ID: 1162033250

View in Genome Browser
Species Human (GRCh38)
Location 19:7926178-7926200
Sequence CGGGGCCGCCGCGGGGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1467
Summary {0: 1, 1: 2, 2: 20, 3: 178, 4: 1266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162033234_1162033250 4 Left 1162033234 19:7926151-7926173 CCGCGGCTGTTCCTATGGCGACG 0: 1
1: 0
2: 1
3: 3
4: 25
Right 1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG 0: 1
1: 2
2: 20
3: 178
4: 1266
1162033231_1162033250 12 Left 1162033231 19:7926143-7926165 CCGGGCCGCCGCGGCTGTTCCTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG 0: 1
1: 2
2: 20
3: 178
4: 1266
1162033233_1162033250 7 Left 1162033233 19:7926148-7926170 CCGCCGCGGCTGTTCCTATGGCG 0: 1
1: 0
2: 1
3: 1
4: 36
Right 1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG 0: 1
1: 2
2: 20
3: 178
4: 1266
1162033242_1162033250 -7 Left 1162033242 19:7926162-7926184 CCTATGGCGACGGGGGCGGGGCC 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG 0: 1
1: 2
2: 20
3: 178
4: 1266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162033250 Original CRISPR CGGGGCCGCCGCGGGGGGCG GGG Intergenic
900092110 1:925077-925099 CGAGGCCTCCGCGCGCGGCGGGG - Intronic
900096445 1:941969-941991 TGGCGCCGCCGGCGGGGGCGGGG + Intronic
900117048 1:1033401-1033423 CGGAGTCGCCGCAGGGGGCTCGG - Intronic
900119036 1:1040891-1040913 CGGGGCCGGTGCCTGGGGCGGGG + Intronic
900121782 1:1051394-1051416 CAGGGCCTCCGGGGCGGGCGGGG + Intronic
900227370 1:1539611-1539633 CGGGGCCCACTCGGGGCGCGGGG - Intronic
900254956 1:1693168-1693190 ACGGGCTGCCGCGGGGGGTGGGG - Intronic
900255035 1:1693441-1693463 CGGGGCCGCCGCGCGGGGTGAGG + Intronic
900263705 1:1746448-1746470 ACGGGCTGCCGCGGGGGGTGGGG - Intergenic
900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG + Intergenic
900344475 1:2204584-2204606 CGGGGGCTCGGCGGCGGGCGGGG - Intronic
900349263 1:2227253-2227275 AGGGGCCGGCGGGCGGGGCGGGG + Intergenic
900349674 1:2228511-2228533 CGGGCGCGGCGCGGGGCGCGTGG + Intergenic
900349750 1:2228695-2228717 CGGGGCGGCGGCGGGGGCCGGGG + Exonic
900406577 1:2495578-2495600 CGGGGCCTCCCCGTGGGGCAGGG - Intronic
900417286 1:2540931-2540953 GAGGGCGGCGGCGGGGGGCGCGG - Intergenic
900629328 1:3625287-3625309 CAGGGCCGGGGCGGGGGCCGAGG + Intronic
900786688 1:4654433-4654455 CGGGGTCGCCGCGGGTGGTGGGG - Intergenic
900787107 1:4655826-4655848 CGCGGCGGGCGCGGGGGCCGGGG + Intronic
901057627 1:6456022-6456044 CGGGGGAGGCGCGGCGGGCGGGG - Intronic
901086112 1:6613457-6613479 CGGCTCGGCCGCGGGGGGAGGGG - Intronic
901198554 1:7453871-7453893 CCGGGCTGCTGCGGGGGGCCGGG - Intronic
901262695 1:7885584-7885606 CGGGGCCGGGGAGGGGAGCGAGG + Intergenic
901506592 1:9689481-9689503 CGGGGCGCCGGCTGGGGGCGGGG - Intronic
901540195 1:9910399-9910421 CGGGGCCTGCGGGCGGGGCGGGG + Intergenic
901659856 1:10792325-10792347 CGGGGCCGGGGGGGGGGGGGCGG - Intronic
901766162 1:11501499-11501521 CGGGGATGACGCGGGGGGCTCGG - Exonic
902067468 1:13700214-13700236 CGGCGCGGCCGCGGGCGCCGGGG + Intronic
902067588 1:13700593-13700615 CGCGTCCCCCGCGGGGCGCGCGG - Intronic
902072298 1:13749920-13749942 CGGGCCCGCCGCGCAGGACGCGG + Intronic
902451503 1:16499353-16499375 CGGGGCCGAGGCGGGGGCGGGGG + Intergenic
902586219 1:17439876-17439898 CGGAGCCGAGGCGGGCGGCGAGG - Intergenic
902823545 1:18957270-18957292 CGGGTCCGCAGCGTGGGGCACGG - Intergenic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903142230 1:21345552-21345574 CGGGGCCGCCGCGGGGCCAATGG + Intergenic
903153301 1:21428266-21428288 CGGGGCCCGGGCGCGGGGCGCGG - Intergenic
903233873 1:21937351-21937373 CGGGGCCGGCGCTGCGGGGGCGG - Intergenic
903324843 1:22563755-22563777 AGGGGCGGCCGAGGGGCGCGGGG + Intronic
903349985 1:22711410-22711432 CCCGGCCGTGGCGGGGGGCGGGG + Intronic
903501121 1:23800646-23800668 CGGGGAGTCCGCGGGGAGCGAGG - Intronic
903555124 1:24187416-24187438 CAGCCCCGCCGCGGGGGGAGGGG + Intronic
903855686 1:26336580-26336602 CGTGCCGGCCGCGGGGGGCGGGG - Intronic
903883711 1:26529620-26529642 CGGGGCCGGCCCTCGGGGCGCGG + Intergenic
904034116 1:27549976-27549998 CGTGGCAGCCGCTGGGGTCGGGG - Exonic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904199769 1:28812209-28812231 CTGGGCCGGTGCGGGCGGCGAGG + Exonic
904500111 1:30908508-30908530 CGGGGCCGCGGCCGGGCCCGGGG - Exonic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904782966 1:32964467-32964489 CTGGGCCGCGGCAGGGGCCGGGG + Exonic
904924553 1:34037300-34037322 CAGTGCCGCCGGTGGGGGCGGGG - Intronic
905179166 1:36156049-36156071 CGGCGCGGGCGCGGGGGGCTGGG + Intronic
905449432 1:38047069-38047091 CGCGGCCGCCACGTGGGGAGTGG + Intergenic
905639109 1:39576479-39576501 CGGGGCAGGCGCGGGGCGCGGGG + Intronic
905647170 1:39632948-39632970 GACGGCCGCCGCGAGGGGCGAGG - Intronic
905789793 1:40783964-40783986 CGGGGCGGGCGCGGGCGGCGGGG - Intergenic
905800216 1:40838247-40838269 AGGGGACGCGGCCGGGGGCGGGG - Intronic
905912248 1:41662701-41662723 CGGGGCGGGCGCGGAGGGAGGGG - Intronic
906197094 1:43936173-43936195 GGGGGCCTTCGCGGGGGGCAGGG - Exonic
906204378 1:43979303-43979325 CCGAGCCGCCCCGGGGGGCAGGG - Intronic
906315517 1:44784402-44784424 CGGGGTCTGCGCGGCGGGCGCGG + Exonic
906365539 1:45206445-45206467 CGGTGGCGCCGAGGGGGGCGGGG + Exonic
906614568 1:47225568-47225590 CGAGGCGGGCGCGGGGGCCGGGG + Exonic
906650324 1:47508277-47508299 CGCGTGGGCCGCGGGGGGCGGGG + Intergenic
907080434 1:51617019-51617041 CGGGGCCGCAGGGGGCGGGGCGG - Intronic
907278085 1:53327942-53327964 CGGCGGCGGCGCGGGGAGCGCGG - Exonic
907364169 1:53945976-53945998 CGAGGCCGCCGCGAGGGGGCGGG - Intergenic
907429880 1:54405782-54405804 CGAGGCCGCGGCGGGCGGCGTGG - Intronic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908473810 1:64470108-64470130 CTGGGCCGCCGCGGCGGCTGCGG - Intergenic
908501205 1:64745193-64745215 CGGCGGCGGCGAGGGGGGCGCGG + Exonic
908581918 1:65525547-65525569 AGGGGCGGCTGCGGAGGGCGCGG + Intronic
909475244 1:76074683-76074705 CGGGGCCGCGGCTCGGGGGGCGG + Intergenic
910251466 1:85201803-85201825 CCGGGCCGCGACGGGGCGCGCGG + Intergenic
910759044 1:90717742-90717764 CGGGGCTGCCGAGTGGCGCGCGG - Intergenic
911527537 1:99004743-99004765 CGAGGCAGCCACCGGGGGCGCGG + Exonic
912353992 1:109041120-109041142 GGGGGCGGGGGCGGGGGGCGAGG - Intronic
912376475 1:109213808-109213830 CGGGGCCGCGGAGGGAGGGGAGG - Intergenic
912492618 1:110070464-110070486 CGGGTCAGCCGCGGGCCGCGGGG + Exonic
912492711 1:110070728-110070750 GGCGCGCGCCGCGGGGGGCGGGG + Intronic
912603533 1:110964001-110964023 CGGAGCAGGCGCAGGGGGCGTGG + Exonic
912800181 1:112715314-112715336 CGGGGCCGCGGCCGAGGGCGGGG - Exonic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
913449193 1:118981072-118981094 GGAGGCCGAGGCGGGGGGCGGGG - Intronic
914758464 1:150579772-150579794 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914758468 1:150579778-150579800 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914808376 1:151008407-151008429 CGCCTCCGCCGCTGGGGGCGGGG + Intronic
915167861 1:153958538-153958560 CGAGGCCGCGGCGGAGGCCGCGG - Exonic
915213340 1:154325584-154325606 CGGGGCCGCAGCTGGGGGGGCGG + Intronic
915355975 1:155255351-155255373 CGGGGCCGCCTGGTGGGGAGAGG + Exonic
915463183 1:156081723-156081745 CGGGGCGGCCGGGGGCGCCGCGG + Exonic
915463523 1:156082822-156082844 GGGGGCCGGGGCCGGGGGCGGGG + Intronic
915477357 1:156161033-156161055 CGCGGCCTGGGCGGGGGGCGGGG + Intronic
915495892 1:156282526-156282548 CGGGGCCTCCCGGGCGGGCGGGG - Intronic
916761338 1:167820335-167820357 CGGGGCCGGCCAGAGGGGCGGGG + Intronic
917418293 1:174834599-174834621 GGGGGGCGGCGGGGGGGGCGGGG - Intronic
918388837 1:184037361-184037383 CCGGGCCGAGGCGGGCGGCGGGG + Exonic
919463239 1:197902935-197902957 CGGGGCGGCCGCGGCGGGGCGGG - Intronic
919892001 1:201982575-201982597 CGGGGCCCGCGCGGCGGGGGCGG + Intronic
920021131 1:202957801-202957823 CGAGGCCGCCGCGCGTGGGGAGG - Intronic
920190419 1:204190410-204190432 CGGGGCGGGGGCGGGGGGCGGGG - Exonic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
921039576 1:211416766-211416788 CGGGGAGGCGGCGGGGGCCGCGG + Intergenic
921185350 1:212665450-212665472 CGGGGCAGCCTCGGGGAGGGTGG - Intergenic
921189824 1:212699608-212699630 CCGGCGCGCCGCGGGGGGCGAGG - Intronic
922287524 1:224183161-224183183 CGGGCGGGCCGGGGGGGGCGGGG + Exonic
922766241 1:228158091-228158113 CCGGGCGGCGGCGGAGGGCGCGG - Exonic
923299670 1:232629938-232629960 CCGGGCAGCGGCGGGCGGCGAGG - Intergenic
923506153 1:234608642-234608664 CGGGGCCGCCGAGCTGAGCGCGG - Exonic
923744359 1:236686637-236686659 CGGGGCTGCGGCGGGGCGCGAGG - Exonic
924052293 1:240091774-240091796 GGGGGCGGCGGCGGCGGGCGGGG + Intronic
924527265 1:244863696-244863718 CGGTGGCGCCGCCCGGGGCGAGG - Exonic
924527282 1:244863755-244863777 CGGGGCCGCCAAGGAGGCCGCGG - Exonic
924539793 1:244970473-244970495 CGGGGTCGCGGCGGGCGGCGAGG - Exonic
924551688 1:245084060-245084082 CCGGGGCGCCGGGGGGGGGGCGG - Intronic
1062813871 10:485102-485124 CAGGGCCACCGCGGGAGGCACGG + Intronic
1062874213 10:931972-931994 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
1063429694 10:5977694-5977716 CGGTGCCGCGGCGGCCGGCGGGG - Intronic
1063449995 10:6144899-6144921 CGGGGCGCCTGCGGGCGGCGGGG - Intergenic
1063458447 10:6201405-6201427 AGAGGGCGGCGCGGGGGGCGGGG + Intronic
1063504024 10:6580182-6580204 CGGCGGCGGCGCGGGGCGCGGGG + Intronic
1063994972 10:11611178-11611200 TGGGGGCGCCGCGCGGGGTGCGG - Intronic
1064167796 10:13001592-13001614 CGGGGCGGCGGCGGGGAGCCCGG + Exonic
1064179230 10:13100316-13100338 GGGGGCTGCAGCGGTGGGCGAGG + Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064384659 10:14879200-14879222 CGAGGCCGCCACGGGAGACGCGG - Intronic
1064418279 10:15168816-15168838 CGGGGCCGGCGGGCTGGGCGCGG - Intergenic
1064418286 10:15168834-15168856 CGGGGCCGGCGGGCAGGGCGGGG - Intergenic
1064418356 10:15169027-15169049 AGGGGCTGCGGCGGTGGGCGGGG - Intergenic
1065024200 10:21526064-21526086 CGGGGCTGGCGGCGGGGGCGGGG - Intergenic
1065025313 10:21534889-21534911 CGCGGCCGCGGCACGGGGCGGGG - Intronic
1065025334 10:21534924-21534946 AGGGTCCGCGGCGGGGCGCGGGG + Intronic
1065099858 10:22321759-22321781 CGGGGCGGCCGCGGGTGGAAGGG + Intronic
1065188661 10:23192182-23192204 CGGAGGCGCGGCGGTGGGCGGGG - Intergenic
1065590387 10:27256820-27256842 CGGGGCGGGAGCGGGGGGGGCGG - Intergenic
1066022573 10:31318833-31318855 CCGGGCAGCCGCGGCGGGTGTGG + Intronic
1066022870 10:31319912-31319934 CGGGGCGGCCGCGGGTTGCGTGG + Intronic
1066464243 10:35639536-35639558 CAAGGGCGCCGCGGTGGGCGGGG - Exonic
1067096529 10:43305043-43305065 GGGGGCGGGGGCGGGGGGCGGGG - Intergenic
1067445104 10:46337044-46337066 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067502319 10:46816336-46816358 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067592268 10:47523684-47523706 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1067830788 10:49610170-49610192 CGGGGCGGGGGCCGGGGGCGGGG - Intronic
1069186537 10:65429672-65429694 CGGGGCCGGCGGGGCTGGCGGGG + Intergenic
1069709276 10:70478683-70478705 CGGCCCCACCGCGAGGGGCGGGG - Intergenic
1069761760 10:70816131-70816153 AGGGGCCGCCGCGGGCTCCGGGG + Intronic
1069769518 10:70888467-70888489 CGGGGCAGCCGCGGGCGAGGTGG - Intronic
1070162312 10:73873929-73873951 AGCGGCACCCGCGGGGGGCGGGG + Intronic
1070198099 10:74177189-74177211 CTGGGCCGCCCCCGGGGGCGCGG - Intronic
1071309463 10:84328841-84328863 CGGGGTCGCGGCGGGCGCCGGGG + Intronic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1072189080 10:93066111-93066133 CGGGGCCGCTGGGGGCAGCGAGG + Exonic
1072336509 10:94402903-94402925 TGGGGCTGCCGAGGGCGGCGGGG - Exonic
1072562184 10:96586703-96586725 CGGGGCGGCCGCGCCGGCCGGGG + Intronic
1073061799 10:100737742-100737764 CGGGGCCGTCTAGGGGGGCAGGG - Intronic
1073094091 10:100969494-100969516 AGGGGCCGCGGCTGGAGGCGGGG - Intronic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1073249834 10:102114656-102114678 GGGGGCCGGCCTGGGGGGCGGGG + Intronic
1073297675 10:102450878-102450900 CGGCGCGGCCTCGGGTGGCGCGG + Exonic
1074130392 10:110568168-110568190 CGGGGCGGCCGCGGGCGGGAAGG + Intronic
1074377379 10:112951285-112951307 CCGGGCGGCTGCGGGGCGCGCGG - Intronic
1074591916 10:114821857-114821879 CCGGGACGCGGCGGGCGGCGAGG - Exonic
1074786953 10:116849776-116849798 CGTTGCCGCAGCGCGGGGCGGGG - Intronic
1075031967 10:119029825-119029847 CGCGGCCGCGGCGGGGCGAGCGG - Exonic
1075501732 10:122980717-122980739 CTGGGCCGCGGGGCGGGGCGGGG + Intronic
1075645451 10:124093279-124093301 CGGGAGCGCCGCGGGGAGTGAGG + Intronic
1075768771 10:124916640-124916662 CTGGACTGCCGCGGGGTGCGTGG - Intergenic
1075768856 10:124916967-124916989 CTGGGGAGCCCCGGGGGGCGGGG - Intergenic
1076172007 10:128327164-128327186 GGGGGCAGCAGCGGGTGGCGAGG + Intergenic
1076358201 10:129867992-129868014 CGCGGCCACCGCGGGAGGAGAGG + Intronic
1076554345 10:131311922-131311944 CCGGGCGGCCGCGGAGGACGTGG + Intergenic
1076680377 10:132168591-132168613 CGTGGCCGCCGCGGGCCGCGTGG + Exonic
1076722215 10:132397580-132397602 GCGGGCCGGGGCGGGGGGCGCGG + Intronic
1076850057 10:133088296-133088318 CGGGCCGGGCGCGCGGGGCGGGG - Intronic
1076857586 10:133124830-133124852 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076857590 10:133124836-133124858 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076864498 10:133160289-133160311 CGGGGCGGGCCCGGGGGGCGCGG - Intergenic
1076879068 10:133231124-133231146 CGGGGCCGCGGACGGGCGCGCGG - Exonic
1076893003 10:133293957-133293979 CGGGGCCGGCCTGGGAGGCGTGG + Intronic
1076981896 11:209046-209068 AGGGGACGCGGCGGGGTGCGGGG + Intronic
1077008506 11:369961-369983 CGCGGGGGGCGCGGGGGGCGCGG + Intronic
1077008513 11:369970-369992 CGCGGGGGGCGCGGGGGGCGGGG + Intronic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1077008526 11:369997-370019 CGCGGGGGGCGCGGGGGGCGCGG + Intronic
1077008534 11:370015-370037 CGCGGGCGGCGCGGGGGGCGCGG + Intronic
1077008542 11:370033-370055 CGCGGGCGGCGCGGGCGGCGGGG + Intronic
1077074666 11:694939-694961 CGCGGCCGCGGCAGGAGGCGAGG - Exonic
1077093530 11:789983-790005 CGGGGCGGGCGGGGCGGGCGCGG - Intronic
1077100259 11:819404-819426 CCGGGCGGCAGCGGAGGGCGGGG + Intronic
1077121500 11:910938-910960 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077121504 11:910944-910966 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077124428 11:926120-926142 CGGGGCCGCCGGCGGAGACGGGG + Intronic
1077250069 11:1557023-1557045 CGGGGCCGCCGGCGGGGCCGTGG + Exonic
1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG + Intergenic
1077307090 11:1873282-1873304 CGGGGTCGCCGCAGTGGGCAGGG - Intronic
1077322261 11:1947652-1947674 CGGTGCCCCCGCGTGGGGAGTGG + Intronic
1077409169 11:2395519-2395541 CGGTGCGGCCCCGGGGGGCGAGG + Exonic
1077419742 11:2444738-2444760 CGGGGGCGCAGGCGGGGGCGGGG + Intronic
1077495484 11:2884848-2884870 CGGGGCCGGGGCGGGGGCCGGGG + Exonic
1077495495 11:2884866-2884888 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495503 11:2884878-2884900 CGGGGCCGGGGCTGGGGCCGGGG + Exonic
1077495792 11:2885965-2885987 CGGGGGCGGGGCGGGGCGCGCGG + Intergenic
1077923099 11:6655874-6655896 CGGGGGCTCCGCGGGCGGAGGGG - Intergenic
1078023472 11:7673568-7673590 GGGGGCCGGAGCGGGAGGCGTGG - Intronic
1078057544 11:8019682-8019704 AGGGGGCGCCGGGAGGGGCGGGG + Intronic
1078180092 11:9004095-9004117 CGAGGGAGCCGCGCGGGGCGTGG - Intergenic
1078514103 11:12008508-12008530 CGGAGCGGGCGCGGGGGCCGTGG + Exonic
1078679550 11:13463042-13463064 CGGGGGCGGCGCGGGAGGCTGGG - Intronic
1079035142 11:17014269-17014291 CGGGGACGCGGGTGGGGGCGCGG - Intronic
1079035187 11:17014414-17014436 CGGAGCCGCCGCGGGGTGGGGGG + Intronic
1079361993 11:19777271-19777293 CGGGGCCGCTGCTGCGCGCGGGG - Intronic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1080503689 11:32892916-32892938 CCGGGCCGCGGCGGGCGGCGAGG - Intergenic
1080606640 11:33869634-33869656 CGCGGCCGAGGCGGGGGCCGGGG + Intronic
1080802139 11:35618783-35618805 CGGGGCCGCCGCTCCGGGCCGGG - Exonic
1081636782 11:44727061-44727083 CGGGGCCGGGGCTGGGGCCGGGG - Intronic
1081636790 11:44727073-44727095 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636794 11:44727079-44727101 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636798 11:44727085-44727107 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081700061 11:45147040-45147062 CGGCGCCGGCGCGGGGTGGGGGG + Intronic
1081938138 11:46918595-46918617 CGGGGCTGCGGCGCGGGGGGCGG - Exonic
1082843913 11:57712030-57712052 CGTGGCCGCGGTGGGAGGCGGGG + Exonic
1083609633 11:63998805-63998827 CGGGGCCGCCGCACGGGGCGAGG + Intronic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1083656985 11:64234571-64234593 CGGGGACGGCGGGGGCGGCGGGG - Exonic
1083659757 11:64246643-64246665 CAGCGGCACCGCGGGGGGCGCGG - Exonic
1083660956 11:64251560-64251582 CGGGGCCGGAGCGGGCCGCGCGG + Exonic
1083747704 11:64744836-64744858 CGGGGCCGCGGCGTGGAGAGCGG - Intronic
1083883141 11:65558105-65558127 CGGGGGCCCGGCGGGAGGCGCGG + Exonic
1083885705 11:65572576-65572598 CGGCGGGGCCGCGGGGTGCGGGG + Exonic
1083886516 11:65576003-65576025 CGGGGCTCCGGCGCGGGGCGGGG - Intergenic
1083904826 11:65662767-65662789 CGGGGCCGCCGCGGCTGTGGCGG - Intronic
1083922130 11:65786816-65786838 CGGGGCGGCCGGGCGGGGCGGGG - Intergenic
1083945119 11:65919205-65919227 GGGGCGGGCCGCGGGGGGCGGGG + Intergenic
1083997230 11:66278431-66278453 CCGGGCCGCCGCCCGGCGCGGGG + Exonic
1084154055 11:67303969-67303991 CGGGGCCTCCCGGTGGGGCGTGG + Intronic
1084171282 11:67401988-67402010 CGGGGCCTCGGCGGCGGGCTGGG + Intronic
1084284068 11:68120695-68120717 CGGGGCCGGGGCGGAGGCCGGGG - Intronic
1084310220 11:68312501-68312523 CGCGGCCGGTGCGGGGGGCGCGG + Intergenic
1084319535 11:68365722-68365744 CGGGGCGGGCGGGCGGGGCGGGG + Intronic
1084522929 11:69675429-69675451 CGCGGCTGCAGCGGTGGGCGGGG + Intergenic
1084620954 11:70270233-70270255 TAGGGGCGCCGCGGCGGGCGGGG + Intergenic
1084758126 11:71251925-71251947 CGGGGCCGCCAGGTGGCGCGCGG - Intronic
1084888105 11:72223782-72223804 CGGGACCGAGGCGCGGGGCGGGG + Intronic
1085197968 11:74683648-74683670 GGGGGCCGCGGTGGGGGCCGCGG - Intergenic
1085284658 11:75351794-75351816 CCGGGCCGCGGCCAGGGGCGTGG + Intergenic
1085346027 11:75768711-75768733 AGGCGCCGACGCGGCGGGCGGGG - Exonic
1087761746 11:102110379-102110401 CGGGGCCGCGGCGGCGCGGGCGG + Intergenic
1088495734 11:110430000-110430022 GAGGGCCGCGGCGAGGGGCGCGG - Exonic
1089208923 11:116787919-116787941 CGGGGCCGGGGCGGGCGACGGGG + Exonic
1089298550 11:117484033-117484055 CGGGGCAGGGGCGGGGGGCAGGG - Intronic
1089499824 11:118925511-118925533 CGGGGCCGGGGCGCGGGGCCGGG + Intronic
1089622329 11:119729025-119729047 CGGGGCCCAGGCGGCGGGCGCGG + Exonic
1089729532 11:120511710-120511732 CGAGCCCGGCGCGGGGAGCGCGG - Intergenic
1090198777 11:124839413-124839435 CGCGGCCGGGGCTGGGGGCGGGG + Intergenic
1090699065 11:129278895-129278917 CGCGGAGGCCGCGGGGAGCGCGG + Intronic
1091273050 11:134331743-134331765 CGGGGCCCCGGCCGGGGGCGGGG - Intergenic
1202805279 11_KI270721v1_random:2965-2987 CGGTGCCCCCGCGTGGGGAGTGG + Intergenic
1091390996 12:125918-125940 CAGGGCCTCCTAGGGGGGCGGGG + Intronic
1091550042 12:1530259-1530281 CGGGGCCGGCGCGGCTGTCGGGG + Intronic
1091550281 12:1530963-1530985 CGGGGCCGTCCCCGGGGGCGAGG - Intronic
1091563287 12:1630238-1630260 CGGGGAGGCCGCTGGGGGCGCGG + Intronic
1091718422 12:2795550-2795572 CGGGGCGGCGGAGAGGGGCGGGG + Intronic
1091740749 12:2959232-2959254 CCGGGCCGGGGCGGGCGGCGGGG - Intergenic
1091869176 12:3873171-3873193 CGGGGCGGGCCCAGGGGGCGGGG - Intronic
1092143584 12:6200230-6200252 CTGGGCGGGGGCGGGGGGCGGGG + Intronic
1092229070 12:6766816-6766838 CGGGGCCGTCGGGGGCGGCCTGG - Intronic
1092250255 12:6891145-6891167 CTGGGCGGCTGCGCGGGGCGGGG - Intronic
1092487442 12:8914666-8914688 CGGGGGCGCCGAGGGCGGGGTGG - Exonic
1094466106 12:30755003-30755025 CGGGGCGGCCGAGGGCGGAGCGG - Intergenic
1094682685 12:32679689-32679711 CGGAGCCGGCGCGGCGGGCCTGG + Intronic
1095261714 12:40105821-40105843 CGGGGCTGCCCGGGGGGACGCGG + Exonic
1095349197 12:41188903-41188925 CCGGGCGGCCGCTGGGGCCGCGG + Exonic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096465852 12:51847590-51847612 CCGGGCCGCCGCTGGGCGCAGGG + Intergenic
1096466166 12:51848604-51848626 CGGGGCGGCGGCGCGGGCCGGGG + Intergenic
1096529578 12:52234315-52234337 TGGGGCCGCTGGAGGGGGCGAGG + Intronic
1096668222 12:53181017-53181039 CGGGGACGCGGCGGGACGCGCGG - Intronic
1096796749 12:54082581-54082603 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796753 12:54082587-54082609 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096841039 12:54379254-54379276 CGGGGCCGAGGACGGGGGCGGGG + Intronic
1096946730 12:55414975-55414997 CGGGGGCGCCGAGGGCGGGGTGG + Intergenic
1097190391 12:57216784-57216806 CGGAGCCGGCGCTGGGGGCGGGG - Exonic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1098029007 12:66235292-66235314 GCGGGCCGCGGCGGCGGGCGCGG + Intronic
1098897810 12:76083965-76083987 GGGGGCGGCCGCGCGGGGAGGGG - Intronic
1099315533 12:81078247-81078269 CGGGGCGGTCTCGGGGGCCGGGG + Exonic
1100611399 12:96194351-96194373 CGGGGCCGGGGCGGCGGGGGAGG + Intergenic
1101150294 12:101877455-101877477 CGGAGCCGCCGGAGGGGACGCGG - Exonic
1101447413 12:104747184-104747206 CCGGGCAGCCGCTGGAGGCGTGG - Intronic
1101466912 12:104958333-104958355 CGGGGCTGCCGCGCGGGGGCGGG - Intronic
1102068608 12:109999460-109999482 CGGGAACGCCGCGGGGCGCGGGG + Intronic
1102197192 12:111034068-111034090 CGGGGCCGCCGCCGGCCGCCCGG - Exonic
1103568716 12:121830313-121830335 GGGGGCGGGCGCGGGGGGCCGGG - Exonic
1103698414 12:122835223-122835245 CGGGGTCGCCGCGGGATGGGGGG + Intronic
1103764598 12:123271463-123271485 CGGGGCGCCCGCGGAGGCCGGGG - Intronic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1104289651 12:127455844-127455866 TGGGGCGGCTGCGGGGCGCGGGG + Intergenic
1104376193 12:128267110-128267132 CGGGGGCGGGGCCGGGGGCGGGG + Intergenic
1104585168 12:130042533-130042555 CGGGGCTCGCGCGGGGGGCGTGG - Intergenic
1104697282 12:130872524-130872546 CGGGGCCGCCATGGGCTGCGGGG + Intronic
1104957735 12:132474647-132474669 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104957872 12:132474968-132474990 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104958044 12:132475362-132475384 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104958055 12:132475386-132475408 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104980215 12:132570243-132570265 TGGGGTCCCCGCGGGGGACGGGG + Intronic
1104983226 12:132583079-132583101 CGGGGCCCCCGCGGAGCGCGAGG + Exonic
1105413839 13:20192804-20192826 CGGGGCCGGGGCGGGGGTCTCGG + Intronic
1105512131 13:21060615-21060637 CGGCGCGGCCGCGGGGAACGGGG + Intronic
1106109105 13:26761018-26761040 CGGGGCCGCCGGCTGGGGTGGGG - Intergenic
1106516978 13:30464820-30464842 CGCGGCGGCGGCGGCGGGCGGGG + Intronic
1106517119 13:30465265-30465287 GCGGGGCGCCGCGGCGGGCGAGG - Intronic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1106776718 13:33016459-33016481 GGCGGCGGCCGCGGGCGGCGCGG - Exonic
1107438404 13:40402591-40402613 AGGGGCAGCTGCGGAGGGCGTGG - Intergenic
1110450686 13:75635782-75635804 CCCGGCCGCCGCAGGGGGCGGGG + Intronic
1110450858 13:75636281-75636303 CGGGGCCACCGCGGGGAGGACGG + Intronic
1110705979 13:78602272-78602294 CATGGCCGGCGCGGGCGGCGCGG - Exonic
1111199966 13:84922614-84922636 CGGGGGGGCCGGGGGGGCCGGGG - Intergenic
1112505215 13:99971040-99971062 CATGGCCGCCGCGGGGGCCGTGG + Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1112580713 13:100674626-100674648 CCGGGCCGCCGTGCGGGGCTCGG + Intronic
1113120244 13:106917584-106917606 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120248 13:106917590-106917612 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120252 13:106917596-106917618 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120256 13:106917602-106917624 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120260 13:106917608-106917630 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120264 13:106917614-106917636 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120268 13:106917620-106917642 CGGGGCCGGGGCCGGGGTCGGGG + Intergenic
1113346700 13:109485316-109485338 CGGGGCAGGGGCGGCGGGCGGGG - Intergenic
1113493941 13:110713613-110713635 CGGGGCCGTTGCCGGGGGAGGGG + Intronic
1113517417 13:110914518-110914540 CGGGGCAGCCGGGGGGCGCGGGG - Intronic
1113633682 13:111905417-111905439 CGGGGACGCAGAAGGGGGCGGGG - Intergenic
1113633689 13:111905435-111905457 CGGGGACGCGGAAGGGGGCGGGG - Intergenic
1113633697 13:111905453-111905475 CGGGGACGCGGAAGGGGGCGGGG - Intergenic
1113633705 13:111905471-111905493 CGGGGACGCGGAAGGGGGCGGGG - Intergenic
1113633713 13:111905489-111905511 CGGGGACGCAGAAGGGGGCGGGG - Intergenic
1113633720 13:111905507-111905529 CGGGGACGCGGAAGGGGGCGGGG - Intergenic
1113654101 13:112057409-112057431 TGGGGGAGCCGCGAGGGGCGGGG - Intergenic
1113737757 13:112690310-112690332 CGTGACCGGAGCGGGGGGCGCGG + Exonic
1113962324 13:114132774-114132796 CGGGGCGGGGGCGGGGGCCGAGG - Intergenic
1114554858 14:23556107-23556129 CCTGGCCACCGCGGGGGTCGCGG + Exonic
1115120137 14:29928074-29928096 CGGAGCCGCCTCGGCAGGCGCGG + Intronic
1115235833 14:31207803-31207825 CGGGGTCGCCGCCGGGGGAGTGG - Intronic
1115320758 14:32077159-32077181 ACGGGCCGCCGCTGGTGGCGGGG + Intronic
1115320878 14:32077561-32077583 CGCGGCCGCCGAGGGGAGCCTGG + Intronic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1115851789 14:37595150-37595172 CGGCGGCGGCGCGGCGGGCGGGG + Intronic
1117315250 14:54566468-54566490 CGTGGCCGCCGCCGGCGGGGAGG - Intergenic
1117803216 14:59465313-59465335 AGCGGCCGCCGCGGGGAGCTGGG + Exonic
1118270533 14:64338686-64338708 CGGGGCGGCCTCGCGGGGGGTGG - Intergenic
1118285267 14:64465384-64465406 CGGGGCGACCGCCGGAGGCGCGG - Intronic
1118350939 14:64972161-64972183 CGGGGACGCTGCGGGCGGCGAGG + Intronic
1119519991 14:75278409-75278431 GGGGGCCGCGGCTGGGGGAGGGG - Intergenic
1119821003 14:77616376-77616398 AGGGGCGGCCGGGCGGGGCGAGG - Intronic
1120765362 14:88323332-88323354 GGGGGGCGTCGCCGGGGGCGAGG - Intronic
1121074924 14:91060225-91060247 CGGGGCCGCAGCCGTGGGCGCGG - Intronic
1121103000 14:91262983-91263005 CGGGGCAGCGGGGAGGGGCGGGG + Intergenic
1121422519 14:93825231-93825253 GGGGGCGCCCGCGGGGGGCGAGG + Intergenic
1121453850 14:94026463-94026485 CGGGAATGCCGCGGGAGGCGCGG - Exonic
1121667861 14:95686331-95686353 CGGGGCCGGCAGTGGGGGCGGGG - Intergenic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1122108692 14:99480569-99480591 CGGGGCCACAGCGGCCGGCGGGG + Intronic
1122130875 14:99604106-99604128 CCGGGCGGCCCCGGCGGGCGCGG - Intergenic
1122137956 14:99645474-99645496 CGCGGCCACCGGGCGGGGCGGGG + Intronic
1122143341 14:99675172-99675194 CGGGGTTGGCGCGGGGGGAGCGG - Exonic
1122162359 14:99793547-99793569 AGGGGCGGCCGCGCGGGGCCGGG + Intronic
1122183416 14:99971746-99971768 GGGGGCCGCCGCCGGGGGATGGG - Intronic
1122264100 14:100538674-100538696 CGGGGCCGCCACCGCGGCCGTGG + Exonic
1122371250 14:101230067-101230089 CGAGGCTGCGGGGGGGGGCGAGG - Intergenic
1122371259 14:101230085-101230107 CGAGGCTGCGGGGGGGGGCGAGG - Intergenic
1122418312 14:101560750-101560772 TCGGGCAGCGGCGGGGGGCGCGG + Intergenic
1122444590 14:101760455-101760477 CGGGGCCGACGCCGGAGGAGAGG + Intergenic
1122543304 14:102509500-102509522 CGGGCGCGGCGCGGGGGACGGGG + Intronic
1122582020 14:102777233-102777255 CGGCGCCGCGGCGCGGGGCGGGG - Intergenic
1122889026 14:104724174-104724196 CCGGGCCGGGGCAGGGGGCGGGG - Intronic
1122904400 14:104795313-104795335 CGGGGAGGGCGCGGGGCGCGCGG - Intronic
1122904456 14:104795455-104795477 CCGGGCGGCCACGGCGGGCGGGG + Intronic
1122905749 14:104800758-104800780 CAGCGCGGCCGCGGGGAGCGGGG - Intronic
1122910759 14:104826670-104826692 CGGGGCTGCCGGAGGGGGCGGGG + Intergenic
1122910768 14:104826688-104826710 CGGGGCTGCCGGAGGGGGCGGGG + Intergenic
1122940397 14:104978534-104978556 CGGGGGCGCGGGGTGGGGCGGGG - Intergenic
1122975408 14:105168829-105168851 CGGGGCCGCGCCGCGGGGTGGGG + Intergenic
1122978558 14:105181083-105181105 CCGGGCCGCCGGCGGGGGCGCGG + Intronic
1122978636 14:105181338-105181360 CGGGGCGGCCGAGGTGGGCGGGG + Intergenic
1122978644 14:105181356-105181378 CGGGGCGGCCGAGGTGGGCGGGG + Intergenic
1123001998 14:105300798-105300820 CGCGGCCGTTGCGGGCGGCGCGG - Exonic
1123024855 14:105419803-105419825 AGGAGCGGCCGCGGGCGGCGGGG - Exonic
1123025060 14:105420315-105420337 GGGGGCGGCCGCGGGGGTGGCGG + Intronic
1202899784 14_GL000194v1_random:28384-28406 CGGCGCAGGCGCGGGGGGCGGGG - Intergenic
1123710072 15:22980447-22980469 CGGGGCCGCGGCCGGGAGGGAGG - Intronic
1123898057 15:24848219-24848241 CGGGGGCGGCGGTGGGGGCGGGG + Intronic
1123898067 15:24848237-24848259 CGGGGGCGGCGGCGGGGGCGGGG + Intronic
1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG + Intronic
1124500443 15:30223296-30223318 CGGGGCCCGCGCCGGGGCCGGGG + Intergenic
1124500957 15:30225780-30225802 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1124742613 15:32312887-32312909 CGAGGCCGCCGCCGGGGGCAGGG + Intergenic
1124957227 15:34367322-34367344 TGCGGGCGCCGCGGCGGGCGCGG - Intergenic
1125674356 15:41494433-41494455 CGGGGCCAGCGCCGGGCGCGGGG + Intronic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1125709614 15:41774418-41774440 CGGAGCCGACGCGAGGGGCGCGG - Intronic
1125874670 15:43133664-43133686 CGGGGCCGGCGCCGGATGCGGGG - Exonic
1125903641 15:43370976-43370998 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1125903645 15:43370982-43371004 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1125937519 15:43649320-43649342 CTGGGCCGGGGCCGGGGGCGAGG + Intronic
1126109505 15:45167301-45167323 CGGGGACGGCGCCGGAGGCGCGG + Exonic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1126113291 15:45187767-45187789 CTGGGCTTCCGCGGGGGGGGCGG - Intronic
1126172385 15:45705143-45705165 GGGTGCCGTAGCGGGGGGCGGGG - Intergenic
1127537608 15:59904531-59904553 TGGGGGCGGGGCGGGGGGCGGGG + Intergenic
1127982712 15:64046355-64046377 CGCGGCGGGCGCGGCGGGCGCGG + Intronic
1127982715 15:64046364-64046386 CGCGGCGGGCGCGGCGGGCGCGG + Intronic
1128056391 15:64702928-64702950 TGGCCCCGCTGCGGGGGGCGGGG + Intronic
1128115426 15:65102163-65102185 CGGGGGCGACGCGGGGGCGGCGG + Exonic
1128139221 15:65286886-65286908 CGGCGGCGCGGCGGGAGGCGGGG - Intronic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128161039 15:65422962-65422984 CGGCGCCGCGGGCGGGGGCGCGG + Exonic
1128161061 15:65423007-65423029 TGGGGCCGGCGCGGGGGCCAGGG + Exonic
1128318113 15:66673787-66673809 CGGGGCTGGCGCAGGGGGCGTGG - Intronic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1128344132 15:66842828-66842850 CGGCGCCGGCGCGGGCGGGGAGG + Intergenic
1129273889 15:74433285-74433307 CTGGGCCGGCAAGGGGGGCGCGG - Intronic
1129387283 15:75202842-75202864 CGGCGCCGCCGGGAGGGGCTTGG + Intronic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1129893787 15:79089491-79089513 CGGCGGCGGCGCAGGGGGCGGGG + Intronic
1130076578 15:80695241-80695263 CGGGGCCGGCCCGGCGGGCGCGG - Intronic
1130517147 15:84634094-84634116 CGGCGCTGCAGCGGGCGGCGCGG - Intergenic
1131076254 15:89496629-89496651 CGGGGCGGCCACGTGGGGCACGG + Intergenic
1131144345 15:90001680-90001702 CGGCGGGGGCGCGGGGGGCGCGG + Intronic
1131367620 15:91853580-91853602 GCGGGCGGCCGCGGGAGGCGAGG + Intergenic
1131431946 15:92394627-92394649 TGGGGCCGGAGCGGAGGGCGGGG + Intronic
1132055648 15:98648870-98648892 GGGGGCCGGCGCGGGGCGGGCGG + Intergenic
1132163629 15:99565321-99565343 CGGGGCGGGGGCGGGGCGCGAGG - Intergenic
1132398231 15:101489571-101489593 CGCGGGGGGCGCGGGGGGCGCGG - Exonic
1132398237 15:101489580-101489602 CGCCGCGGGCGCGGGGGGCGCGG - Exonic
1132464744 16:72367-72389 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132480597 16:164748-164770 CGGGGTCGCGGGGCGGGGCGGGG + Intronic
1132480618 16:164789-164811 CGGGGTCGCGGGGCGGGGCGGGG + Intronic
1132480691 16:164925-164947 CGGGGTCGCGGGGCGGGGCGCGG + Intronic
1132498594 16:275108-275130 CGGGGCCGCGGAAGCGGGCGAGG + Intronic
1132499896 16:280616-280638 CGGGGCGGCGGCGGGGCGGGCGG + Exonic
1132527821 16:426186-426208 CGGGGCCGCTGCAGATGGCGGGG + Exonic
1132600013 16:769165-769187 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600041 16:769213-769235 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132656694 16:1044478-1044500 CGGGGCCGCCTGGGGGGCCGAGG + Intergenic
1132674692 16:1116891-1116913 CGGGGGAGCAGAGGGGGGCGGGG - Intergenic
1132734721 16:1379697-1379719 CGGGGCCAGCGCGGAGGGGGCGG - Intronic
1132736592 16:1389050-1389072 CGGGGCCGGGGCCGGGGGAGGGG - Intronic
1132741338 16:1414768-1414790 GGGCGGGGCCGCGGGGGGCGTGG - Intergenic
1132779355 16:1614313-1614335 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1132844110 16:1992217-1992239 CGGGGCCGGGGCGGTGAGCGCGG + Intronic
1132870693 16:2114517-2114539 GGCGGCCGTCGCGGGGGGCAGGG + Exonic
1132889491 16:2196775-2196797 CGGGGCGGGCGCGGGGAGGGCGG - Intergenic
1132934519 16:2473958-2473980 TGGAGCCGCGGCTGGGGGCGCGG + Exonic
1132968543 16:2673426-2673448 CGGGGGCATCGCGGGGGGCGGGG - Intergenic
1132968552 16:2673444-2673466 GCGGGGCGTCGCGGGGGGCGGGG - Intergenic
1132994740 16:2817194-2817216 CGGGGCGCCCCCTGGGGGCGGGG - Intronic
1133020565 16:2965042-2965064 CGGGGCCTGCGCTGGGGGCGAGG + Intronic
1133036606 16:3036987-3037009 CGGGGCCGCGGGAGGGGCCGGGG + Intergenic
1133220176 16:4316288-4316310 CCGGGCCGGGGCGGGGGGGGGGG + Intronic
1133232099 16:4371784-4371806 CGGGCCCGCCGCGGCAGGGGCGG - Intronic
1133259336 16:4538296-4538318 CGGGGCCGGCGGTTGGGGCGCGG - Intronic
1133272374 16:4616458-4616480 CGGGGGCGGAGCCGGGGGCGGGG + Intergenic
1134521838 16:14922387-14922409 GGCGGCCGTCGCGGGGGGCAGGG - Intronic
1134709508 16:16321038-16321060 GGCGGCCGTCGCGGGGGGCAGGG - Intergenic
1134716721 16:16361067-16361089 GGCGGCCGTCGCGGGGGGCAGGG - Intergenic
1134950095 16:18347607-18347629 GGCGGCCGTCGCGGGGGGCAGGG + Intergenic
1134958029 16:18391092-18391114 GGCGGCCGTCGCGGGGGGCAGGG + Intergenic
1135335859 16:21600074-21600096 CGGGGCCGCGGCCGGGTGCCCGG - Intronic
1136111072 16:28063810-28063832 GGGGGCCGCCACGCCGGGCGCGG + Intergenic
1136153678 16:28368186-28368208 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1136209411 16:28747084-28747106 CGAGGCCGCCGCCAGGGGCAGGG + Intergenic
1136237828 16:28925338-28925360 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
1136365187 16:29806433-29806455 CGGGGCCGGGGCCGGGGGCGGGG - Intronic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136419553 16:30123232-30123254 CGGGGCCGCCGTGGGGAGGAGGG - Exonic
1136458425 16:30395420-30395442 GGGGGCGGCCACCGGGGGCGGGG - Exonic
1136550399 16:30979709-30979731 CAGGGCTGGCGCAGGGGGCGTGG - Exonic
1136586715 16:31191022-31191044 CGGGGCCGCGGCGGGGACCGTGG + Exonic
1136778878 16:32885205-32885227 GGAGGGGGCCGCGGGGGGCGGGG + Intergenic
1136891740 16:33976313-33976335 GGAGGGGGCCGCGGGGGGCGGGG - Intergenic
1137412934 16:48244639-48244661 CGCGGCGGCGGCGGGCGGCGCGG + Intronic
1137454774 16:48609961-48609983 CCGGGCCGCCATGGCGGGCGCGG + Exonic
1137559249 16:49492476-49492498 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1137614565 16:49838915-49838937 CGGGGCCGCCCCCGCGGGCCGGG + Intronic
1137655238 16:50153465-50153487 GGGGCCCGCCGCGGGCGGCGCGG - Intronic
1137655323 16:50153839-50153861 CGGGGCCGGGGCCGGGGCCGAGG - Exonic
1137655375 16:50154010-50154032 CGAGGACGCCGAGGGAGGCGAGG - Exonic
1137926601 16:52546986-52547008 CGGGCCGGGCGCCGGGGGCGCGG + Exonic
1138247880 16:55480435-55480457 AGGGCCCGGCGCGTGGGGCGGGG + Intronic
1138252149 16:55509441-55509463 GAGGGCGGCCGAGGGGGGCGTGG + Intronic
1138273841 16:55716610-55716632 CGGGGCGGGGGCGGGGGGAGGGG + Intergenic
1138327881 16:56191091-56191113 CGCCGCCGGCGCGTGGGGCGGGG + Intergenic
1138360805 16:56425614-56425636 CGGCGCGACCGCTGGGGGCGGGG - Intergenic
1138389116 16:56657639-56657661 CGGGGCGGGGCCGGGGGGCGGGG + Intronic
1138507710 16:57486423-57486445 CGGGGACGGCGAGGGAGGCGCGG + Exonic
1138595127 16:58025732-58025754 CGCGGCGGCCGCGGCGCGCGGGG + Exonic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1139496939 16:67326774-67326796 CGGCGCGCGCGCGGGGGGCGGGG + Intergenic
1139534418 16:67562695-67562717 AGCGGGCGCCGCGGGGGGTGTGG + Exonic
1139574741 16:67833765-67833787 CGGGGTCGCCGCGGGGTGCGCGG + Exonic
1139598123 16:67969635-67969657 CGGGCCCGCTGCGGGGGCCCTGG - Intergenic
1139954318 16:70685994-70686016 GGCGGGCGGCGCGGGGGGCGCGG + Exonic
1140078630 16:71723948-71723970 CCGGCGGGCCGCGGGGGGCGGGG - Intronic
1140927569 16:79599173-79599195 CGGGGGCGCGGCGGGGGCGGGGG - Exonic
1140927811 16:79600087-79600109 GAGGGCGGGCGCGGGGGGCGCGG - Exonic
1141116692 16:81315334-81315356 CGGGGCGGCCGGGCCGGGCGTGG + Intronic
1141430575 16:83968622-83968644 CCGGGCGGCGGCGGCGGGCGCGG + Exonic
1141665295 16:85462686-85462708 CGGGGGCGCCGCGGCGCGGGAGG + Intergenic
1141839633 16:86566660-86566682 CGGAGTCGCCGCGGAGGCCGGGG + Intergenic
1141840130 16:86568577-86568599 CGGGGCCGCCGCGGCGCAGGCGG + Exonic
1141910992 16:87058169-87058191 GGGGGCCGGCGAGGGGGGCGTGG - Intergenic
1141972359 16:87492479-87492501 CGGGGCGGCCGGGGCGGCCGGGG + Intergenic
1141989567 16:87602426-87602448 GGGGGCGGGGGCGGGGGGCGGGG + Intronic
1142136332 16:88453512-88453534 CGGGGCGGCCGCGGAGACCGGGG + Exonic
1142211806 16:88811952-88811974 CGGGACCGCCACGAGGGGTGGGG + Intergenic
1142271923 16:89094194-89094216 CGGGGCCCCCGCGCGGGGTGCGG + Intronic
1142395281 16:89828393-89828415 CGCGGAGGGCGCGGGGGGCGGGG - Intronic
1142395379 16:89828686-89828708 CAGGGCTGCCGCGGGCTGCGGGG + Exonic
1203081292 16_KI270728v1_random:1147294-1147316 GGAGGGGGCCGCGGGGGGCGGGG + Intergenic
1142468338 17:148309-148331 CTGGGCCTCCGCCGGGGGCCAGG + Intronic
1142509656 17:385829-385851 CGGGGACGCGGCGGGGGGTGGGG - Intronic
1142596276 17:1031537-1031559 CGGGGGCGCTGCGGGGCTCGGGG - Intronic
1142808696 17:2385324-2385346 CTGGGCCGGCGAGGGGGCCGGGG - Exonic
1142810249 17:2392801-2392823 CCGGGCAGCCGGGAGGGGCGGGG - Intronic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1142848242 17:2692295-2692317 CGGGGCAGCCGGCGGGGGCGGGG - Intronic
1142876223 17:2853469-2853491 CGGGGCCGCCGGCGGGAGTGCGG + Intronic
1142980559 17:3668751-3668773 CGGCGCAGGCGCGGAGGGCGGGG + Intronic
1143078874 17:4366725-4366747 GGGTTCCGCCGCCGGGGGCGGGG - Intergenic
1143539696 17:7561775-7561797 CGGGGCCGCCACGCGCGGCCGGG + Intergenic
1143565290 17:7717211-7717233 CGGGGGGGCGGCGCGGGGCGGGG - Intergenic
1143635564 17:8162333-8162355 CGGGGCAGCAGGGGGGGCCGTGG + Exonic
1144021005 17:11240484-11240506 CGGGAGCGCCGCGAGGGGAGGGG - Intergenic
1144500927 17:15786410-15786432 CGTGACCCCCGCTGGGGGCGGGG + Intergenic
1144527243 17:16000176-16000198 CGGGGCCGCTGCCGAGGACGGGG + Exonic
1144565112 17:16353353-16353375 CGCGGAGGCCGCGGGGGCCGCGG + Exonic
1144586846 17:16492250-16492272 CGGCGCGGAGGCGGGGGGCGGGG - Intergenic
1144682599 17:17205623-17205645 CGGTGCCTCCGCGGTGGGGGCGG - Intronic
1144758643 17:17694817-17694839 CGGGGCCGCGGGGCGGGGCGGGG + Intronic
1144930928 17:18858235-18858257 CGGGGCCGGGGCTGGGGTCGGGG + Exonic
1145765517 17:27456269-27456291 CGCGGCCGCCGGGAGGGGAGGGG + Intergenic
1145912897 17:28552640-28552662 TGGGGCCCCGGCCGGGGGCGGGG - Exonic
1146053302 17:29568650-29568672 CGCGGGCGGCGCGGGCGGCGCGG + Exonic
1146057686 17:29589406-29589428 CTGGGCCAGCGTGGGGGGCGCGG + Exonic
1146398475 17:32486665-32486687 AGGGGCGGCCCCGAGGGGCGGGG + Exonic
1146581248 17:34040239-34040261 CGGGTGCGGCGCGGAGGGCGGGG + Intronic
1147044415 17:37742776-37742798 CGGGGGCTCCGCGGGCGGCTCGG + Intronic
1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG + Intronic
1147139720 17:38454151-38454173 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1147250848 17:39151692-39151714 AGGGGGCGGGGCGGGGGGCGCGG + Intronic
1147382215 17:40062768-40062790 CCGGGGCGCGGCAGGGGGCGGGG + Intronic
1147612802 17:41811666-41811688 CGGGGCCGCTGCAGTTGGCGTGG + Exonic
1147653024 17:42072717-42072739 CTGGGCCGGCGGGGGCGGCGCGG - Intergenic
1147722724 17:42548636-42548658 TGGGGCCGAGGCCGGGGGCGGGG + Intergenic
1147723923 17:42554833-42554855 TGGGGCCGAGGCTGGGGGCGGGG + Exonic
1147897446 17:43759872-43759894 CAGGGCCGGGGCGGGGGGCGGGG + Intergenic
1148183111 17:45620684-45620706 CGGGGCCGCGGCCGGGGGCGCGG + Intergenic
1148225890 17:45897408-45897430 TGGGGCCGCTGCGGTGGGCAAGG + Intronic
1148265740 17:46225007-46225029 CGGGGCCGCGGCCGGGGGCGCGG - Intronic
1148323703 17:46771701-46771723 CGGCGCCGGGGCCGGGGGCGCGG - Intronic
1148370971 17:47099940-47099962 CGGGGCCGCGGCCGGGGGCGCGG - Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148852287 17:50561066-50561088 GGGGGCAGCGGCGGAGGGCGGGG - Intronic
1149430831 17:56594496-56594518 CGGGGGTGCAGCTGGGGGCGCGG + Exonic
1149614799 17:57988415-57988437 CAGGGCCCCCGCGGGGGGGCTGG + Intergenic
1149996723 17:61409648-61409670 CGGCGCCGGCGCGGGACGCGGGG + Intergenic
1150069321 17:62138443-62138465 CTGGGGCGCCTCGGAGGGCGGGG + Intergenic
1150108510 17:62478898-62478920 CGGGTGCGGCGCGGAGGGCGGGG - Intronic
1150108557 17:62479014-62479036 CCGGGCGGCCGCGGGGGGCGCGG - Exonic
1150562022 17:66302691-66302713 AGGGGGCGCGGCGGGGGCCGGGG - Intronic
1150791884 17:68205742-68205764 CGGGGCCGGGGCAGGGGCCGGGG - Intergenic
1151472336 17:74326131-74326153 AGGGGCGGGCGCCGGGGGCGGGG + Intergenic
1151797095 17:76353631-76353653 CGGGGCGGGCGCGCGGGACGCGG + Exonic
1152087987 17:78231957-78231979 CGGGGGCGGCGGGGGGCGCGCGG - Exonic
1152349697 17:79777931-79777953 CGGGGCCCCGGGCGGGGGCGGGG - Intergenic
1152356514 17:79810171-79810193 CGGGGCCGCGGCCGGGCGAGCGG + Intergenic
1152357250 17:79813287-79813309 GGGGGCGGCCGCGGGGCGAGCGG - Intergenic
1152396549 17:80036577-80036599 GGGGGCCGCCGGGGGCGGCGCGG - Intergenic
1152426277 17:80220375-80220397 CGGGGTCGGGGCAGGGGGCGGGG - Exonic
1152544067 17:80992027-80992049 CGGGGCCGGGGCGGGCGGCGGGG + Intronic
1152581147 17:81166117-81166139 TGCGGCTGCGGCGGGGGGCGCGG - Intergenic
1152617833 17:81346031-81346053 GGCGGCGGCCGCGGGGCGCGGGG - Intergenic
1152635138 17:81427727-81427749 CGTGCCAGCCGCGGGGGGCGGGG - Intronic
1152697570 17:81804502-81804524 GGGGGGCGCGGCTGGGGGCGGGG + Intronic
1152711206 17:81871216-81871238 CGGCGGCGCCGGCGGGGGCGGGG - Intronic
1152718501 17:81911237-81911259 CGGGGCCGGGGCGGGCCGCGGGG - Intronic
1152728762 17:81960045-81960067 ACGGGACGCCGCGGGGAGCGCGG + Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152798786 17:82321665-82321687 CGCGGCAGCCCCGGGGGCCGAGG - Exonic
1152808790 17:82371617-82371639 CGGGGCCGCAGCGGGGTCGGCGG - Intergenic
1152817697 17:82418263-82418285 GTGGTCTGCCGCGGGGGGCGGGG - Intronic
1152861348 17:82698396-82698418 CGGGGCCGGGGAGGGGCGCGGGG - Intronic
1152924374 17:83080497-83080519 CGGGGCAGGGGCGGGGGGCCCGG - Intronic
1153226933 18:2906795-2906817 CGGGGCCTCTGCGGGCGGCGGGG - Exonic
1153855123 18:9137286-9137308 CGGGGGCGCTGCGCGGGGCGGGG + Intronic
1153900666 18:9614637-9614659 CGGGCCTGCCGCGGGCGGCGCGG + Intronic
1154196543 18:12271437-12271459 CAGGGCCGCCGTGGGGGCTGCGG - Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155152795 18:23135878-23135900 CTGGGCCGGCGCGGCGGCCGCGG - Exonic
1155199350 18:23503588-23503610 CGGGGCCCCCGCCGCGGGCGCGG + Exonic
1155519886 18:26657048-26657070 AGGGGCCGCGGCCGGGGGCCGGG - Intronic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1156275818 18:35581801-35581823 CGGGCCGGCCGCGGCGGTCGCGG - Intronic
1156698826 18:39799349-39799371 GGGGGCGGCGGCGGGGGGCGGGG + Intergenic
1157529528 18:48409489-48409511 CGGCGCGGGCGCGGGGCGCGGGG - Intronic
1157867218 18:51197276-51197298 CGGGGCCGCCGCCAGGGCCAGGG + Exonic
1158137612 18:54224276-54224298 CGGGGCCGGGGCCGGGGCCGCGG - Exonic
1158137624 18:54224300-54224322 CGGGGCCGTGGCCGGGGACGGGG - Exonic
1158435946 18:57435678-57435700 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1158579733 18:58671294-58671316 CGGGACCGCGGGGGAGGGCGAGG + Intergenic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1158976530 18:62715841-62715863 CGGGGCCGCCGGGGTCAGCGCGG - Exonic
1159040330 18:63318535-63318557 GGGGGCGGCCCCCGGGGGCGCGG + Exonic
1159770503 18:72542197-72542219 CGGCGCCGGCGCGAGCGGCGCGG + Exonic
1159798488 18:72869164-72869186 CGGGGTCGCCGGGGGGCGGGGGG + Intergenic
1160163213 18:76491274-76491296 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160439777 18:78880416-78880438 GAGGGCCGGGGCGGGGGGCGGGG + Intergenic
1160453344 18:78979749-78979771 CGGCGGCGGCGGGGGGGGCGCGG + Intergenic
1160453451 18:78980173-78980195 CGGGCGCGCGGCGCGGGGCGCGG - Intergenic
1160500742 18:79400244-79400266 CGGAAACGCCCCGGGGGGCGGGG + Intronic
1160500781 18:79400357-79400379 CGGGGCCGGGGCGGGAGCCGGGG - Intronic
1160512069 18:79458295-79458317 CGAGGACGCCGCGGGGAGCAGGG + Intronic
1160518196 18:79489891-79489913 CGGTGCCGCTTCGGGGGTCGGGG + Intronic
1160567811 18:79798068-79798090 CGGGGCCGCAGTGGGCGGTGGGG + Intergenic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160631172 18:80247247-80247269 CAGGGCCGCCGGGGCGGGCGGGG + Intronic
1160675863 19:390942-390964 GGGGGCCGGGGCGGGGGCCGGGG - Intergenic
1160680309 19:409076-409098 CGGGGCTGGCGCGGGGGACGCGG + Exonic
1160706279 19:531693-531715 CGCAGGCGCAGCGGGGGGCGGGG + Exonic
1160710440 19:548842-548864 GGGGGCGGCAGCGGGGGGAGGGG - Intronic
1160719296 19:590340-590362 CGGGGCCCGCGCCGGGGCCGGGG + Exonic
1160724850 19:613560-613582 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160725624 19:616690-616712 CGAGGCCGCCGCCGGGGGCAGGG - Exonic
1160726931 19:621478-621500 CTGGGGCGCCTCGGAGGGCGGGG + Exonic
1160736189 19:663361-663383 CGGGGCTTCCGGCGGGGGCGGGG + Intergenic
1160768921 19:821780-821802 CGGGATCGCCGAGGAGGGCGGGG + Intronic
1160775465 19:853213-853235 AGGGGCGGCCCCGGGGGTCGGGG - Intronic
1160775520 19:853402-853424 AGGTGCCGCCGGGCGGGGCGGGG + Exonic
1160781298 19:878918-878940 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781302 19:878924-878946 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160790456 19:920575-920597 CGGGGGCGGCGGGGGCGGCGCGG - Exonic
1160790460 19:920584-920606 CCGGGCCGGCGGGGGCGGCGGGG - Exonic
1160793951 19:935248-935270 CCAGGCCGCGGCGGGGGGCCGGG + Intronic
1160826192 19:1081651-1081673 CGGGGGCGCTGCGGGCCGCGTGG - Exonic
1160832064 19:1108726-1108748 CAGGGCCGGCGCTGGGGGCTCGG + Intronic
1160835424 19:1122596-1122618 GGGGGCGGAAGCGGGGGGCGAGG - Intronic
1160844897 19:1161895-1161917 CTGGGGAGCCGCGGGGGGGGGGG + Intronic
1160847782 19:1174001-1174023 AGGGGTCGCGGCGGAGGGCGGGG + Intronic
1160861283 19:1238105-1238127 CTCGGCCGCCGCGGCGGGTGCGG - Intergenic
1160864075 19:1249536-1249558 CGGGCGCGCCCCGGGGGGCGCGG - Intronic
1160875878 19:1295978-1296000 CGGGGCCGCGGTGTGGGGCCAGG + Intronic
1160875910 19:1296044-1296066 CGGGGCCGCGGAGTGGGGCCAGG + Intronic
1160903095 19:1438895-1438917 AAGGGCGGCCGCGGGGGTCGCGG + Intronic
1160910346 19:1471077-1471099 CGGCGCAGCCGCGGCGGGCGAGG + Exonic
1160913158 19:1483975-1483997 CCGGGCCGCGCCTGGGGGCGAGG + Intronic
1160930509 19:1567779-1567801 CGCAGCGGCGGCGGGGGGCGCGG - Exonic
1160930759 19:1568452-1568474 CGGGGCCGGCGCCGGGCACGTGG + Intergenic
1160991677 19:1862866-1862888 TGGGGCGCGCGCGGGGGGCGTGG - Intronic
1161015100 19:1979454-1979476 CGGGGCCTCGGCGGGGGTGGGGG - Intronic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161042542 19:2117662-2117684 CGGGGAGCCCGCGGGGGCCGAGG - Intronic
1161068806 19:2250507-2250529 CCGGGCCGTGGCGGGGGGCATGG + Intronic
1161203476 19:3028678-3028700 GGGGGCCGCCCCAGGGGCCGCGG - Intronic
1161207201 19:3047269-3047291 CGGGGCGGCCGCGGCGGGGAGGG + Intronic
1161210448 19:3062662-3062684 GGGGGCCGCTGCCCGGGGCGGGG - Intronic
1161251850 19:3285019-3285041 CGGGGCGGGCCCTGGGGGCGGGG - Intronic
1161251963 19:3285431-3285453 CGGGGCCGCAGCAGAGGGCGGGG - Intronic
1161354225 19:3810239-3810261 CGGGGTCTCCGTGGGGAGCGTGG + Intronic
1161401164 19:4066686-4066708 CGGGGCCGGGCCGGGGCGCGCGG + Exonic
1161450636 19:4343616-4343638 CGGGGCGGAGGCGCGGGGCGCGG + Intronic
1161583929 19:5094977-5094999 CGGGGGCGGCGCCGGGGGCGGGG + Intronic
1161612490 19:5250938-5250960 CGGGGGCGGCGGGGGGGGGGGGG + Intronic
1161702941 19:5805007-5805029 CGGGGGCGGGGCCGGGGGCGGGG - Intergenic
1161852726 19:6746043-6746065 CGGGGCCCCCCAGGGGGGAGAGG - Intronic
1161959582 19:7516272-7516294 TGGGGCCGGGGCGGGGGGCTGGG + Intronic
1162027790 19:7904184-7904206 CGAGCCCGCAGCGGGGGGGGCGG - Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162128238 19:8510873-8510895 CGGCCCGGCCGCGGGGGCCGCGG + Exonic
1162145610 19:8610934-8610956 CTGGGGAACCGCGGGGGGCGGGG + Intergenic
1162312051 19:9913665-9913687 CTGGCCCGCCGCGGGGCGCTCGG + Intronic
1162362951 19:10230697-10230719 CGGTCCCCCGGCGGGGGGCGTGG - Intronic
1162374429 19:10296361-10296383 GGGCGGCGCGGCGGGGGGCGCGG + Exonic
1162426879 19:10602428-10602450 CGGGGCCGGGGCCCGGGGCGGGG + Intergenic
1162486081 19:10961237-10961259 CCGGGGCGCCGAGGGGGGAGGGG + Intronic
1162582555 19:11539866-11539888 TGGGGCCGGCGCTGGGGGGGAGG - Intronic
1162754260 19:12847752-12847774 CGAGGCCGCCAGGGGGCGCGCGG - Intronic
1163026778 19:14517585-14517607 CGGGGCCGCCTCGGAGGGTAAGG - Intronic
1163027044 19:14518477-14518499 CGGCGCCGCGGGGGCGGGCGGGG - Intronic
1163135495 19:15308141-15308163 CGGGGCCGGGGGGGGGGGGGGGG + Intronic
1163138611 19:15331850-15331872 AGCGGCCGCCGCGGGGTCCGCGG - Intronic
1163320575 19:16572340-16572362 GGCGGCGGCCGCGGTGGGCGCGG - Exonic
1163424877 19:17235853-17235875 AGGGGGCGGCGCGGCGGGCGCGG - Exonic
1163435748 19:17294205-17294227 CGTGGCCTCTGCGGGGGGCGTGG - Intronic
1163443787 19:17334738-17334760 CGGTGCAGCCGCGGAGCGCGCGG + Exonic
1163547231 19:17947801-17947823 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1163606936 19:18280863-18280885 CGCGGGCGGCGCCGGGGGCGCGG - Exonic
1163607098 19:18281491-18281513 CCGGGCCGGCGCGGCGGGGGAGG - Exonic
1163631284 19:18419251-18419273 AGTGCCCGCCGCGGGGGGTGGGG - Intronic
1163655668 19:18543527-18543549 GGCGGCCGCGGCTGGGGGCGGGG - Exonic
1163665850 19:18603879-18603901 GGGGGCGGCCGAGGGGGGCGGGG + Intronic
1163666550 19:18606463-18606485 GGGGGCAGCCGCGGGGGGAGGGG - Intronic
1163700878 19:18785930-18785952 CGGGGCCTGCGGTGGGGGCGGGG - Intronic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1163775160 19:19213112-19213134 CTGGGCCCCAGCGGGGGACGTGG + Intronic
1163804026 19:19385475-19385497 CGGGAACCCCGCGAGGGGCGGGG - Intergenic
1163851127 19:19664084-19664106 GGGGCCCGGTGCGGGGGGCGGGG + Intergenic
1164120556 19:22261751-22261773 CGGGGCGGGCGGGGCGGGCGGGG + Intergenic
1165058523 19:33194126-33194148 GGGGAGCGCGGCGGGGGGCGCGG + Intronic
1165349482 19:35268403-35268425 CCGGGGCTCCGCGGGGCGCGAGG - Intergenic
1165349740 19:35269195-35269217 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1165349795 19:35269319-35269341 CGGGGGCGCCGCCGAGGCCGGGG - Intronic
1165461100 19:35944913-35944935 CGGGGCGGGCGGGGCGGGCGTGG - Exonic
1165463760 19:35959880-35959902 CGAGGCCGCCGCGGCCCGCGGGG + Intergenic
1165721410 19:38082116-38082138 CGGGGGAGCCGCGGGGGGCCCGG + Exonic
1165784478 19:38453076-38453098 CGGGGCCACGGCGCTGGGCGGGG + Intronic
1165938314 19:39402933-39402955 CCCGGCCGCCGCTGGGGCCGCGG + Intergenic
1165939164 19:39406769-39406791 CGGGGCCGGGGCCGGGGGCGGGG - Intergenic
1165939169 19:39406775-39406797 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1165961623 19:39539803-39539825 CAGGGCAGCCGCGGCGGGCAGGG - Exonic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166117217 19:40663336-40663358 GGGGGCGGCCGCGAGGGGCGGGG + Intergenic
1166290532 19:41860480-41860502 GGGGGCAGCGGCGGGGTGCGTGG + Intronic
1166311790 19:41967212-41967234 CAAGGCAGCCGAGGGGGGCGGGG - Intronic
1166316764 19:41993892-41993914 TGGGGCCGCAGGGGGCGGCGGGG - Intronic
1166367374 19:42284412-42284434 GGGGGCCGTCACGGGGCGCGCGG - Intronic
1166714049 19:44955358-44955380 CGGGGCTGGCGGCGGGGGCGGGG + Exonic
1166765629 19:45251204-45251226 AGGGCCGGCGGCGGGGGGCGGGG + Intronic
1166851981 19:45765581-45765603 GGGGGCCACCGCAGGGGGTGAGG - Exonic
1166882946 19:45940222-45940244 CGGGGCCGGGGCGGGCGGCGGGG - Exonic
1166994487 19:46713814-46713836 CGGGGCCTCGGGTGGGGGCGGGG - Intronic
1166996785 19:46723228-46723250 CGGGGACGCCGTGTGGGGCCTGG - Exonic
1167080603 19:47274360-47274382 CGGGGCCGTCAGCGGGGGCGTGG + Intergenic
1167103820 19:47419280-47419302 CGTGACCCCCGCTGGGGGCGGGG - Exonic
1167258152 19:48443151-48443173 CGCGGGCGGCGCGGGGGGCACGG + Exonic
1167262029 19:48464163-48464185 CGGGGCTGCAGCAGGAGGCGAGG - Exonic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1167311248 19:48739134-48739156 CCGGCCCGCGGCGGCGGGCGTGG - Exonic
1167358582 19:49018218-49018240 CGGGGCGGCCGGGAGGAGCGCGG + Intergenic
1167445291 19:49533890-49533912 CGGGGCCGGCGCGGAGAGGGTGG + Intronic
1167466136 19:49651888-49651910 CGGGGCGGGCGCGGGCGCCGGGG - Exonic
1167466515 19:49653316-49653338 TGGGGCTGCCTTGGGGGGCGGGG - Exonic
1167501566 19:49851368-49851390 GGGGGCCCCCTCGGGGGTCGCGG + Exonic
1167613362 19:50517798-50517820 CGTGGCCGCCGCGGCCGCCGTGG - Exonic
1167618475 19:50548795-50548817 CCGGGCGGCAGCGGGGGGCACGG + Exonic
1167619971 19:50555328-50555350 CGGGGCAGCTGCGGTGGGAGAGG - Intronic
1167638533 19:50668242-50668264 CGGGGCCGCCCTGGTGGGGGCGG - Exonic
1167648912 19:50719340-50719362 CGGGGCCGCGGGAGGGGGCGAGG - Intronic
1167903362 19:52638395-52638417 CGGGGCCCGCGAGGTGGGCGGGG + Intronic
1167952427 19:53037968-53037990 CGGGGCCTCCGCGGAGTGGGGGG + Intergenic
1168064046 19:53909390-53909412 CGGGGCGGGGGCGGGGGGCGCGG + Exonic
1168076194 19:53982014-53982036 CGGGGCCGGGGGCGGGGGCGGGG + Intronic
1168100396 19:54138254-54138276 CGGGGAGGCGGCGGCGGGCGGGG - Intronic
1168105338 19:54162643-54162665 CGGGGCCACAGCAAGGGGCGGGG + Intronic
1168252652 19:55149246-55149268 CGGGCCCGCCCCGAGGGGAGAGG + Exonic
1168293870 19:55369626-55369648 CGCGGGGGGCGCGGGGGGCGCGG + Intronic
1168297304 19:55383740-55383762 CGGGCCCGGGGCGGCGGGCGCGG - Exonic
1168336289 19:55599418-55599440 CGGGGCGGCCCCGGGAGGCCGGG + Intronic
1168336518 19:55600336-55600358 CGGGGCCGGCGCGTGGGAAGGGG - Intronic
1168339121 19:55613802-55613824 GGGGGCTGCGGCGGGGGGCCGGG - Exonic
1168344240 19:55642641-55642663 CGGCCCAGCCGCGGGGGTCGGGG - Exonic
924962323 2:46134-46156 CGGGGCCGGGGCGCGGGCCGGGG + Exonic
925377640 2:3399804-3399826 CGGGGCGGTGGCGGGGGGAGCGG - Intronic
925492744 2:4413041-4413063 TGGGGCTGCCGCAGGGGGAGAGG - Intergenic
925609347 2:5691418-5691440 CAGGGACGCCGGGCGGGGCGCGG + Intergenic
925912702 2:8583758-8583780 AGGCGCCGGCGCGGGCGGCGAGG - Intergenic
926035109 2:9630467-9630489 CGGGGCCGGGGCGGAGGGCGAGG + Exonic
926077213 2:9951322-9951344 CGGGGACGGCGGGGGCGGCGGGG + Intergenic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
926095853 2:10080266-10080288 AGGGGGCGCGGCCGGGGGCGGGG + Exonic
926130927 2:10302824-10302846 GGGGGCCGGGGCGGGGCGCGCGG - Intergenic
926268295 2:11345026-11345048 GGGGGCCGCGGCGGGGGGCGCGG - Intronic
926422952 2:12716877-12716899 CGGGGGCGGCGGGGGGGGGGCGG + Exonic
927156549 2:20224456-20224478 CCCGGCCGCCGCGGTGGCCGGGG + Intronic
927168768 2:20350947-20350969 CGCTGCCGCCGCGCGGGCCGGGG + Intronic
927472117 2:23384923-23384945 GGGGGCCACCGCGGGGGGCGGGG + Intergenic
927472401 2:23385838-23385860 CCTGGCCGCCGCGTGGGGCCGGG + Intronic
927596633 2:24403171-24403193 GGGGGCGAGCGCGGGGGGCGGGG - Intergenic
927714317 2:25342177-25342199 CCGGGGCGCCGCGGCGGGAGCGG + Intronic
927714425 2:25342521-25342543 CGGGGGCTCCGCGGGCTGCGGGG - Exonic
927857657 2:26537447-26537469 CAGGGCCGTCGAGGTGGGCGAGG + Intronic
927881493 2:26692819-26692841 CGGGGCCGAGGCGCGGGCCGGGG + Exonic
927943999 2:27123790-27123812 CGGGGCACCGGCGGTGGGCGGGG + Intronic
928687186 2:33761471-33761493 CGGGGCGGCTGCGGGCGGAGGGG + Intergenic
928964823 2:36966337-36966359 CGGGGCGGCTGCGGCGGGGGCGG - Exonic
929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG + Exonic
929936411 2:46297325-46297347 CGGGGCGGGCGCGGAGGGCGGGG - Intronic
930198277 2:48530091-48530113 CGGGGCCGCCGAGTGGAGGGCGG - Intronic
930700836 2:54456695-54456717 CGGGGGCGGCGCGGGGAGCCCGG + Intronic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931487192 2:62705628-62705650 CCCGGCCGCCGAGGTGGGCGGGG + Intronic
931614643 2:64144020-64144042 CGGGGCCGCCGAGGGGCGCGGGG - Intronic
931671877 2:64654407-64654429 CAGGGTCCCCGCGGGGGGCGAGG + Intronic
931719511 2:65056786-65056808 CGGGGCCGAGGCGGGCGGCTGGG + Intronic
932699992 2:73985454-73985476 CCGCGCCGCCGAGGGGCGCGGGG - Intergenic
932773221 2:74513281-74513303 CAGGGCCCCCCCGGGGGCCGGGG + Intergenic
934079022 2:88452179-88452201 CGAGGCGGGCGCGGCGGGCGCGG + Exonic
934539115 2:95159751-95159773 CGGGACGGCCTCGGGAGGCGGGG - Intronic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
934966861 2:98731132-98731154 CGGAGCCGGCGGGGCGGGCGGGG - Intergenic
934966884 2:98731181-98731203 CGGGGCGGCCCGGCGGGGCGGGG - Intergenic
934978342 2:98821921-98821943 CGGGCCGGCGTCGGGGGGCGCGG + Exonic
935592567 2:104855630-104855652 CGGGGGCGGCGCAGGGGGCGGGG + Exonic
936412974 2:112276281-112276303 CGGAGCCCGCCCGGGGGGCGGGG - Intronic
936433227 2:112482120-112482142 CGGGGCCGCGCCGGCGGGGGCGG + Intergenic
936433404 2:112482844-112482866 CGGGTCCGCCGCGCTGGGCGCGG + Intronic
937045151 2:118847185-118847207 GGGGGCCGGCGCGGCGGCCGGGG - Exonic
937305358 2:120867444-120867466 AGTGGCCGCCGAGGGAGGCGGGG - Intronic
938073080 2:128318577-128318599 CGGGGCCCGGGCGCGGGGCGCGG + Exonic
938290025 2:130144020-130144042 CGGGGACGGGGTGGGGGGCGGGG + Intronic
938466499 2:131528917-131528939 CGGGGACGGGGTGGGGGGCGGGG - Intronic
939153832 2:138501829-138501851 CGGGCCCGCGGCGGGGGGGTGGG + Exonic
940227064 2:151410655-151410677 CGCGGACGCCTTGGGGGGCGGGG + Intronic
940300988 2:152176048-152176070 CGGCGGCGCGGCAGGGGGCGCGG + Intergenic
941666361 2:168247289-168247311 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
941666363 2:168247295-168247317 CGGGGCCGGGGCCGGGGCCGCGG + Exonic
941905580 2:170714679-170714701 CGGCCCCACCGCGGCGGGCGGGG + Intergenic
942046143 2:172100557-172100579 CGGGGGCGCCCCGGTGAGCGCGG - Exonic
942314048 2:174682437-174682459 CGGGGCCGCCCCGTGGGGCTCGG - Intronic
944244429 2:197516526-197516548 CGGGGCCGCTGAGGTGGGAGGGG + Intronic
944585165 2:201166404-201166426 CGGGGCAGCTGCGGGCGGAGGGG + Exonic
945188952 2:207166644-207166666 CGGGGAAGCCGCCGAGGGCGCGG + Intronic
945225913 2:207530586-207530608 CGGGGGCGAGGCGGGCGGCGGGG - Intronic
945585226 2:211653460-211653482 GGGGGCGGGTGCGGGGGGCGGGG - Intronic
945955415 2:216081873-216081895 CGCGGCCGGCGGGCGGGGCGGGG - Exonic
946306525 2:218859749-218859771 CGGGGCCGAGGCGGGGGCGGGGG - Intergenic
946310697 2:218881011-218881033 CGGAGCCGCAGCCAGGGGCGAGG - Exonic
946313851 2:218897172-218897194 CCGGGCCGCTGCGGTGCGCGGGG + Intronic
946322231 2:218960807-218960829 CGAGGCCGCCGCCAGCGGCGGGG + Exonic
946339975 2:219060583-219060605 CGGGGGCGCCATGGGCGGCGTGG + Intergenic
946692424 2:222319514-222319536 CGGGGCCGGGGTGGGCGGCGGGG + Intergenic
947623328 2:231604592-231604614 CGGGGCCGGAGCTGGGGCCGAGG + Intergenic
947632304 2:231662146-231662168 CGTGGCCGCCTCGCGGGCCGGGG - Intergenic
947636012 2:231681083-231681105 CCGGGCCGCCGCTGGGGGCTCGG + Intergenic
947774522 2:232697262-232697284 CGGGGGCGGAGCAGGGGGCGTGG + Intergenic
947860485 2:233354457-233354479 CGGGGCCGGCGGGAGGGGCGGGG - Intergenic
947860565 2:233354707-233354729 CGGGGCTGCCGCGGCGTGAGGGG - Intronic
947992276 2:234497112-234497134 CGGGTCCGGGGCGGGGCGCGAGG - Intergenic
948140701 2:235670250-235670272 CGGGGCCGCCGAACCGGGCGTGG - Intronic
948216543 2:236237343-236237365 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216558 2:236237368-236237390 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216573 2:236237393-236237415 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216586 2:236237418-236237440 CGGGGCCGGGGCGCGGGGCGAGG + Intronic
948697313 2:239738209-239738231 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697317 2:239738215-239738237 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948764102 2:240210727-240210749 CGGGGCCCCATCTGGGGGCGTGG - Intergenic
948801581 2:240435730-240435752 CGGCGGCGGCGCGGGGCGCGCGG - Exonic
948824204 2:240566549-240566571 CGGGGCCTCCTCGGGCGGGGCGG + Intronic
948824630 2:240568365-240568387 CGGGGCCGGGGCGCCGGGCGGGG - Intronic
948824637 2:240568378-240568400 CGGGGCCGGGGCGCGGGGCCGGG - Intronic
948988763 2:241541399-241541421 CGTGGCCGCTGGGAGGGGCGGGG + Intergenic
1168769751 20:407949-407971 CGGGGCCGGGGCCGGGGGCGGGG - Intronic
1168804431 20:664168-664190 GGGGGGCGCCGGGGGGCGCGCGG - Exonic
1169131525 20:3168362-3168384 AGGGGCCGCTGCAGGGTGCGCGG + Intronic
1169244596 20:4015582-4015604 CGGGCCCGCCGGGGGAGGGGCGG + Intronic
1169278481 20:4248852-4248874 CGGGGGCAGCGCGGGCGGCGCGG - Exonic
1170889803 20:20367865-20367887 CGGGGCGGCGGCGCCGGGCGGGG + Intergenic
1172117982 20:32583316-32583338 CCGGGCGGCCGCGGAGGGGGAGG + Intronic
1172118177 20:32583830-32583852 CCGGGCCGGCCCGGGGGACGGGG + Intronic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1172422057 20:34825715-34825737 CGGGGCGGACTCGAGGGGCGGGG + Intergenic
1172618707 20:36306396-36306418 CGGAGCCGGGGCGGGGGCCGGGG + Exonic
1172644483 20:36461396-36461418 CGCGGCTGACGCGGGGGGCGGGG + Intronic
1172755553 20:37281358-37281380 CTGGGCCGGGGTGGGGGGCGGGG + Intergenic
1172848415 20:37944165-37944187 CGGGGCGGGCGCGGCGGGAGGGG - Exonic
1172939799 20:38646325-38646347 CGGCGCCGTCACGGGGAGCGAGG + Intronic
1174133275 20:48360545-48360567 CGGGGCCACAGCGTGGGGCCTGG - Intergenic
1174204475 20:48828484-48828506 CGGGGCCGCGGAGGCGCGCGTGG - Intergenic
1174287382 20:49482845-49482867 AGGGGCCGCCCCTCGGGGCGGGG + Intergenic
1174317284 20:49713145-49713167 CGGGCGCGCCGCGGGGGACTGGG + Intronic
1174402379 20:50282967-50282989 CGTGGCCGAAGCGGGGGCCGTGG - Intergenic
1174447743 20:50602040-50602062 CAGGGCCACCGCCCGGGGCGGGG + Intronic
1174658637 20:52191949-52191971 CTGGGCGACCGCGGGTGGCGAGG + Exonic
1175210454 20:57350880-57350902 CGGGGGGGGCGGGGGGGGCGGGG + Intergenic
1175215230 20:57389142-57389164 TGGGGCCGCCGGAGGGGGGGAGG + Intergenic
1175267075 20:57709591-57709613 CGGCGGCGCGGCGCGGGGCGCGG + Exonic
1175399655 20:58693100-58693122 CGGGGCCTCCGCGGGCCGCCCGG - Intronic
1175715418 20:61252121-61252143 CTGGTGCGGCGCGGGGGGCGCGG + Intergenic
1175749210 20:61483669-61483691 CGGGGGCGGGGCGGGGGGGGCGG - Intronic
1175847105 20:62065001-62065023 CGGGGCGGCGGCGGGGGCGGCGG + Exonic
1175847117 20:62065025-62065047 CGCGGGGGCGGCGGGGGGCGAGG + Exonic
1175847127 20:62065049-62065071 CGCGGCGGGCGCGGGGGGCGCGG + Exonic
1175847491 20:62066157-62066179 GGGGGCCGCCGGGCGGGGCGCGG + Intergenic
1175873678 20:62219895-62219917 CGAGGCGGCGGCGGCGGGCGGGG - Exonic
1175994176 20:62804993-62805015 CGGAGGAGCCGCGGGCGGCGCGG + Exonic
1176005659 20:62861184-62861206 CGGCGCCGCCAAGGAGGGCGCGG - Exonic
1176042376 20:63072335-63072357 GGGGGCAGCAGCGGGGCGCGGGG + Intergenic
1176068851 20:63215825-63215847 AGGGGCCGCGGCCGGGGCCGAGG - Intronic
1176128954 20:63488201-63488223 CCGGACCGGCGCGCGGGGCGGGG + Exonic
1176131766 20:63499304-63499326 CGGGGGCGGGGCGGGGGGCAGGG + Exonic
1176194584 20:63831334-63831356 CGGGCGCGCGCCGGGGGGCGGGG - Intergenic
1176221072 20:63969657-63969679 CGGCGCCGGCGCGGGGCGCGGGG + Intronic
1176221085 20:63969681-63969703 CTCGGGCGCGGCGGGGGGCGGGG + Intronic
1176221152 20:63969848-63969870 CCGGGCCGGGGCGGGGGGCGCGG + Intronic
1176234581 20:64048484-64048506 GAGCGGCGCCGCGGGGGGCGCGG + Exonic
1176234830 20:64049367-64049389 CGAGGCGGGCGCGGCGGGCGCGG + Exonic
1176376912 21:6091408-6091430 CGGTGGCGCGGCGGGAGGCGTGG + Intergenic
1176380704 21:6111033-6111055 CGGGGGCGGGGCAGGGGGCGGGG + Intergenic
1176550188 21:8217413-8217435 CGGGTCCGCCCCCGGGGCCGCGG + Intergenic
1176569116 21:8400451-8400473 CGGGTCCGCCCCCGGGGCCGCGG + Intergenic
1176577030 21:8444683-8444705 CGGGTCCGCCCCCGGGGCCGCGG + Intergenic
1176619159 21:9043158-9043180 CGGCGCAGTCGCGGGGGGCGGGG - Intergenic
1177389165 21:20444028-20444050 CGGGGCCGCGGGGGAGGTCGCGG + Intergenic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1178914169 21:36697863-36697885 CCGGGCCGCGGATGGGGGCGCGG - Intergenic
1178953931 21:37006736-37006758 CGGCGCCGCAGCAAGGGGCGCGG + Exonic
1179150739 21:38806181-38806203 CGGGGCCTGGGCGGGGGTCGCGG + Intronic
1179243835 21:39613076-39613098 CGGGGCTGGGGCGCGGGGCGCGG + Intronic
1179534362 21:42041887-42041909 GGGGGCAGCCCCGGGGGGTGTGG - Intergenic
1179586421 21:42376515-42376537 CGGGGCCGCAGCGGTGGGCGAGG - Intronic
1179605686 21:42513939-42513961 CGGGGCCGGACCGGGAGGCGGGG + Exonic
1179742768 21:43427207-43427229 CGGGGGCGGGGCAGGGGGCGGGG - Intergenic
1179746563 21:43446836-43446858 CGGTGGCGCGGCGGGAGGCGTGG - Intergenic
1179891808 21:44339078-44339100 CGCGGCCGCCCCGGGGTGGGGGG - Intronic
1180005520 21:45018907-45018929 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1180037800 21:45258719-45258741 CTGGGCGGCCGCGGGGGGACTGG + Intergenic
1180092882 21:45541995-45542017 CGGGGTCTCCGCGGGGGTCGCGG - Intronic
1180209592 21:46286579-46286601 CGCGGACGCGGCGGGGTGCGGGG - Exonic
1180216177 21:46324786-46324808 CGCGGCCGGGGCCGGGGGCGTGG + Intronic
1180782801 22:18530101-18530123 CCGGGCCGGCGCCGCGGGCGCGG + Intronic
1180791502 22:18577747-18577769 AGGGGCGGCCTTGGGGGGCGGGG - Intergenic
1180801530 22:18634211-18634233 GGGGGCCGGGGCGGCGGGCGCGG + Intergenic
1180915107 22:19480243-19480265 CGGGGCCGGCGCGCGAGGTGAGG + Intronic
1180949380 22:19714392-19714414 CAGGGCGGCCCGGGGGGGCGGGG - Intergenic
1181061356 22:20283539-20283561 CGGGGCTGGGGCTGGGGGCGGGG + Intergenic
1181126363 22:20704133-20704155 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181147491 22:20859023-20859045 CGGGGTCGGCGGGCGGGGCGAGG + Exonic
1181165161 22:20979377-20979399 CGGGGCCTCGGATGGGGGCGGGG + Intronic
1181220192 22:21361050-21361072 GGGGGCCGGGGCGGCGGGCGCGG - Intergenic
1181239691 22:21469439-21469461 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181248501 22:21517579-21517601 GGGGGCAGCAGCTGGGGGCGTGG + Intergenic
1181312527 22:21952876-21952898 CCTGGCCGCCGCGGGCGCCGCGG + Intergenic
1181467581 22:23118478-23118500 CAAGGCAGCCGCGGGGGGTGGGG - Intronic
1182249927 22:28992166-28992188 CGGGGCCGGGGCGGGGGGTTGGG - Intronic
1182576518 22:31276698-31276720 CAGCGGCACCGCGGGGGGCGCGG + Intronic
1182715050 22:32351697-32351719 CGGGGCGGGGGTGGGGGGCGTGG + Intergenic
1183407975 22:37639743-37639765 CGGGGTCACGGCGGGGGTCGCGG - Exonic
1183517026 22:38272715-38272737 CGGTGCGGCCGCGGAGGGAGGGG - Intronic
1183524999 22:38317491-38317513 CGGGGCGGCGGCGGCGGGCCGGG - Intronic
1183545915 22:38454889-38454911 CGGGGCCGGAGCGGCGGGCCCGG + Intronic
1183593243 22:38793962-38793984 TGGGGCCTCGGCGGCGGGCGAGG + Intronic
1183606989 22:38871862-38871884 CGGGGGCGTCGCGGGAGGGGAGG - Intronic
1183683774 22:39350215-39350237 CGGCGGCGCGGCGGCGGGCGAGG + Intronic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1183831109 22:40418715-40418737 CGGGGGTGCCGAGGGGGGCGGGG + Exonic
1183942241 22:41302259-41302281 AGGGGCCGCGGCGAGGGCCGGGG + Intronic
1184034108 22:41910490-41910512 CGGGGCCCCCGCGCGGCCCGCGG - Exonic
1184037846 22:41926833-41926855 CGGGGAGGAAGCGGGGGGCGGGG + Intergenic
1184101388 22:42343444-42343466 CGCGGGCGCGGCGGGGGGCGGGG - Intronic
1184101446 22:42343599-42343621 CGCGGCGGCCGCGGGGCGCACGG - Intronic
1184101454 22:42343623-42343645 CGGGGCCCGCGCTGGAGGCGAGG - Intergenic
1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG + Intergenic
1184439219 22:44498304-44498326 CGGGGCCGGCGCGGTGGCGGTGG + Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184759406 22:46536469-46536491 CGGGGCCGGCGCGACGGGCCCGG - Exonic
1185037920 22:48489430-48489452 CGCGGGCGCGGCGCGGGGCGCGG + Intergenic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185255258 22:49827968-49827990 AGGGGGCGCCGCGAGGAGCGGGG + Intergenic
1185268719 22:49918615-49918637 CGGGGCTGGCGGGTGGGGCGGGG + Exonic
1185272693 22:49936091-49936113 CGGGGCCGGGGCGGCGGGGGAGG - Intergenic
1185313910 22:50170652-50170674 GGGGCCCGGCGAGGGGGGCGCGG - Intergenic
1185313922 22:50170678-50170700 CGCGGGCGGGGCGGGGGGCGCGG - Intergenic
1185317588 22:50185734-50185756 CGGGAGCGCCGGGGGGGGGGGGG + Intergenic
1185317634 22:50185886-50185908 TGGGGCCGCGGGGCGGGGCGGGG - Intergenic
1185333349 22:50261325-50261347 CGGGGCCTGCGCGGGGTGCCCGG - Intronic
1185343000 22:50299910-50299932 CGGTGCCGGCGCCGGGGGAGGGG - Intronic
1185351739 22:50343236-50343258 CGGGGCCGCGCGGGTGGGCGGGG - Intergenic
1185403050 22:50628192-50628214 CGGGGGCGGGGCCGGGGGCGGGG + Intergenic
1203255083 22_KI270733v1_random:133751-133773 CGGGTCCGCCCCCGGGGCCGCGG + Intergenic
1203263139 22_KI270733v1_random:178830-178852 CGGGTCCGCCCCCGGGGCCGCGG + Intergenic
949938599 3:9136396-9136418 CGGGGCGGTCGGGGGGGGGGGGG - Intronic
950021713 3:9792417-9792439 AGGGGCCGCGGGAGGGGGCGGGG + Exonic
950053553 3:10009178-10009200 CAGTGACGCAGCGGGGGGCGTGG - Intronic
950316326 3:12004685-12004707 CGGGGGCGCCGCCGAGGCCGAGG - Exonic
950400967 3:12768918-12768940 CGGGGCCGGGGCGGGGCGGGGGG + Intronic
950400980 3:12768934-12768956 CGGGGGGGGCGGGGGGGGCGGGG + Intronic
950675217 3:14550500-14550522 CGGTGCCGCTGCGGGGAGGGTGG - Intergenic
950729800 3:14947689-14947711 CGGGGGCGCCGCCGGGGTCGCGG - Intronic
950730095 3:14948589-14948611 CGGGGGCGGGGCCGGGGGCGGGG + Intronic
951907022 3:27715677-27715699 CGGGGCGGGGGAGGGGGGCGGGG - Intergenic
952867229 3:37862121-37862143 GGGGCGCGGCGCGGGGGGCGCGG - Intronic
952942290 3:38454069-38454091 CCGGGGCGACGCGGGGGCCGGGG - Exonic
953027425 3:39153201-39153223 CGGGGTTACCGCGGCGGGCGGGG + Intronic
953518822 3:43622082-43622104 CGGGGCCGCGGCGGGAGAGGCGG + Intronic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954256547 3:49411634-49411656 CGGGGTCGCCGCTTGGGGCGCGG + Intronic
954912700 3:54122401-54122423 CGGGGCCGCCGAGGCGGGGCCGG + Intergenic
956675039 3:71725326-71725348 CCGGGCCCCGGCGGGGGGCGCGG + Exonic
956813618 3:72888340-72888362 CGGGGCGGACGCGGGGCGCGCGG - Exonic
958638521 3:96776809-96776831 CGGGGTCTCCGCGGCGTGCGCGG - Intergenic
959591892 3:108090911-108090933 CGGCGACCCCGCGGCGGGCGCGG - Exonic
960684799 3:120285419-120285441 CGGGGCCGCCCCAGGGGACTCGG - Intergenic
961012874 3:123447999-123448021 CGGCGCCGTCGAGGGCGGCGAGG - Exonic
961013306 3:123449476-123449498 CGGGCCCACCGCGGCCGGCGCGG + Exonic
961013397 3:123449806-123449828 CCCGGGCGGCGCGGGGGGCGGGG - Intergenic
961320101 3:126067097-126067119 GGTGGCCGGGGCGGGGGGCGGGG - Intronic
961612575 3:128152910-128152932 CGGGGGGACGGCGGGGGGCGGGG - Intronic
961827566 3:129606853-129606875 CGGGGCCGGGGCGGGGAGTGAGG - Intergenic
961929374 3:130517100-130517122 CGGGGCCGCCGGGGCGGGGAAGG + Intergenic
962156821 3:132956822-132956844 CGGGGCAGGGGCGGGGGGGGCGG - Intergenic
962222274 3:133573899-133573921 CGGGGTCGCCGAGGCGTGCGCGG - Exonic
962272335 3:133987132-133987154 CGGGGCGGGGGCGGGGGGGGGGG - Intronic
962804189 3:138915535-138915557 CGGGCCTGCCGCCGGGGGCGCGG - Intergenic
963091399 3:141486931-141486953 CGGGGCCGCGGCGGGCGGGGCGG + Intergenic
963091587 3:141487532-141487554 CCGGGGCGCGGCCGGGGGCGCGG + Intronic
966182031 3:177197060-177197082 GGGGGCCTGGGCGGGGGGCGCGG - Intronic
966684826 3:182682729-182682751 CCGGGCCGGCGCGCGGGGGGCGG - Intergenic
966866538 3:184261503-184261525 GGGGGCGGGGGCGGGGGGCGGGG + Intronic
966886445 3:184380177-184380199 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
967491772 3:190100234-190100256 GGGGGGCGGCGGGGGGGGCGGGG - Intronic
967858467 3:194134892-194134914 CGGGCCAGGCGCAGGGGGCGGGG + Intergenic
968025938 3:195442703-195442725 CGGGGCCTCCTCCGGGTGCGCGG + Intronic
968048083 3:195635284-195635306 CGGGGCAGCTGCGGGGGAGGCGG - Intergenic
968048177 3:195635500-195635522 GGGGGCGGCCGCGGGGGTCGGGG - Intergenic
968090320 3:195895150-195895172 TGAGGCCGCCGCAGGGGGCAGGG + Intronic
968099227 3:195954120-195954142 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968099319 3:195954336-195954358 CGGGGCAGCTGCGGGGGAGGCGG + Intergenic
968306434 3:197654421-197654443 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968306528 3:197654637-197654659 CGGGGCAGCTGCGGGGGAGGCGG + Intergenic
968341576 3:197960186-197960208 CGGGGCCGGCGCGGGCGCAGAGG + Intronic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
968433822 4:575200-575222 CGGGGCCGGCGGGGCCGGCGGGG - Intergenic
968479238 4:826338-826360 GGGGGCGGGGGCGGGGGGCGGGG + Intergenic
968479292 4:826423-826445 GGGGGCGGGGGCGGGGGGCGGGG + Intergenic
968514294 4:1009866-1009888 CGGGGCCGGGACGGGGGGCGGGG - Intergenic
968550586 4:1221725-1221747 CGGGGCCGCCACGGGAGAAGGGG + Intronic
968593662 4:1471878-1471900 TGGGGGAGCCGCCGGGGGCGGGG + Intergenic
968674964 4:1872009-1872031 CGGGGCGGCCGCGGTGGGAGGGG + Intronic
968674980 4:1872045-1872067 CGGGGCCGGCGCCGGGGCCAGGG + Intronic
968701056 4:2058647-2058669 ATGCGCGGCCGCGGGGGGCGGGG + Intergenic
968750605 4:2387058-2387080 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
968815126 4:2818110-2818132 CGGTGACGCGGCAGGGGGCGGGG + Intronic
968956448 4:3722151-3722173 AGTGGCCACGGCGGGGGGCGGGG + Intergenic
968965123 4:3765848-3765870 CGGGGCGGGCGCGCGGGGCGGGG - Intergenic
969344747 4:6563687-6563709 CGGGCCCGGGGCGGGGGGCGGGG + Intergenic
969344783 4:6563788-6563810 CCGGGCGGCTGCGGGGGGCCGGG + Intergenic
969362614 4:6674275-6674297 CGCGGCCGGCGCGGGGCGCGGGG - Intergenic
970001346 4:11368852-11368874 CGGGGCCGCTGCGGGCGGAAGGG + Intergenic
970333143 4:15004208-15004230 CTGCGGCGCCGCGGGCGGCGGGG - Exonic
970897141 4:21117291-21117313 CGGGGTTGCCGGGGGGGGGGGGG + Intronic
971257874 4:25030701-25030723 CGGGGCCCGGGCGGGGAGCGGGG - Exonic
972396618 4:38663983-38664005 CGGAGGCGGCGCGGGAGGCGGGG + Intergenic
972543001 4:40056149-40056171 CGTGGCCGCTGCGGCGGGCACGG - Intergenic
972632881 4:40857194-40857216 ATGGGCGGCCGCGGCGGGCGGGG - Intronic
973292435 4:48483672-48483694 CGGGGCCGGCGCTGGAGGCAGGG - Exonic
973531864 4:51843422-51843444 CGGTGACGCTGCGGGCGGCGTGG + Intronic
973613700 4:52659368-52659390 CTGGGCCGCGGCCGGCGGCGCGG + Intergenic
973888415 4:55346209-55346231 CGGTGACGCGGCGCGGGGCGGGG - Exonic
975870743 4:78776296-78776318 CGGGGACGGGGCGGGGCGCGAGG - Intergenic
976199015 4:82561547-82561569 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
976199023 4:82561565-82561587 CGGGGCCGCAGCGGGCGGGCTGG + Intronic
976704618 4:88007789-88007811 CGGGTCCGGCGCGCGGGGCGCGG - Exonic
977809701 4:101346063-101346085 GAGGGTGGCCGCGGGGGGCGCGG - Intronic
977908146 4:102501132-102501154 CGGGGCCGCTTCGGGGCGCCGGG - Intergenic
978072583 4:104491450-104491472 GGGGGCGGCGGCGGGGGGGGTGG - Exonic
978619312 4:110622848-110622870 CAGGGCTGCCGCGTGGGGGGGGG - Exonic
979231387 4:118352503-118352525 GGGAGCGCCCGCGGGGGGCGCGG + Exonic
979278093 4:118835839-118835861 CGGGGACGCGGCGGGAGGCCGGG - Intronic
980130380 4:128811663-128811685 CGGGGCGGGCGCGGCGGGCCGGG - Intronic
980405034 4:132344810-132344832 CGGGGCTGCGGCTGGGGCCGGGG + Intergenic
980405059 4:132344889-132344911 CGGGGCTGCGGCTGGGGCCGGGG + Intergenic
980923901 4:139115344-139115366 CAGCGGCACCGCGGGGGGCGCGG - Intronic
981315471 4:143336452-143336474 CGCGGCCGCCGAAGAGGGCGGGG - Intergenic
981530924 4:145752996-145753018 CGTGGCCGCTGCTGGGGGCTGGG + Intronic
982068266 4:151673257-151673279 GGGGGGGGCCGCGGGAGGCGTGG + Intronic
982172844 4:152678520-152678542 CGGGGCGGCGGTGGGGGGAGGGG + Intronic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
984928388 4:184826107-184826129 CGGGGCCTGCGGGCGGGGCGGGG - Intronic
984973475 4:185210060-185210082 CGGGGAGGCGGCGGGGGCCGCGG + Intronic
985068352 4:186144723-186144745 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
985068389 4:186144822-186144844 CGGCGCCGGCGCGGGCGGGGCGG + Exonic
985129657 4:186726761-186726783 CGCGCCCGGGGCGGGGGGCGAGG - Intergenic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985537435 5:473147-473169 CGGGGCCTGCGCCGGGGGCGGGG - Intergenic
985549131 5:524379-524401 CTGGGCCGACGCGCGGGGCTGGG + Intergenic
985550109 5:528573-528595 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
985565276 5:612318-612340 CGGCGCCTGCGCGGCGGGCGGGG - Exonic
985629855 5:1008750-1008772 CGGGGGCGCTGCGGGGGCCGCGG + Intergenic
985660857 5:1155914-1155936 CGGGGCCGGCGGGGCGGGCGCGG + Intergenic
985660862 5:1155923-1155945 CGGGGCGGGCGCGGGAGGCCGGG + Intergenic
985703235 5:1386129-1386151 TGGGGCCGGCGCGGGGAGTGAGG + Intergenic
985714242 5:1446537-1446559 CGGGGCGGGCGCAGGGGGTGGGG - Intergenic
985824741 5:2183834-2183856 CGGGGAGGCTGCTGGGGGCGGGG + Intergenic
985896359 5:2751797-2751819 CCGGGCCGCGGCCGGGGGAGGGG + Intergenic
985997084 5:3602939-3602961 CGGGGGCGCGTCGGGGAGCGGGG + Intergenic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986330622 5:6713931-6713953 CGGGGCCGCGTCGGGGCGGGCGG + Intergenic
986330847 5:6714709-6714731 CGGGGAGGCCGCGGGGGCGGGGG + Intronic
986695930 5:10354108-10354130 CCGCGCCGCCGAGGGGGGCGGGG + Intronic
986733288 5:10650156-10650178 CGGGGCCGCAGGGCTGGGCGCGG + Exonic
987156752 5:15096629-15096651 GGGGGCGGGCGGGGGGGGCGGGG + Intergenic
987379912 5:17275549-17275571 CGGCCCCGCTGCGGGCGGCGAGG + Exonic
988369281 5:30346012-30346034 GGGGGGGGCCGGGGGGGGCGCGG - Intergenic
988734654 5:34008107-34008129 CGGCGCCGCGGCTGGGGGCGTGG - Intronic
988825195 5:34929309-34929331 CGGGGCCTCGGCGGGGCGAGAGG - Intergenic
989178883 5:38556720-38556742 CGGGGCCGGGGCCGGGGGCAGGG - Intronic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
990376196 5:55173295-55173317 CGGGGCCGCGGCGCGCGCCGGGG - Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
992105642 5:73447618-73447640 CGCGGGAGCCGCAGGGGGCGCGG - Exonic
992320919 5:75612324-75612346 CGGGGGCGGGGCGGAGGGCGGGG - Intronic
992663610 5:78984903-78984925 CGGGGGCGGCGCGGGCGGCGGGG + Intronic
992716311 5:79514229-79514251 CGGAGCCGCGGCCGGGGGCTGGG + Intergenic
992939919 5:81751435-81751457 CGCGGGCGGCGCGGGGGGAGGGG - Intronic
994710540 5:103259197-103259219 TGGGGCCCGCGCGGGGTGCGGGG + Intronic
995764596 5:115602053-115602075 GGGGGCCGCCGCCGGGGGCGCGG - Intronic
997513138 5:134466601-134466623 CGGGGCAGCCGGGCAGGGCGGGG - Intergenic
997521551 5:134526913-134526935 CGGGGCGACGGCAGGGGGCGTGG + Intronic
997584095 5:135034450-135034472 CGGCGAGGCCGCGGGGGGCGGGG - Intronic
997647645 5:135491647-135491669 CCGGGCGGGCGCGTGGGGCGGGG + Intergenic
997653009 5:135536029-135536051 CCGGGCTGCCGCGGGGGCGGAGG - Intergenic
997870014 5:137498650-137498672 CGGGGACCCCGCGGCGGGCACGG + Intronic
997899642 5:137753471-137753493 CGGGGCGGCCGAGGCGGCCGGGG - Exonic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
997984597 5:138492334-138492356 CTGGCCCGGCGCGGGAGGCGCGG + Intergenic
998018990 5:138753872-138753894 CGGGGCTGCCGCGCGCGCCGAGG - Intronic
998166797 5:139848734-139848756 CCGGGCCGGCGCGGGGGAGGGGG + Intronic
998265474 5:140664807-140664829 CGCTTCCGCCTCGGGGGGCGGGG - Exonic
998583505 5:143403832-143403854 CGGGGCCCGCGCGGAGGGCGTGG - Intronic
999767974 5:154755410-154755432 CCGGGCCGCCCCGGGGGCGGGGG + Intronic
1000296306 5:159916311-159916333 CGCGCCCTCTGCGGGGGGCGGGG - Intergenic
1000302952 5:159972312-159972334 CGTGGCGGCCGCGGCGGCCGGGG - Exonic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001381979 5:171311318-171311340 CGGGGCCGCCGGCGGGGCCCCGG - Intronic
1001586001 5:172834301-172834323 GGGGGCGGCCGGCGGGGGCGGGG + Exonic
1001823041 5:174724743-174724765 TGGGGGCGCCGAGGGGGCCGCGG + Exonic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002168714 5:177363315-177363337 CGGGGCCGGAGACGGGGGCGGGG + Intronic
1002170316 5:177371040-177371062 CCGGGCCGCGGGGCGGGGCGGGG + Intronic
1002170336 5:177371074-177371096 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170340 5:177371080-177371102 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170344 5:177371086-177371108 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170348 5:177371092-177371114 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170352 5:177371098-177371120 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002622098 5:180494938-180494960 CGGGGGCGCGGCCCGGGGCGGGG - Intronic
1002632629 5:180591346-180591368 CGGGGGCGCAGCGGGCGCCGAGG + Intronic
1002638328 5:180618983-180619005 GCGGGGCGCCGCGGGCGGCGGGG - Intronic
1002888175 6:1313426-1313448 CGAGGCCGGGGCGGCGGGCGCGG - Exonic
1002888970 6:1317396-1317418 CTCGGCCGACGCGGGGGGCGCGG + Intergenic
1002927001 6:1610526-1610548 CGCGGCGGCCGCGGCGGCCGGGG + Exonic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1002927253 6:1611585-1611607 CGCGGGGGCCGCGGGGGGCGCGG + Exonic
1003175532 6:3750711-3750733 CGCGGCAGCCGCGGGCGGGGCGG + Intronic
1003569471 6:7246752-7246774 CGAGGCAGGCGCCGGGGGCGCGG + Exonic
1004140639 6:13014158-13014180 CGGGGCGGCGGCGGCGAGCGCGG + Intronic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1004690335 6:17987660-17987682 AGGGGCGGGCGCGCGGGGCGGGG + Intergenic
1005453065 6:25992606-25992628 CAGGGCCGGCGCTGCGGGCGGGG - Intergenic
1005605511 6:27473145-27473167 CGGCGCCGGCGTGCGGGGCGGGG - Intergenic
1005905721 6:30260306-30260328 CGGGGCTGACGGCGGGGGCGAGG + Intergenic
1005915287 6:30345611-30345633 TGGGGGCGCGGAGGGGGGCGGGG + Intronic
1006177509 6:32131303-32131325 CGAGGCGGCGGGGGGGGGCGGGG + Intergenic
1006179871 6:32148430-32148452 CGGGGCCGCCGAGGGGAGCGGGG + Exonic
1006472743 6:34237545-34237567 CGGGCGCCCTGCGGGGGGCGGGG + Intronic
1006606262 6:35259771-35259793 TGGGGCCGGCGCTGGTGGCGGGG + Exonic
1006641081 6:35490219-35490241 CAGTGCTCCCGCGGGGGGCGGGG - Intronic
1006834021 6:36986062-36986084 CGGAGCGGCGGCGGGGGTCGAGG - Exonic
1006860693 6:37170096-37170118 CGGGGAGGGCGCGGCGGGCGGGG - Intergenic
1007371382 6:41428522-41428544 CGGGGCCGCCGCACCCGGCGCGG - Intergenic
1007378209 6:41470525-41470547 CTGGGCCAGCGCGGGGGCCGGGG + Intergenic
1007431512 6:41779902-41779924 CGCGGCCGCGGGGCGGGGCGGGG - Intronic
1007591158 6:43021678-43021700 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1007665267 6:43509869-43509891 CGGGGCCCCGGCAGGGGTCGCGG + Exonic
1007673480 6:43575953-43575975 CCGGGCCGCGGCGGGCGGCGGGG + Exonic
1007701769 6:43770112-43770134 CCGGCCCGCCCCGGGGGGCGGGG - Intergenic
1008378671 6:50819827-50819849 CGAGGCGGCCGAGGCGGGCGAGG + Intronic
1008883619 6:56408717-56408739 AGGGGCCGGGGCGGGGGGGGGGG - Intergenic
1010703299 6:79077760-79077782 CGGGGCCGCGGCCCGGGGCGCGG - Intronic
1011128943 6:84034492-84034514 CGGGGCGGGCGGGGGGAGCGGGG - Intronic
1011734442 6:90297036-90297058 GGGGGCTGGGGCGGGGGGCGGGG + Intergenic
1013006634 6:106080401-106080423 GGGGGCTGCGGTGGGGGGCGTGG - Intergenic
1013155730 6:107490043-107490065 GGGGGCCGGCGCGGGAGGAGGGG - Exonic
1013372671 6:109483549-109483571 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1014098172 6:117482568-117482590 AGGGGCCGACGTGCGGGGCGGGG + Intronic
1015149101 6:130019300-130019322 GGGGGCGCCGGCGGGGGGCGCGG + Intronic
1015366313 6:132401363-132401385 CGGGACGGCGGCGGGGGGCTCGG - Exonic
1015965369 6:138692373-138692395 CTGGGTCGGCGCGGGGGCCGCGG - Intronic
1016010790 6:139135624-139135646 TGCGGCCGCCGCGGGGGCTGCGG + Exonic
1016982316 6:149864388-149864410 CGGGGCCGCGCGGGGGGGCGGGG - Intergenic
1017103217 6:150866118-150866140 CGGGACCGCCGTGGGGAGCGGGG + Intronic
1017696682 6:157022149-157022171 CGGGGCCGCGGAAGGGGGCGAGG + Intronic
1017793638 6:157823070-157823092 CGGGGCGGCGGCGCGGCGCGGGG + Intronic
1017793780 6:157823514-157823536 CGGGGCCGCGGGGAGGGTCGGGG + Intronic
1017877646 6:158537218-158537240 CGGGGGCGGCGAGGCGGGCGCGG - Intronic
1017920733 6:158869860-158869882 CGGGGCCGGCGCGACCGGCGGGG + Intergenic
1018046371 6:159969443-159969465 AGCGGCCGGCGTGGGGGGCGGGG + Intronic
1018613057 6:165662159-165662181 CGGGGCGGCGGCGGCGGCCGGGG + Intronic
1018613213 6:165662679-165662701 CGCGGCCGGCGGGGGGAGCGCGG - Intronic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1018755967 6:166850000-166850022 CGGGGCCTCCGCCAGGGACGTGG + Intronic
1019345993 7:531180-531202 AGGGGCAGGGGCGGGGGGCGGGG + Intergenic
1019421802 7:954275-954297 CGCGGACGCCGCGGGGGTGGCGG - Intronic
1019433928 7:1012203-1012225 AGGGGCCGCCGCGGTGGCCGAGG + Intronic
1019434941 7:1017735-1017757 AGGGGCAGCCGCGGACGGCGGGG + Intronic
1019473383 7:1232935-1232957 CGGGCCAGCGGCGGGAGGCGCGG - Exonic
1019475278 7:1241380-1241402 GGGGGCGGCCGGGGTGGGCGTGG + Intergenic
1019530078 7:1498949-1498971 CGGGGGCGCCCCGGGGGGGTGGG - Intronic
1019578024 7:1746811-1746833 CGGGGCCGCGGCCGGGTGAGTGG - Exonic
1019711365 7:2519625-2519647 TGGGGCCGCGGCTGGGGGCTGGG - Intronic
1019942615 7:4303122-4303144 GAGGGCCGCAGCGGGGGGCAGGG - Intergenic
1019989551 7:4682247-4682269 CAGCGGCGGCGCGGGGGGCGGGG - Intergenic
1020125412 7:5530383-5530405 CCGGACCGCCGTGGGGGGCGCGG - Intronic
1020130239 7:5555387-5555409 CGGGCCCGGCGTGGGGGTCGCGG - Intronic
1020137322 7:5594397-5594419 CGGGGCAGACGCGGGAGGAGGGG - Intronic
1020268400 7:6577369-6577391 GAGGGCCGCCGCGGGTTGCGGGG - Intergenic
1020281657 7:6653168-6653190 GGCGGCCGCCGCGGGGCCCGAGG + Exonic
1022101665 7:27172995-27173017 CGCGGCCCACGCGGGGGGAGGGG - Intronic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1022427958 7:30285569-30285591 CGGGGCCGCCGGGGCTGCCGGGG - Exonic
1023638592 7:42237128-42237150 GCGGGCGGCCGCGGGGCGCGCGG + Intronic
1024216700 7:47254558-47254580 CGGGCTCGCCGGGCGGGGCGGGG - Intergenic
1026010076 7:66629296-66629318 CGGGGCCGGGGTTGGGGGCGGGG + Intronic
1026772860 7:73213200-73213222 TGGGGCTCCCGCGGGGGGTGGGG + Intergenic
1027001602 7:74658091-74658113 CGAGGCGGGGGCGGGGGGCGCGG - Intronic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1028382228 7:90212021-90212043 CGTGGAGGGCGCGGGGGGCGCGG + Exonic
1028417468 7:90595949-90595971 GGGGGCGGCCGGGAGGGGCGCGG + Intronic
1028621437 7:92833346-92833368 CGGCGCCGCTGGGGCGGGCGGGG + Exonic
1028796403 7:94908112-94908134 CGGGAGCGCCGCGGGCGGGGAGG - Intronic
1028841559 7:95434811-95434833 CGGGGTGGCCGCGTGGTGCGGGG - Intronic
1028982440 7:96981569-96981591 AGGGGCTGGGGCGGGGGGCGGGG - Intergenic
1028987866 7:97021949-97021971 CGGGGTGGGGGCGGGGGGCGCGG + Intronic
1029110513 7:98211248-98211270 CGGGGCGGAAGCTGGGGGCGGGG + Intergenic
1029123213 7:98281763-98281785 CCGGGCCGGAGCGGCGGGCGCGG + Exonic
1029264311 7:99326143-99326165 CGGGGCCTCCTGAGGGGGCGGGG + Intronic
1029495971 7:100895664-100895686 CGGGGCAGCGGAGGGCGGCGCGG + Intronic
1029535277 7:101154337-101154359 CGCCGACGCCGCGGGGAGCGCGG - Intergenic
1029640615 7:101816963-101816985 CGCGGCGGCCGCGAGGTGCGCGG - Intronic
1029708491 7:102287370-102287392 CGGGGCCCTAGCAGGGGGCGGGG - Intronic
1029715066 7:102321308-102321330 CGCGGGCGCGGCAGGGGGCGTGG - Exonic
1030115255 7:106058050-106058072 CTGGGACGGCGCAGGGGGCGCGG + Intergenic
1031025246 7:116672407-116672429 TCGGGGCGCCGCGGGCGGCGAGG - Exonic
1031043572 7:116862983-116863005 CGGGGCCTCCGCCGGGGCCGGGG + Intronic
1031833917 7:126659030-126659052 TGGGGGCGGGGCGGGGGGCGGGG - Intronic
1031991385 7:128201367-128201389 CGGGCCCACCGGGGTGGGCGTGG + Intergenic
1032020653 7:128405701-128405723 CAGGGCCGGCCCGGGGGTCGCGG + Intronic
1032068796 7:128791508-128791530 CGGAGCCGGCGCGGGAGCCGCGG + Intronic
1032298830 7:130668472-130668494 CCGGGCAGCCGCGAGGGGAGGGG + Intronic
1033220504 7:139523980-139524002 GGGGGCGGGCGCGGGGCGCGCGG - Exonic
1033227390 7:139572771-139572793 CGGGGCAGGGGCGGGGGGGGGGG - Exonic
1033253178 7:139777775-139777797 CGTGGCCGGCGCCGGGGGAGGGG + Intronic
1033253203 7:139777837-139777859 CGGGCCCGGCGCGGGGGGCTCGG + Intronic
1033654153 7:143362149-143362171 CGGGGCTGGCGCGGAGGCCGAGG + Intronic
1033662060 7:143408881-143408903 CCGGGCGGGGGCGGGGGGCGGGG + Exonic
1034262304 7:149764732-149764754 CGGCGCCACCTCGGGGGGAGCGG + Exonic
1034349645 7:150407638-150407660 CGGGTCCCCTGCGGGGGACGGGG + Intronic
1034414717 7:150958392-150958414 CGCGGGCGCCCCGGGGGCCGTGG - Exonic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034522628 7:151632327-151632349 CGCCGCCGCCGCAGGTGGCGCGG + Intronic
1034560621 7:151877322-151877344 CCGCGGCGCGGCGGGGGGCGAGG - Intergenic
1035167456 7:157000075-157000097 CGGGGGCGGAGCGGGGCGCGGGG + Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035203118 7:157279293-157279315 CGGGGACGCGGGAGGGGGCGTGG + Intergenic
1035266827 7:157693729-157693751 CGAGGTCGCCGCGGGCGGGGAGG - Intronic
1035431830 7:158828814-158828836 CGGGGCCGGGGGGCGGGGCGGGG + Intronic
1035437518 7:158870170-158870192 AGGGGCCGCAGCGGTGGGTGGGG + Intronic
1035717070 8:1763400-1763422 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717079 8:1763417-1763439 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717088 8:1763434-1763456 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717097 8:1763451-1763473 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717106 8:1763468-1763490 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717115 8:1763485-1763507 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717124 8:1763502-1763524 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717133 8:1763519-1763541 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717142 8:1763536-1763558 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717151 8:1763553-1763575 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717160 8:1763570-1763592 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717169 8:1763587-1763609 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717178 8:1763604-1763626 GGGGCGCGGCGCGGGGGGCGGGG - Intronic
1035717187 8:1763623-1763645 GAGGGGCGCGGCGGGGGGCGGGG - Intronic
1036708047 8:11059641-11059663 CGGGACAGGTGCGGGGGGCGCGG + Intronic
1036733305 8:11284779-11284801 CGGGGCTGGCCCGTGGGGCGGGG - Exonic
1037305148 8:17497030-17497052 CGGGGCGGGGGCGGGGCGCGGGG - Intergenic
1037313148 8:17577199-17577221 CGCGGCGGCTGCGCGGGGCGGGG - Exonic
1037799348 8:22024142-22024164 AGGCGCCGCGGCAGGGGGCGGGG - Exonic
1037807542 8:22066915-22066937 CGGGGCCGCCGAGGGCGGGTGGG + Intronic
1037896614 8:22660608-22660630 TGGGGCAGGGGCGGGGGGCGCGG + Intronic
1038319477 8:26514096-26514118 CGCTGTAGCCGCGGGGGGCGTGG + Intergenic
1038450021 8:27633910-27633932 CGGGGCCCCAGCGGGAAGCGCGG + Intronic
1038644452 8:29350799-29350821 GGGGGACAGCGCGGGGGGCGGGG - Intergenic
1038828458 8:31032881-31032903 CGGGCCCGGCGTGGGGGTCGCGG - Exonic
1038883509 8:31639666-31639688 CGGCGGCGGCGCGGGGGGTGGGG + Intronic
1039518457 8:38152089-38152111 CGGGGGGGCGGGGGGGGGCGGGG + Intergenic
1039595600 8:38787654-38787676 CGGGGCCGCCGGCGAGGACGAGG + Exonic
1039903153 8:41767268-41767290 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1039936722 8:42052021-42052043 CGGAACAGCCGCGGGGGGAGGGG + Intergenic
1040052806 8:43033049-43033071 CGGGGCGGCTGGGGGGGGTGGGG + Intronic
1040423368 8:47260834-47260856 CGGGGCTTCGGCGGGGGGCAGGG - Exonic
1041271538 8:56113840-56113862 CGCGGCAGCCGCGGGGCCCGAGG + Exonic
1041690209 8:60679816-60679838 GCGGGGCGCCGCGTGGGGCGGGG + Intronic
1042253002 8:66775162-66775184 GGGGCCTGCCGCAGGGGGCGGGG + Exonic
1042591771 8:70403660-70403682 CGGGGCCGCGAGGGCGGGCGGGG - Intronic
1042695193 8:71547759-71547781 CGGGGCGGCCGAGCGGGGCGGGG + Intronic
1043388147 8:79768004-79768026 AGGGGCGGGCGCGGAGGGCGGGG - Intergenic
1043527450 8:81112083-81112105 CGGAGCAGCCGCGCGGGGAGCGG + Intergenic
1044335977 8:90985236-90985258 GGTGGCGGCGGCGGGGGGCGAGG + Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045098846 8:98825721-98825743 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098858 8:98825741-98825763 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098870 8:98825761-98825783 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098882 8:98825781-98825803 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098894 8:98825801-98825823 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098906 8:98825821-98825843 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098918 8:98825841-98825863 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045432048 8:102123810-102123832 CGGGGCCGGGGCCGGGGGCCGGG - Intronic
1045488660 8:102654282-102654304 CGGGCCCGCGGGGAGGGGCGGGG + Intronic
1045509964 8:102806551-102806573 CGCGGCCTCCGGGGGAGGCGGGG - Intergenic
1045663937 8:104466555-104466577 CAGGGCCGCCTCGCGCGGCGCGG - Intronic
1045847886 8:106658324-106658346 GGTGGCGGCCGCCGGGGGCGAGG + Intronic
1047259228 8:123241166-123241188 CCGGGGCCCCGCGGAGGGCGAGG + Intronic
1047393721 8:124475031-124475053 CGGGGCCGCGGCCGGGGGCGGGG - Exonic
1049109712 8:140635403-140635425 CGGGCCCGGCGCGGGCGGCAGGG - Intronic
1049194679 8:141308605-141308627 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049420175 8:142512957-142512979 TGGGACAGCAGCGGGGGGCGGGG + Intronic
1049452594 8:142670097-142670119 CTGGGTGGCCGCGGAGGGCGTGG + Intronic
1049532249 8:143160357-143160379 CGGGGGCCGCGCGGGGGGCGGGG + Intronic
1049552448 8:143266917-143266939 TGGGGCCCCCGCGAGGGGAGCGG + Intronic
1049620915 8:143597962-143597984 TGGGGCGGGCGCGGGGGGCCCGG - Exonic
1049673165 8:143878537-143878559 CGGGGCCCCGACGCGGGGCGGGG + Intergenic
1049684746 8:143934786-143934808 TGGGCCTGCCGTGGGGGGCGGGG - Intronic
1049689857 8:143953688-143953710 CGGGCCCGAGCCGGGGGGCGCGG - Intronic
1049752537 8:144291921-144291943 CAGGGCCGCGGCGGACGGCGCGG + Intronic
1050094243 9:2047304-2047326 CTGCGCGGCTGCGGGGGGCGCGG - Exonic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1051774517 9:20620550-20620572 CGAGCGCGGCGCGGGGGGCGGGG + Intronic
1052740095 9:32384597-32384619 CGGGGCCGCCGCGCGATGGGCGG - Intronic
1052903793 9:33817223-33817245 CGGGGGCTGCGCGGGGGGAGGGG - Intergenic
1053072932 9:35111617-35111639 CGTGGCCGCCGCGGCGCGGGTGG - Intronic
1053163489 9:35829322-35829344 CGGGCCCGGGGCGGGGGCCGGGG - Intronic
1053198363 9:36136739-36136761 CAGCGCAGCCGCGGGGAGCGAGG + Exonic
1053306187 9:36986254-36986276 CCTGGCCGCCGCGGGCCGCGCGG + Intronic
1053306208 9:36986344-36986366 CGCGGCCGCGGCGGGGCCCGGGG - Intronic
1054489434 9:65762638-65762660 GGGGGCCGCGGCGGTGGGGGGGG - Intergenic
1054798636 9:69325418-69325440 CGCGGCCGCAGCGGGGGCAGCGG - Intronic
1055030642 9:71768981-71769003 CGGGGCCGGCGGGAGGGGCCGGG - Intronic
1055611774 9:78031576-78031598 CGGCGGCGGCTCGGGGGGCGAGG - Intergenic
1055785201 9:79863729-79863751 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1056475428 9:86947337-86947359 CGGGGTTGCCGCGGGCGGAGGGG - Intergenic
1056643407 9:88388988-88389010 CCGGGCCGGCGACGGGGGCGGGG + Intronic
1056643416 9:88389000-88389022 CGGGGGCGGGGCGGGGGGAGGGG + Intronic
1056799497 9:89681410-89681432 CGGGGGGGGCGGGGGGGGCGGGG - Intergenic
1057061025 9:92003951-92003973 CGGGCCCCTGGCGGGGGGCGCGG + Intergenic
1057259665 9:93576672-93576694 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1057259745 9:93576935-93576957 CGGGCGCGCAGCCGGGGGCGCGG - Intronic
1057311508 9:93946063-93946085 CGGAGCTGCCGCGGGGGCTGGGG + Intergenic
1057313510 9:93955417-93955439 GGGGGCGGCGGCGCGGGGCGGGG - Intergenic
1057489237 9:95508752-95508774 AGGGGTCGCGGCGCGGGGCGGGG - Intronic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057605458 9:96495397-96495419 CTGGGCAGGGGCGGGGGGCGGGG - Intronic
1057801273 9:98192682-98192704 CGGGGCCGGAGGGCGGGGCGGGG + Intergenic
1057881597 9:98796524-98796546 CGGAGCCGACGCGGCCGGCGGGG - Exonic
1058439084 9:104991216-104991238 CGGGGCCGGCGCTGGGGCGGGGG - Intergenic
1059123368 9:111661821-111661843 CGAGGCCTCGGCGGGGCGCGGGG + Intronic
1059176799 9:112175340-112175362 CGGCGCCGCCGAGGGAAGCGGGG + Intronic
1059208253 9:112486782-112486804 CGGGGCCGGCGAGCGGGGCGGGG - Intronic
1059375136 9:113875900-113875922 GGGAGCGGGCGCGGGGGGCGCGG + Intergenic
1059451328 9:114372953-114372975 TGGGGACGCAGCGGGGGGGGGGG + Intronic
1059633912 9:116154282-116154304 CGGGCCGGCGGCGGGGCGCGGGG - Exonic
1060106720 9:120877237-120877259 CGGGGGCGCCGCGGGGAGGAGGG + Exonic
1060192047 9:121599543-121599565 CGGCGGCGCCGGGGGAGGCGCGG + Intronic
1060208984 9:121699093-121699115 CGGGGGCGACGTGGCGGGCGGGG + Intronic
1060700591 9:125746908-125746930 CGGGCGGGCCGCGGGGAGCGAGG - Intergenic
1060856030 9:126915260-126915282 AGGCGCGGGCGCGGGGGGCGGGG + Intronic
1061061006 9:128250556-128250578 CGTTGGCGCCGCTGGGGGCGGGG + Intronic
1061128314 9:128690079-128690101 CGGGGGCGCCGCCGCGGGCCGGG - Intronic
1061208348 9:129177063-129177085 CGGGGCGCCCCCGGGGGGCTCGG + Exonic
1061208449 9:129177405-129177427 AGGGGCGGCCCCTGGGGGCGCGG + Exonic
1061208503 9:129177602-129177624 CGGAGCGCCCGCGGGCGGCGCGG - Exonic
1061248416 9:129413375-129413397 GGGGGCCGGGGCGGGGGGCAGGG - Intergenic
1061275895 9:129569211-129569233 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061275899 9:129569217-129569239 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061293708 9:129666157-129666179 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061293712 9:129666163-129666185 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061450196 9:130663555-130663577 CGGGGCCGCAGCGGCCGTCGGGG - Intergenic
1061540780 9:131277100-131277122 CGGGGCGGGCGCGGGGGGCGGGG - Intergenic
1061559649 9:131394270-131394292 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061608945 9:131733354-131733376 CGGGGCGGGGGCGGGGGGGGGGG + Intronic
1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG + Intronic
1061610030 9:131739997-131740019 CGGAGCGGCGGCGGCGGGCGCGG - Intronic
1061623003 9:131823940-131823962 TGGGGCCGCCGCGGAGAGCCCGG + Intergenic
1061710880 9:132486945-132486967 CCGGGCTGCCCCGGGGAGCGGGG + Intronic
1061975706 9:134067347-134067369 CGCGGCCGGGGCGGGGGGCAAGG - Intronic
1061975793 9:134067591-134067613 CCGGGCTGGCGCGGGGCGCGCGG + Intronic
1062320922 9:135990246-135990268 CAGGCCCACAGCGGGGGGCGGGG - Intergenic
1062364731 9:136203220-136203242 CGGGGCCGCGGGGCGGGGCGGGG + Intronic
1062389197 9:136327399-136327421 CGGGGCGGACGCGGGGGGAGGGG - Intergenic
1062389344 9:136327775-136327797 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1062414229 9:136439705-136439727 CGGGGACGCCGCTCGGGGAGAGG + Exonic
1062414275 9:136439861-136439883 CGGGGCCGGGGCGCGGGGCGGGG - Intergenic
1062461868 9:136665706-136665728 CGGGGCCGCCAGGTGGGGCGGGG + Intronic
1062467293 9:136686933-136686955 CGGGGCCAGGGCGGGGGGTGGGG + Intronic
1062467359 9:136687145-136687167 GGGGGCCGCCGGGAGGGGCCGGG - Intronic
1062526050 9:136978516-136978538 CGGGGCCACCTCCCGGGGCGGGG + Intronic
1062621396 9:137423871-137423893 CGAGGCCGCGCTGGGGGGCGCGG + Intronic
1062638239 9:137502692-137502714 CGGGGGGGACGCGGGGGACGCGG + Intronic
1062676750 9:137750750-137750772 CGTGGCTGCCGGAGGGGGCGCGG + Intronic
1202780001 9_KI270717v1_random:24913-24935 CGCGGCGGCGGCGGGTGGCGGGG + Intergenic
1203471481 Un_GL000220v1:116888-116910 CGGGTCCGCCCCCGGGGCCGCGG + Intergenic
1203479302 Un_GL000220v1:160860-160882 CGGGTCCGCCCCCGGGGCCGCGG + Intergenic
1185469360 X:373502-373524 TCGGGCAGCCGCGGGGCGCGCGG + Intronic
1185482966 X:461208-461230 CGGGGCGGCAGCCGGGGCCGGGG - Intergenic
1185621490 X:1453417-1453439 CGGGGCGAGCGCCGGGGGCGGGG - Intronic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1186464490 X:9774410-9774432 CAGGGCCGCCTGGTGGGGCGAGG + Intronic
1186466239 X:9786354-9786376 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1186466243 X:9786360-9786382 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1187225886 X:17375266-17375288 CGGAGCGGCCGAGGGGCGCGCGG + Intergenic
1187332653 X:18354728-18354750 CGGGCCGGCCGCGCGGGGGGCGG - Intergenic
1187363689 X:18649972-18649994 CGGGGCGGCGGCGGCGGGTGGGG - Intronic
1187826117 X:23334552-23334574 CGGGGAGGCCGCGGGGGGTGGGG + Exonic
1188003512 X:25002621-25002643 GTCGGTCGCCGCGGGGGGCGCGG - Intergenic
1188005497 X:25013547-25013569 AGGGGCCGCCGCGGCAGCCGCGG - Exonic
1189331361 X:40146683-40146705 GGGGGCGGGCGCGGCGGGCGGGG - Intronic
1190024670 X:46912547-46912569 GGCGGCCCCGGCGGGGGGCGGGG + Exonic
1190337222 X:49269910-49269932 CGCGGCCGGCGAGGGGGGCGCGG - Exonic
1190344231 X:49322459-49322481 TGGGGCCTCCGGCGGGGGCGAGG + Intronic
1190346419 X:49341569-49341591 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190347670 X:49532598-49532620 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190348771 X:49542154-49542176 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190349871 X:49551710-49551732 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190350976 X:49561263-49561285 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190352077 X:49570821-49570843 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190353178 X:49580370-49580392 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190354279 X:49589917-49589939 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190355381 X:49599441-49599463 TGGGGCCCCCGGCGGGGGCGAGG + Intronic
1190385625 X:49879948-49879970 CGGGGCCGGGGCGGGGGCCGGGG - Exonic
1190783993 X:53625858-53625880 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1192152003 X:68718365-68718387 CGGGGCCGGGGCTGGGGCCGGGG - Exonic
1192584454 X:72308220-72308242 CGGGGCCGGGGCGGGGTGGGGGG - Intergenic
1195269396 X:103215349-103215371 CGGGCCCGCCGCGGGGCCCGGGG - Intronic
1195599207 X:106726915-106726937 TGGGGCCGCCGCCTGGGGCCGGG + Exonic
1195728047 X:107937200-107937222 CAGGGCCGGGGCGCGGGGCGGGG - Intergenic
1196765253 X:119236695-119236717 CGCGGCCGGCGAGGGGGGCTTGG + Intronic
1196854526 X:119970374-119970396 CGGGGGGGGGGCGGGGGGCGGGG + Intergenic
1197754303 X:129983704-129983726 GGGGGCCGCCGGGCCGGGCGCGG + Intronic
1197754434 X:129984102-129984124 CGGGGCGGGCGGGCGGGGCGTGG + Intronic
1197774374 X:130110228-130110250 CGGGGCCCCGGCGTGGGGCTGGG - Intronic
1198158613 X:133985745-133985767 CGGGGGCGCGGCGTGGAGCGCGG + Intronic
1198254830 X:134915363-134915385 CGGGGCCGGAGCCTGGGGCGGGG + Intergenic
1200068809 X:153517898-153517920 GGGCGCCGCCGGGGTGGGCGCGG + Intronic
1200100699 X:153688111-153688133 CCCGGCCGGGGCGGGGGGCGCGG + Exonic
1200209649 X:154341591-154341613 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209653 X:154341597-154341619 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209657 X:154341603-154341625 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200216817 X:154371705-154371727 CAGGGCCCCTGCGGGGGGTGGGG + Intronic
1200221195 X:154390489-154390511 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221199 X:154390495-154390517 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221203 X:154390501-154390523 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221207 X:154390507-154390529 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221211 X:154390513-154390535 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221215 X:154390519-154390541 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221219 X:154390525-154390547 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221223 X:154390531-154390553 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221227 X:154390537-154390559 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200233678 X:154458356-154458378 CGGGGCCGCGGTGGGGCTCGGGG + Exonic
1200239569 X:154486632-154486654 CGGGGCGGCGGCGCGCGGCGGGG - Exonic
1200249879 X:154547170-154547192 CGAGGCCGCCGGGGCAGGCGGGG - Exonic
1200323814 X:155216798-155216820 CGGGGCCGGGACGAGGGGCGAGG + Intronic