ID: 1162036119

View in Genome Browser
Species Human (GRCh38)
Location 19:7940480-7940502
Sequence TCCTGGGGCCATCGTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 11, 3: 22, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162036119_1162036128 -5 Left 1162036119 19:7940480-7940502 CCACACCCACGATGGCCCCAGGA 0: 1
1: 0
2: 11
3: 22
4: 254
Right 1162036128 19:7940498-7940520 CAGGACAGGACTGGAGAGGTAGG 0: 1
1: 0
2: 3
3: 49
4: 505
1162036119_1162036130 13 Left 1162036119 19:7940480-7940502 CCACACCCACGATGGCCCCAGGA 0: 1
1: 0
2: 11
3: 22
4: 254
Right 1162036130 19:7940516-7940538 GTAGGTAGCTGCCTCCAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1162036119_1162036129 10 Left 1162036119 19:7940480-7940502 CCACACCCACGATGGCCCCAGGA 0: 1
1: 0
2: 11
3: 22
4: 254
Right 1162036129 19:7940513-7940535 GAGGTAGGTAGCTGCCTCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 151
1162036119_1162036124 -9 Left 1162036119 19:7940480-7940502 CCACACCCACGATGGCCCCAGGA 0: 1
1: 0
2: 11
3: 22
4: 254
Right 1162036124 19:7940494-7940516 GCCCCAGGACAGGACTGGAGAGG 0: 1
1: 0
2: 4
3: 45
4: 392
1162036119_1162036133 27 Left 1162036119 19:7940480-7940502 CCACACCCACGATGGCCCCAGGA 0: 1
1: 0
2: 11
3: 22
4: 254
Right 1162036133 19:7940530-7940552 CCAAGGAGGCAGCTGAGCTGAGG 0: 1
1: 0
2: 5
3: 79
4: 709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162036119 Original CRISPR TCCTGGGGCCATCGTGGGTG TGG (reversed) Intronic
900126251 1:1070179-1070201 ACCTGGGGCAAGGGTGGGTGTGG + Intergenic
900291849 1:1927065-1927087 GCCTGGGCCGATGGTGGGTGGGG - Intronic
900366537 1:2314077-2314099 GCCTGGGGGGATTGTGGGTGGGG + Intergenic
900493601 1:2965819-2965841 TCCAGGGCCCATCCTGGCTGTGG - Intergenic
900520913 1:3105139-3105161 GCCTGTGGCCATCGTGGGGAGGG - Intronic
901324012 1:8356333-8356355 ACCAGGAGCCATCCTGGGTGAGG - Intronic
901445959 1:9308287-9308309 CCCTGGGCCCATCCTTGGTGGGG + Intronic
901471624 1:9460498-9460520 TCCCAGGGCCTCCGTGGGTGAGG - Intergenic
903333685 1:22611076-22611098 TCCTGGGGGCAACATGGGGGTGG - Intergenic
903686314 1:25134916-25134938 GTCTGGGGACATGGTGGGTGGGG - Intergenic
904464297 1:30698765-30698787 GCCTTGGGCCAGGGTGGGTGAGG - Intergenic
905649410 1:39646456-39646478 CCCTGGGGCTAGCGAGGGTGGGG + Intergenic
906745036 1:48215575-48215597 TCTTGGGGCCAGCATGGGGGTGG - Intergenic
907411710 1:54287985-54288007 TCAGGGGGCCATCGTGTGGGAGG + Intronic
909411259 1:75354571-75354593 CCAGGGGGCCATCGTGAGTGTGG - Intronic
912823196 1:112883644-112883666 GCCCGGAGCCATCCTGGGTGGGG - Intergenic
913118644 1:115719532-115719554 TCCAGGGACCATCTTGGGTCTGG - Intronic
914239929 1:145846499-145846521 GCCTGGGACCATCTTGGGTGTGG + Intronic
916502820 1:165401221-165401243 CCCAGGGGTCATCCTGGGTGGGG + Exonic
916824242 1:168428991-168429013 TGCTGGTGCCATCTTAGGTGGGG - Intergenic
920180874 1:204131128-204131150 TCCTGGGGCCTTCCTGGCTCTGG - Exonic
920367584 1:205456291-205456313 TCGTGGGGCCATGGAGGGAGTGG - Intergenic
921031713 1:211340115-211340137 CCCTGAGGCCATGGAGGGTGGGG + Intronic
921132720 1:212233546-212233568 TCCTGGGGCACTCTTGGCTGAGG + Intergenic
922334968 1:224611652-224611674 TCCTGGCTGCATGGTGGGTGGGG + Intronic
922473548 1:225890796-225890818 TCCTGGGGCCTCCATGGATGGGG + Intronic
922474710 1:225899083-225899105 TCGTGGGGCCTCCATGGGTGGGG - Intronic
923019501 1:230152014-230152036 TCCTGTGGCCATCTTGGTTTTGG + Intronic
923470950 1:234290623-234290645 TCCAGGGCCCATCCAGGGTGGGG - Intronic
924113581 1:240724114-240724136 GCCTGAGGCCATCGGGTGTGTGG - Intergenic
924250052 1:242123651-242123673 GGCTGGGGCCACCGTGTGTGTGG - Intronic
924940513 1:248810191-248810213 TCATGGGGCCATGCTGTGTGAGG - Intergenic
1062833185 10:619648-619670 TCCTGGGGTCTGTGTGGGTGAGG - Intronic
1062933581 10:1368826-1368848 TCCTGGGGCCGGGCTGGGTGAGG + Intronic
1063389821 10:5641944-5641966 TCCAGGGGCCAACGTGAATGCGG - Exonic
1065858375 10:29849260-29849282 GCCTGGGGCCAGTATGGGTGGGG - Intergenic
1067278094 10:44851997-44852019 TCCTGGGCCCATCCTGGGCCCGG - Intergenic
1069069828 10:63981847-63981869 CACTGGGCCCATCGGGGGTGGGG - Intergenic
1069949834 10:72011190-72011212 TCCTGGGGCCATCGTGGTGCTGG - Exonic
1070829420 10:79409505-79409527 CCCTGGGCCCAGCGTGGGTCTGG + Intronic
1071053031 10:81473999-81474021 TCCAGGCGCCAACATGGGTGTGG - Intergenic
1073341116 10:102744990-102745012 TCCTGGTGCCAAGTTGGGTGGGG + Intronic
1075895206 10:125989110-125989132 TCCTGGGGTCACGGTGAGTGAGG + Intronic
1076407341 10:130221585-130221607 TCCTGCAGCCATCGTGTATGGGG - Intergenic
1076769888 10:132657097-132657119 GCATGGGGCCATCCTGGCTGAGG - Intronic
1077240326 11:1507334-1507356 ACCTGGAGCCATCGGCGGTGGGG + Intergenic
1077466840 11:2737394-2737416 TCCAGGGGCCCCCGTGGGTCTGG - Intronic
1077472824 11:2772237-2772259 CCCTGAGGCCAGCGGGGGTGGGG - Intronic
1077600410 11:3570781-3570803 ACCAGGGCCCATCGGGGGTGGGG + Intergenic
1078432519 11:11298679-11298701 CTCAGGGGCCATTGTGGGTGGGG + Intronic
1078514188 11:12008802-12008824 TCCTGGGGCGATCGGGGCTCGGG - Intronic
1078640033 11:13085732-13085754 TCTTGGGGCCAGTGGGGGTGGGG + Intergenic
1079129369 11:17738446-17738468 TTCTGGGGCCAAAGTTGGTGGGG - Intronic
1081812980 11:45923478-45923500 GCATGTGGCCATCGTGTGTGCGG + Exonic
1082644303 11:55702318-55702340 TCCTGGAGCCTTGGTTGGTGGGG - Intergenic
1082834152 11:57639669-57639691 TCCTGGGCCCAAGGTGGGGGAGG + Intergenic
1083051579 11:59781709-59781731 AACTGTGGCCATGGTGGGTGCGG + Intronic
1083357355 11:62076708-62076730 TCCTGGGACCAAGGTGGGAGTGG - Intergenic
1083955861 11:65982442-65982464 CCCCGGGGCAATCGTGGGTTTGG - Intergenic
1084161787 11:67354019-67354041 TCCTGGGGCCAGTGGGGGTTGGG - Intronic
1084169405 11:67393405-67393427 TGCTGGGCCCATGATGGGTGTGG + Intronic
1084256323 11:67945396-67945418 ACCAGGGCCCATCGGGGGTGGGG + Intergenic
1084433957 11:69127224-69127246 TCCTGGGGCTGGCGTGGCTGCGG + Intergenic
1084474221 11:69379650-69379672 TCCTGGGGCCCTACTGTGTGCGG - Intergenic
1085028905 11:73257928-73257950 TCCTGGGGCCAGTGGGGGTGGGG + Intergenic
1085409189 11:76281587-76281609 TGCAGGGGCCATGGTGGGCGAGG + Intergenic
1085463279 11:76707834-76707856 TCCTGGGTCTACCCTGGGTGTGG + Intergenic
1085664566 11:78402563-78402585 TACTGGGGCGATTGGGGGTGGGG - Intronic
1086375425 11:86195209-86195231 TCCTGGGGCAGCGGTGGGTGCGG - Intergenic
1088396475 11:109375421-109375443 TCATGGGGACTGCGTGGGTGTGG + Intergenic
1088469550 11:110178041-110178063 TCTAGAGGCCATGGTGGGTGGGG - Intronic
1088924410 11:114285776-114285798 TCCTGCTGCAATTGTGGGTGGGG - Intronic
1091588686 12:1830298-1830320 TGCTGGCGTCATCATGGGTGTGG + Intronic
1091911214 12:4232073-4232095 TGCCAGGGCCATCCTGGGTGAGG - Intergenic
1092321711 12:7483399-7483421 CGCTGGGGCCATAGTGAGTGTGG - Exonic
1094454380 12:30616066-30616088 CCCTGGGGCAAGGGTGGGTGGGG + Intergenic
1095788871 12:46142930-46142952 TCCTGGGGCAGTGGTGGCTGTGG - Intergenic
1096500605 12:52062083-52062105 CACTGGGCCCAGCGTGGGTGGGG - Intergenic
1097055543 12:56247052-56247074 TCCTGGGCACAGCGTGGGTCTGG + Intronic
1100187996 12:92158277-92158299 TCCTGGGGGCGAGGTGGGTGTGG - Intergenic
1101709427 12:107250898-107250920 TCATGGGGCCATGATGGGGGAGG + Intergenic
1101760282 12:107652616-107652638 TGCTGAGGTCATCGGGGGTGGGG - Intronic
1102035715 12:109769484-109769506 TCCTGGGGCAACCGATGGTGGGG - Exonic
1102047948 12:109841403-109841425 TGCTGAGGCCAGCGTGAGTGTGG - Intergenic
1102199852 12:111049733-111049755 TCCTGGGCCCATCCAGGGTTTGG - Intronic
1103612696 12:122133728-122133750 TGGCGGGGGCATCGTGGGTGAGG - Exonic
1106140580 13:27007445-27007467 GCCTGGAGCCCTCGTGGGGGAGG + Intergenic
1108598056 13:51966731-51966753 AACTGTGGCCATGGTGGGTGCGG - Intronic
1110224022 13:73100974-73100996 AACTGTGGCCATGGTGGGTGCGG + Intergenic
1111107523 13:83666837-83666859 GCCTGAGGCCTTCGTGTGTGGGG - Intergenic
1113607281 13:111618697-111618719 TCCTGAGACCCTCGTGGGAGAGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114549634 14:23525510-23525532 ACCTGAGGCCCTCGGGGGTGGGG - Exonic
1122529458 14:102415627-102415649 GACTGGGGCCAACGTGGGGGTGG + Intronic
1122663308 14:103312155-103312177 TCCTGGGGCTGTGGGGGGTGAGG - Intergenic
1122902010 14:104785908-104785930 TCCTGGGGCTCTACTGGGTGGGG + Intronic
1202918332 14_KI270723v1_random:5867-5889 TCCTGCGGCCCCCGTGGCTGGGG + Intergenic
1202926297 14_KI270724v1_random:28710-28732 TCCTGCGGCCCCCGTGGCTGGGG - Intergenic
1124045795 15:26148756-26148778 TCCTGGGGACCAGGTGGGTGGGG + Intergenic
1124516618 15:30371991-30372013 TCCTGGAGCCACCGTGGGCTCGG + Intronic
1124726301 15:32158740-32158762 TCCTGGAGCCACCGTGGGCTCGG - Intronic
1125276920 15:38003488-38003510 TCCTTGGCCCATGGTGGGTGTGG + Intergenic
1128146691 15:65335912-65335934 TCCCCAGGCCACCGTGGGTGAGG - Exonic
1128244546 15:66124182-66124204 TCCTGGGGCCAACCTGGGGTCGG - Intronic
1128381909 15:67119437-67119459 TGCTGGGGCCATGGCGGGGGTGG + Intronic
1129890713 15:79070020-79070042 TCATGGGGACATCCTGGGTTGGG - Intronic
1129914663 15:79258325-79258347 GCCTTGGGCCAGCCTGGGTGTGG - Intergenic
1130174401 15:81553299-81553321 CACTGGGGCCATCGACGGTGAGG - Intergenic
1132021110 15:98363485-98363507 TCCTGAGACAATCTTGGGTGAGG + Intergenic
1132698363 16:1211876-1211898 TCGGGGGGCCATCCTGGGTAGGG + Intronic
1132827285 16:1911675-1911697 GCCTGGGGCACGCGTGGGTGTGG + Exonic
1132844370 16:1993107-1993129 CCCTGGGGCCTGCGTTGGTGGGG - Exonic
1132973987 16:2702500-2702522 GCCTGGGGCAGTCTTGGGTGGGG + Intronic
1133042223 16:3066798-3066820 ACCTGGGACCATAGTGGTTGTGG + Intronic
1133204319 16:4223931-4223953 CCCTAGGCCCATCATGGGTGGGG + Intronic
1136230408 16:28882564-28882586 CCCTGGGGACATCGTGGAGGTGG + Exonic
1138351970 16:56350805-56350827 TCCTGGGCCCATCCTGGGTAGGG - Intronic
1138373911 16:56549350-56549372 GCCTGGGGCTATGGTGTGTGGGG - Intergenic
1141578523 16:84981506-84981528 TCCTGGGCACATCCTGTGTGGGG - Intronic
1141805266 16:86337633-86337655 TCCTGGGACAAACGTGTGTGGGG - Intergenic
1142153133 16:88521447-88521469 GCCTCAGGCCATCGTGGGTCAGG + Intronic
1142201846 16:88764878-88764900 TGCTGGGGCCATGGTTGGAGTGG - Intronic
1142231868 16:88903736-88903758 CCCTTGGGCCAGCGTGGGTTGGG + Intronic
1142262790 16:89050547-89050569 CCCTGGGGCCCTCGAGGGAGGGG + Intergenic
1142322806 16:89395311-89395333 TCCTGGGAGCAGCGTCGGTGTGG + Intronic
1142327465 16:89425498-89425520 TCCTGGCACCATTGTGGGAGTGG - Intronic
1142403771 16:89874357-89874379 GCCTGGGGCCACCGTGGGGGTGG + Intronic
1143121127 17:4607551-4607573 TCCTGGGGGCATCCTGGCTGGGG - Exonic
1144703597 17:17353579-17353601 TCTTGGGGCCAAGGAGGGTGAGG + Intergenic
1144832852 17:18141185-18141207 TCCTGGGGCCATGGGGAGTTGGG - Intronic
1147316769 17:39624839-39624861 TCCTGGGGCCAAGAAGGGTGGGG - Intergenic
1148699205 17:49577837-49577859 TCCCATGGCCATCCTGGGTGTGG + Intronic
1151568954 17:74916481-74916503 TCCTGGGGCCCCCATGGCTGGGG - Exonic
1152318105 17:79592709-79592731 TGCTGGGGCCACCTTGGGAGTGG - Intergenic
1152691610 17:81720662-81720684 TTCTGGAGCCATTGTGGGTGAGG + Exonic
1152855680 17:82663671-82663693 TCCTGGTGCCAGCGGGGCTGTGG - Intronic
1159958192 18:74534538-74534560 TCCGGGGGACAACGTGGGTCAGG + Exonic
1160419213 18:78732626-78732648 TTCTGGGGCCATGGGGCGTGTGG - Intergenic
1160430009 18:78804596-78804618 TCCTGGGGCCAGCGTGGAGGAGG - Intergenic
1160901839 19:1432711-1432733 TCCTGGGGCCAGCGGGGACGCGG - Intronic
1162036119 19:7940480-7940502 TCCTGGGGCCATCGTGGGTGTGG - Intronic
1162804364 19:13129368-13129390 TCCTGGGGCTAGCGTGGGTGAGG + Intronic
1163513057 19:17747652-17747674 TCCTGGCGCCGTCGCGGGGGTGG + Intergenic
1163703776 19:18800607-18800629 TCCTGGTGGCACCGTGGATGTGG - Intergenic
1164424475 19:28128709-28128731 TCCTGGGGCCAGGGTGGTGGTGG - Intergenic
1164888485 19:31803392-31803414 GCCTGGGGCGATGGTGGGTCTGG - Intergenic
1165914936 19:39252752-39252774 TCCTGGGGCCAGCATGGGTGAGG + Intergenic
1166267028 19:41690689-41690711 TCCAGGGACCCTCGGGGGTGGGG + Intronic
1167269925 19:48500935-48500957 TGCTGGGACCATCCTGGGTGGGG + Intronic
1167524142 19:49973166-49973188 CCTTGGGGCCATCGAGGGGGAGG - Intergenic
1167707461 19:51090120-51090142 TCAAGGGGCCTTGGTGGGTGGGG + Intergenic
1167937978 19:52923014-52923036 TCCAGGGGCCGACGAGGGTGAGG + Intergenic
1167981895 19:53282587-53282609 ACCTGGGGCCATGGTGGGGGTGG + Intergenic
1167984198 19:53301075-53301097 ACCTGGGGCCATGGTGGGGGTGG - Intergenic
1168528570 19:57107082-57107104 TCCTGGTGCCACCCTGGGAGTGG - Intergenic
928092993 2:28387382-28387404 TCCTAGGGGCCTCGTGGGGGTGG + Intergenic
930001370 2:46863899-46863921 TCCTGGGGCCATGGTGGAGGAGG - Intergenic
931261601 2:60624712-60624734 TCCAGAGCCCATGGTGGGTGTGG + Intergenic
932539582 2:72638570-72638592 TCCTGGGGCTATTGTGGGCCAGG - Intronic
932700157 2:73986081-73986103 GCCTGGGTCCAGGGTGGGTGAGG + Intergenic
934475080 2:94588288-94588310 TCCTGGGGCCAGCATGGGTGGGG + Intergenic
935232192 2:101108724-101108746 TCCTGGAGTAATGGTGGGTGGGG - Intronic
936257903 2:110933492-110933514 TGCTGGGGCCCTCCTGGATGAGG + Exonic
936462659 2:112724015-112724037 TGCTGGGGGGATGGTGGGTGAGG + Intronic
936869070 2:117110735-117110757 CCCTGGAGCCATCGTGAGTTAGG + Intergenic
937257424 2:120565166-120565188 TCCTGGGGCCGGCGGGGTTGGGG + Intergenic
938378994 2:130826093-130826115 TCCTGGGGGCTTCCAGGGTGCGG - Intergenic
946622068 2:221572100-221572122 GCGAGGGGCCATCGCGGGTGAGG - Intronic
948685982 2:239670027-239670049 ACCTGTGGCCACCGTGGGAGAGG + Intergenic
1170367667 20:15615645-15615667 CCCTTGGACCATGGTGGGTGTGG - Intronic
1171782300 20:29430529-29430551 TCCTGCGGCCCCCGTGGCTGGGG + Intergenic
1173927560 20:46792164-46792186 TCCTGAGGCCATGGTGGGGCAGG + Intergenic
1173978034 20:47202054-47202076 GCCTAGGGCCAGCGTGGTTGTGG + Intergenic
1175260893 20:57673433-57673455 TCTTGCTGCCATCGTTGGTGTGG + Intronic
1175706628 20:61183443-61183465 TCCTGGGGTCAGGGTGTGTGAGG - Intergenic
1175729207 20:61342003-61342025 TGCTTAGGCCATAGTGGGTGAGG + Intronic
1175876468 20:62232520-62232542 TCCTGCAGCCATCCTGGGCGAGG - Intronic
1176084671 20:63290526-63290548 TCCTGGAGCCACGGTGGGGGTGG - Intergenic
1176121830 20:63457571-63457593 TCCTGGGGCCATGGTCAGTGTGG - Intronic
1179613325 21:42566179-42566201 TCCTGGGGCCTTGGTGGGGCTGG + Intronic
1180065657 21:45410955-45410977 TCCTGAGGCCATAGGGTGTGTGG - Intronic
1181236487 22:21450501-21450523 TCCTGCGGCCATCCTGAGTTGGG + Exonic
1181520912 22:23448727-23448749 TCCTGGGCCCGGCCTGGGTGTGG - Intergenic
1181520929 22:23448760-23448782 TCCTGGGCCCCGCCTGGGTGTGG - Intergenic
1181670614 22:24424048-24424070 GCGTGGGGCCGTCGGGGGTGCGG + Intronic
1182321088 22:29479058-29479080 TCCTGGGGCAGTCGGGGGTCAGG + Intergenic
1183178095 22:36239013-36239035 CCCTGGGGCCAGCCTGGGTGTGG + Intronic
1183180000 22:36253589-36253611 CCCTGGGGCCAGCCTTGGTGTGG - Intronic
1183513579 22:38250158-38250180 TCCCTGGGCCTTCCTGGGTGCGG + Intronic
1183671577 22:39276034-39276056 ACCTGGGGCCAGGGTGGGTGCGG - Intergenic
1183947950 22:41337566-41337588 GCCTGGGGCTACCGTGGGAGAGG + Intronic
1184104182 22:42357941-42357963 TCCTGGGGCCAGTATCGGTGGGG + Intergenic
1185071308 22:48658227-48658249 TCCTGAGGGCAGGGTGGGTGGGG + Intronic
1185131734 22:49043308-49043330 TCCAGAGGCCAGCGTGGCTGAGG + Intergenic
1185169025 22:49281464-49281486 TCCTGGGGCCAGAGTGGGCTTGG + Intergenic
1185182798 22:49372862-49372884 TCCTGGGGACAGAGAGGGTGGGG - Intergenic
1185194791 22:49462234-49462256 TCTTGGGGCCTTCCTGAGTGTGG - Intronic
1185241212 22:49748734-49748756 TCCTGGGCCTATGGTAGGTGGGG - Intergenic
1185397448 22:50600361-50600383 TCCTGGGGGGATCCTGGGCGCGG + Intronic
950055805 3:10023520-10023542 TCCTGGGGACAAGGTGGGTACGG - Intergenic
950712395 3:14821641-14821663 TCCAGGAGGCAGCGTGGGTGTGG + Intronic
952326285 3:32323169-32323191 TCCTGAGGCCAGCCTGGCTGGGG + Intronic
954293318 3:49661085-49661107 TGCTGGGGCCAGGGTAGGTGGGG - Exonic
954990884 3:54839785-54839807 TCCTGGCTCCATCGTTGATGAGG + Intronic
965606391 3:170501682-170501704 CCCTGGTGCCATCTAGGGTGGGG - Intronic
968548282 4:1209723-1209745 TCCTGGGGCCTTGCTGGGCGGGG + Intergenic
968568997 4:1329589-1329611 TGCTGGGGCCGTCTTGGGAGTGG + Intronic
968954617 4:3711928-3711950 TCCTGGGGCCACCAGGGGCGGGG + Intergenic
970712253 4:18876913-18876935 TCCTGTGGCCATCTTGGTTTTGG + Intergenic
973760005 4:54107026-54107048 CCCTGGGGCCTTCCTGGGTTTGG - Intronic
978777677 4:112519340-112519362 TACTGGGGCCTGCGGGGGTGGGG + Intergenic
985471703 5:50816-50838 TCCTGGCGCCAGGGTAGGTGAGG - Intergenic
985527188 5:412002-412024 TCCCGGGGCCATCACCGGTGAGG - Intronic
988604176 5:32666090-32666112 TCCTGGGGCCATCATGATGGTGG + Intergenic
992838814 5:80667663-80667685 TCCAGGTGCCAGCGTGAGTGAGG + Intronic
997410015 5:133683869-133683891 TGCTGGGGCGAAGGTGGGTGCGG + Intergenic
998402048 5:141853210-141853232 CCCTGGGGCCATGGTGGGATGGG - Exonic
1000293182 5:159890213-159890235 TCCTGGGGCCATCTATGGTCTGG - Intergenic
1000548029 5:162625820-162625842 TCCAGGTGCCATTGGGGGTGGGG - Intergenic
1000857873 5:166421945-166421967 TCATGGGACCATCGTGCATGAGG + Intergenic
1000989997 5:167902073-167902095 TCTTGAGGCCATCTTGGGTTAGG + Intronic
1001494049 5:172175491-172175513 TCCTGGCACCCTGGTGGGTGGGG - Intronic
1001814326 5:174655358-174655380 ACCTGGGGGCATGGTGGGTTTGG - Intergenic
1002213884 5:177614497-177614519 TCCATGGGACATGGTGGGTGGGG - Intergenic
1003123846 6:3339623-3339645 TCTTGTGGCCATCTTGGGTTAGG - Intronic
1003331783 6:5135283-5135305 TCCTGGGGCTGTGGAGGGTGCGG + Intronic
1003331842 6:5135479-5135501 TCCTGGGGCTGTGGAGGGTGCGG + Intronic
1003331858 6:5135535-5135557 TCCTGGGGCTGTGGAGGGTGCGG + Intronic
1004160316 6:13206899-13206921 AGCTGGGGCCATCGTCTGTGTGG - Intronic
1006016533 6:31085726-31085748 TCCTGGGGCCATCGTCCCAGGGG + Intergenic
1007357118 6:41329098-41329120 TCCTGGGGCCAACATTGGTGGGG - Intergenic
1007485006 6:42174891-42174913 TCCAGGCACCATCATGGGTGGGG + Intronic
1010898597 6:81398070-81398092 TCTTGGAGACATCGTGGGTTTGG - Intergenic
1013169800 6:107626590-107626612 TTCAGGGCCCATCATGGGTGAGG - Intronic
1014276873 6:119398187-119398209 TCCTGGGGCCATCAGGGTGGTGG + Intergenic
1016413303 6:143806494-143806516 CCTTGTGGTCATCGTGGGTGGGG + Intronic
1018561256 6:165102835-165102857 GCCTGGAGCCATAGTGGGTGTGG + Intergenic
1018562616 6:165118131-165118153 CCCTGGGGCAATCGTATGTGTGG + Intergenic
1019590284 7:1827421-1827443 TCCTGAGCCCGTCGCGGGTGTGG + Intronic
1019590296 7:1827454-1827476 TCCTGAGCCCGTCGCGGGTGTGG + Intronic
1019594957 7:1854217-1854239 CACCGGGGCCATGGTGGGTGCGG - Intronic
1019769053 7:2871811-2871833 GGCTGGGGCCATGGTGGGAGGGG + Intergenic
1023185832 7:37531841-37531863 TCCATGGGCCAATGTGGGTGAGG + Intergenic
1026941162 7:74288965-74288987 TGTTGGGGCCAGCGTGGGTGGGG - Intergenic
1031687419 7:124748108-124748130 AGCTGGGGCCAATGTGGGTGGGG + Intronic
1031778256 7:125928938-125928960 ACCTGGGCCCGTCGGGGGTGGGG + Intergenic
1034549277 7:151809984-151810006 TCCGTGGACCATGGTGGGTGTGG - Intronic
1035074488 7:156169097-156169119 TCCTGGGGGGACAGTGGGTGGGG + Intergenic
1035074502 7:156169128-156169150 TCCTGGGGGGATAGTGGGTGGGG + Intergenic
1035252281 7:157605243-157605265 TCCAGGTGCCAGCATGGGTGCGG + Intronic
1036222043 8:6929317-6929339 TGCTGGGGGCAGGGTGGGTGGGG - Intergenic
1036256561 8:7211215-7211237 ACCGGGGCCCATCGGGGGTGGGG + Intergenic
1036308611 8:7669800-7669822 ACCGGGGCCCATCGGGGGTGGGG + Intergenic
1036360926 8:8076277-8076299 ACCGGGGCCCATCGAGGGTGGGG - Intergenic
1036427573 8:8659798-8659820 CCCTGGTGCCAGTGTGGGTGGGG - Intergenic
1036890040 8:12590724-12590746 ACCGGGGCCCATCGGGGGTGGGG + Intergenic
1037434177 8:18845545-18845567 TCCAGCGGCCCTCATGGGTGTGG - Intronic
1043542620 8:81280585-81280607 AACTGTGGCCATGGTGGGTGCGG - Exonic
1049446116 8:142632391-142632413 TCCTGGGGCCACCAGGGGAGAGG - Intergenic
1049646765 8:143739088-143739110 TCTTGGTGCCATCCTGGCTGGGG + Intergenic
1049789006 8:144464544-144464566 CCCTGGGGCCAGCGTGGTGGTGG + Exonic
1052854972 9:33401474-33401496 TCCTGGGGCCAGCATGGGTGGGG - Intronic
1053682992 9:40497803-40497825 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1053932974 9:43126117-43126139 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054280722 9:63127125-63127147 TCCTGGGGCCAGCATGGGTGGGG + Intergenic
1054296092 9:63333303-63333325 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054394108 9:64637798-64637820 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054428758 9:65143011-65143033 TCCTGGGGCCAGCATGGGTGGGG - Intergenic
1054501622 9:65878532-65878554 TCCTGGGGCCAGCATGGGTGGGG + Intronic
1057131560 9:92657734-92657756 TGGTGGGGCCACAGTGGGTGTGG - Intronic
1057855778 9:98599752-98599774 TCCTGGTGCCATGCGGGGTGGGG - Intronic
1058247303 9:102643312-102643334 TCCTGTGGCCATCTTGGTTTGGG - Intergenic
1058889136 9:109345797-109345819 GCCTGGTTCCATCGTGGGTCGGG - Intergenic
1060665278 9:125428847-125428869 CCCCTGGGCCACCGTGGGTGAGG - Intergenic
1061271640 9:129547105-129547127 TCCTGGGGCCCTCTGGGGAGAGG - Intergenic
1061865005 9:133487642-133487664 TCCTGGGGTCCCCGTAGGTGGGG + Intergenic
1062043404 9:134414440-134414462 TCTTGGAGCCATCCTGGGGGTGG + Intronic
1062141501 9:134961576-134961598 GCCTGGGGGCACTGTGGGTGAGG - Intergenic
1062306190 9:135908045-135908067 CCCTGGGGACCTCGTGGGTGTGG + Intergenic
1185736763 X:2501243-2501265 TCCTGGGGGCGTCCTGGCTGGGG - Intronic
1185736855 X:2501499-2501521 TCCTGGGGGCGTCCTGGCTGGGG - Intronic
1186462503 X:9759572-9759594 TCCTGGGACCAAGGAGGGTGTGG + Intronic
1192220915 X:69196792-69196814 TCCTGGGGCAATCATGGGTCTGG - Intergenic
1195433768 X:104818517-104818539 TCTCGGGGCCATAGAGGGTGAGG + Intronic
1197648855 X:129043400-129043422 ACCTGGCGTCATCGGGGGTGGGG + Intergenic
1200404850 Y:2799473-2799495 TTGTGGGGCCATAATGGGTGAGG - Intergenic
1201459283 Y:14204632-14204654 TGCTGGGGCCAGTGTGTGTGGGG - Intergenic
1201501100 Y:14643549-14643571 TCCTGGGGCAATCCTGGATCTGG + Intronic