 7:130754792-130754814 GGGAAGTTGCACTCTGAGTCTGG + Intergenic
1036373683 8:8182227-8182249 GGGACGTTCCATGCTGAGAAAGG - Intergenic
1036877220 8:12483414-12483436 GGGACGTTCCATGCTGAGAAAGG + Intergenic
1036930439 8:12951443-12951465 AGGAAGGGCCACGCCGAGAGAGG + Intronic
1038533405 8:28336922-28336944 GTGAGGTGCCACTCAGAGACAGG + Intronic
1039471828 8:37818224-37818246 GGGAGGTGCCAGCCTGAGAGGGG - Intronic
1040673938 8:49726032-49726054 GTGCAGTGGCAGGCTGAGACAGG + Intergenic
1048254808 8:132897765-132897787 GTGCAGTGCCACGCTGGGACTGG + Exonic
1055780117 9:79811787-79811809 GGCATGTGCCACGTAGAGACGGG + Intergenic
1056687159 9:88776199-88776221 GGCAAGTCCCAGGCTGAGAAGGG + Intergenic
1057856083 9:98601828-98601850 GGGCACTGCCAGGCTGAGCCTGG + Intronic
1060274636 9:122173111-122173133 GGGAAATGCCACCACGAGACTGG - Intronic
1062181708 9:135194485-135194507 GGGAAGGGCCAAGCTGAACCAGG - Intergenic
1185711210 X:2304782-2304804 AGGAATTGCTACACTGAGACTGG - Intronic
1186515624 X:10164459-10164481 GGGGAGTGACATGTTGAGACTGG + Intronic
1186604505 X:11076512-11076534 GGGAAGTGCCACAATGAAGCAGG - Intergenic
1187045910 X:15647244-15647266 GGGAAGTGCCCCGGTGGGGCCGG - Intronic
1187051888 X:15703545-15703567 GGGAAGTGCCCCGGTGGGGCCGG - Intronic
1192422352 X:71044942-71044964 GGGAAGTCGCTCTCTGAGACAGG - Intergenic
1194221551 X:91199985-91200007 GGGAAGTGCCAGGTAGAGAAAGG + Intergenic
1200233813 X:154458773-154458795 GGGCAGCCCCACGCAGAGACGGG - Intronic
1200558063 Y:4663741-4663763 GGGAAGTGCCAGGTAGAGAAAGG + Intergenic
1200788716 Y:7281091-7281113 GGAAAGTCCCAGGCAGAGACAGG + Intergenic
1201619134 Y:15935792-15935814 GTGAAATGCCACGTTGAGAGTGG - Intergenic