ID: 1162031847

View in Genome Browser
Species Human (GRCh38)
Location 19:7920876-7920898
Sequence GGGCAGGACGAGCCTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162031836_1162031847 13 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031847 19:7920876-7920898 GGGCAGGACGAGCCTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162031847 Original CRISPR GGGCAGGACGAGCCTGGGGG CGG Intronic