ID: 1162031851

View in Genome Browser
Species Human (GRCh38)
Location 19:7920884-7920906
Sequence CGAGCCTGGGGGCGGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162031836_1162031851 21 Left 1162031836 19:7920840-7920862 CCGCTGAGGTTTGGAGAGTGGGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1162031851 19:7920884-7920906 CGAGCCTGGGGGCGGGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162031851 Original CRISPR CGAGCCTGGGGGCGGGGCGT GGG Intronic