ID: 1162033187

View in Genome Browser
Species Human (GRCh38)
Location 19:7925997-7926019
Sequence CCCGGCGGCCGCGCTCTCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 152}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162033172_1162033187 14 Left 1162033172 19:7925960-7925982 CCCTCACCCTGGCTTCGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033169_1162033187 24 Left 1162033169 19:7925950-7925972 CCCGGCGCGCCCCTCACCCTGGC 0: 1
1: 1
2: 0
3: 41
4: 364
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033177_1162033187 8 Left 1162033177 19:7925966-7925988 CCCTGGCTTCGACCCGGACGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033164_1162033187 30 Left 1162033164 19:7925944-7925966 CCCCGCCCCGGCGCGCCCCTCAC 0: 1
1: 0
2: 9
3: 117
4: 895
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033165_1162033187 29 Left 1162033165 19:7925945-7925967 CCCGCCCCGGCGCGCCCCTCACC 0: 1
1: 1
2: 9
3: 117
4: 1082
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033170_1162033187 23 Left 1162033170 19:7925951-7925973 CCGGCGCGCCCCTCACCCTGGCT 0: 1
1: 0
2: 0
3: 32
4: 368
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033179_1162033187 7 Left 1162033179 19:7925967-7925989 CCTGGCTTCGACCCGGACGGGGA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033181_1162033187 -5 Left 1162033181 19:7925979-7926001 CCGGACGGGGACCGACCGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033174_1162033187 13 Left 1162033174 19:7925961-7925983 CCTCACCCTGGCTTCGACCCGGA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033180_1162033187 -4 Left 1162033180 19:7925978-7926000 CCCGGACGGGGACCGACCGCCCG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033171_1162033187 15 Left 1162033171 19:7925959-7925981 CCCCTCACCCTGGCTTCGACCCG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033167_1162033187 25 Left 1162033167 19:7925949-7925971 CCCCGGCGCGCCCCTCACCCTGG 0: 1
1: 0
2: 1
3: 27
4: 300
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
1162033166_1162033187 28 Left 1162033166 19:7925946-7925968 CCGCCCCGGCGCGCCCCTCACCC 0: 1
1: 0
2: 13
3: 91
4: 807
Right 1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162033187 Original CRISPR CCCGGCGGCCGCGCTCTCTC AGG Exonic