ID: 1162031831

View in Genome Browser
Species Human (GRCh38)
Location 19:7920820-7920842
Sequence CGGCACGCACGCCCCGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 228}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162031831_1162031835 -4 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031835 19:7920839-7920861 GCCGCTGAGGTTTGGAGAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 136
1162031831_1162031840 12 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031840 19:7920855-7920877 GAGTGGGTGGGTGAGTTTGAGGG 0: 1
1: 1
2: 2
3: 55
4: 584
1162031831_1162031843 27 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031843 19:7920870-7920892 TTTGAGGGGCAGGACGAGCCTGG No data
1162031831_1162031846 30 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031846 19:7920873-7920895 GAGGGGCAGGACGAGCCTGGGGG No data
1162031831_1162031844 28 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031844 19:7920871-7920893 TTGAGGGGCAGGACGAGCCTGGG No data
1162031831_1162031839 11 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031839 19:7920854-7920876 AGAGTGGGTGGGTGAGTTTGAGG 0: 1
1: 0
2: 4
3: 72
4: 686
1162031831_1162031837 -1 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031837 19:7920842-7920864 GCTGAGGTTTGGAGAGTGGGTGG 0: 1
1: 1
2: 5
3: 55
4: 550
1162031831_1162031838 0 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031838 19:7920843-7920865 CTGAGGTTTGGAGAGTGGGTGGG 0: 1
1: 0
2: 5
3: 45
4: 490
1162031831_1162031834 -5 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031834 19:7920838-7920860 TGCCGCTGAGGTTTGGAGAGTGG 0: 1
1: 0
2: 0
3: 19
4: 268
1162031831_1162031842 17 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031842 19:7920860-7920882 GGTGGGTGAGTTTGAGGGGCAGG 0: 1
1: 0
2: 4
3: 44
4: 489
1162031831_1162031845 29 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031845 19:7920872-7920894 TGAGGGGCAGGACGAGCCTGGGG No data
1162031831_1162031841 13 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031841 19:7920856-7920878 AGTGGGTGGGTGAGTTTGAGGGG 0: 1
1: 0
2: 4
3: 39
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162031831 Original CRISPR CGGCACGCACGCCCCGCCCC CGG (reversed) Intronic