ID: 1162031840

View in Genome Browser
Species Human (GRCh38)
Location 19:7920855-7920877
Sequence GAGTGGGTGGGTGAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 1, 2: 2, 3: 55, 4: 584}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162031831_1162031840 12 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031840 19:7920855-7920877 GAGTGGGTGGGTGAGTTTGAGGG 0: 1
1: 1
2: 2
3: 55
4: 584
1162031836_1162031840 -8 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031840 19:7920855-7920877 GAGTGGGTGGGTGAGTTTGAGGG 0: 1
1: 1
2: 2
3: 55
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162031840 Original CRISPR GAGTGGGTGGGTGAGTTTGA GGG Intronic