ID: 1162031849 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:7920878-7920900 |
Sequence | GCAGGACGAGCCTGGGGGCG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162031836_1162031849 | 15 | Left | 1162031836 | 19:7920840-7920862 | CCGCTGAGGTTTGGAGAGTGGGT | 0: 1 1: 0 2: 1 3: 20 4: 214 |
||
Right | 1162031849 | 19:7920878-7920900 | GCAGGACGAGCCTGGGGGCGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162031849 | Original CRISPR | GCAGGACGAGCCTGGGGGCG GGG | Intronic | ||