ID: 1162031842

View in Genome Browser
Species Human (GRCh38)
Location 19:7920860-7920882
Sequence GGTGGGTGAGTTTGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 489}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162031836_1162031842 -3 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031842 19:7920860-7920882 GGTGGGTGAGTTTGAGGGGCAGG 0: 1
1: 0
2: 4
3: 44
4: 489
1162031831_1162031842 17 Left 1162031831 19:7920820-7920842 CCGGGGGCGGGGCGTGCGTGCCG 0: 1
1: 1
2: 1
3: 30
4: 228
Right 1162031842 19:7920860-7920882 GGTGGGTGAGTTTGAGGGGCAGG 0: 1
1: 0
2: 4
3: 44
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162031842 Original CRISPR GGTGGGTGAGTTTGAGGGGC AGG Intronic