ID: 1162031836

View in Genome Browser
Species Human (GRCh38)
Location 19:7920840-7920862
Sequence ACCCACTCTCCAAACCTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 214}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162031836_1162031845 9 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031845 19:7920872-7920894 TGAGGGGCAGGACGAGCCTGGGG No data
1162031836_1162031854 25 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031854 19:7920888-7920910 CCTGGGGGCGGGGCGTGGGCGGG No data
1162031836_1162031846 10 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031846 19:7920873-7920895 GAGGGGCAGGACGAGCCTGGGGG No data
1162031836_1162031844 8 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031844 19:7920871-7920893 TTGAGGGGCAGGACGAGCCTGGG No data
1162031836_1162031848 14 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031848 19:7920877-7920899 GGCAGGACGAGCCTGGGGGCGGG No data
1162031836_1162031842 -3 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031842 19:7920860-7920882 GGTGGGTGAGTTTGAGGGGCAGG 0: 1
1: 0
2: 4
3: 44
4: 489
1162031836_1162031849 15 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031849 19:7920878-7920900 GCAGGACGAGCCTGGGGGCGGGG No data
1162031836_1162031841 -7 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031841 19:7920856-7920878 AGTGGGTGGGTGAGTTTGAGGGG 0: 1
1: 0
2: 4
3: 39
4: 527
1162031836_1162031847 13 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031847 19:7920876-7920898 GGGCAGGACGAGCCTGGGGGCGG No data
1162031836_1162031840 -8 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031840 19:7920855-7920877 GAGTGGGTGGGTGAGTTTGAGGG 0: 1
1: 1
2: 2
3: 55
4: 584
1162031836_1162031852 24 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031852 19:7920887-7920909 GCCTGGGGGCGGGGCGTGGGCGG No data
1162031836_1162031843 7 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031843 19:7920870-7920892 TTTGAGGGGCAGGACGAGCCTGG No data
1162031836_1162031851 21 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031851 19:7920884-7920906 CGAGCCTGGGGGCGGGGCGTGGG No data
1162031836_1162031850 20 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031850 19:7920883-7920905 ACGAGCCTGGGGGCGGGGCGTGG No data
1162031836_1162031839 -9 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031839 19:7920854-7920876 AGAGTGGGTGGGTGAGTTTGAGG 0: 1
1: 0
2: 4
3: 72
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162031836 Original CRISPR ACCCACTCTCCAAACCTCAG CGG (reversed) Intronic