ID: 1162039806

View in Genome Browser
Species Human (GRCh38)
Location 19:7963887-7963909
Sequence GGGATGGGGCCCAGCGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162039806_1162039814 5 Left 1162039806 19:7963887-7963909 CCATGGCCGCTGGGCCCCATCCC 0: 1
1: 0
2: 0
3: 29
4: 324
Right 1162039814 19:7963915-7963937 GCGCAGCCACGAGGTGCTCACGG 0: 1
1: 0
2: 0
3: 7
4: 113
1162039806_1162039811 -4 Left 1162039806 19:7963887-7963909 CCATGGCCGCTGGGCCCCATCCC 0: 1
1: 0
2: 0
3: 29
4: 324
Right 1162039811 19:7963906-7963928 TCCCGCTCTGCGCAGCCACGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1162039806_1162039816 22 Left 1162039806 19:7963887-7963909 CCATGGCCGCTGGGCCCCATCCC 0: 1
1: 0
2: 0
3: 29
4: 324
Right 1162039816 19:7963932-7963954 TCACGGTTGAGACACCTGCATGG 0: 1
1: 0
2: 0
3: 2
4: 72
1162039806_1162039817 23 Left 1162039806 19:7963887-7963909 CCATGGCCGCTGGGCCCCATCCC 0: 1
1: 0
2: 0
3: 29
4: 324
Right 1162039817 19:7963933-7963955 CACGGTTGAGACACCTGCATGGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162039806 Original CRISPR GGGATGGGGCCCAGCGGCCA TGG (reversed) Intronic