ID: 1162041809

View in Genome Browser
Species Human (GRCh38)
Location 19:7975300-7975322
Sequence GAGCTGAGGCTGGCACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162041799_1162041809 11 Left 1162041799 19:7975266-7975288 CCTGCCAAACCATGACCCTGGCG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG 0: 1
1: 0
2: 3
3: 32
4: 271
1162041805_1162041809 -5 Left 1162041805 19:7975282-7975304 CCTGGCGCCAGTGGAGCGGAGCT 0: 1
1: 0
2: 0
3: 3
4: 118
Right 1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG 0: 1
1: 0
2: 3
3: 32
4: 271
1162041804_1162041809 -4 Left 1162041804 19:7975281-7975303 CCCTGGCGCCAGTGGAGCGGAGC 0: 1
1: 0
2: 1
3: 3
4: 91
Right 1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG 0: 1
1: 0
2: 3
3: 32
4: 271
1162041800_1162041809 7 Left 1162041800 19:7975270-7975292 CCAAACCATGACCCTGGCGCCAG 0: 1
1: 0
2: 2
3: 12
4: 138
Right 1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG 0: 1
1: 0
2: 3
3: 32
4: 271
1162041802_1162041809 2 Left 1162041802 19:7975275-7975297 CCATGACCCTGGCGCCAGTGGAG 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG 0: 1
1: 0
2: 3
3: 32
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162041809 Original CRISPR GAGCTGAGGCTGGCACTGAC TGG Intronic
900563752 1:3322425-3322447 GAGCTGGAGCTGGAACTGAGGGG - Intronic
900653997 1:3746102-3746124 GAGCTGAGGCTGAGGCTGACGGG + Intergenic
900959620 1:5910549-5910571 GAGCACAGGCCGGCACTTACGGG + Intronic
901038869 1:6352274-6352296 CAGCTGAGGCTGGGACTCACTGG - Intronic
901067868 1:6502931-6502953 GAGCTGGGGCAGGCACACACGGG + Intronic
901414665 1:9108401-9108423 GGGCTGAGGCTGACCCTTACGGG - Intronic
901738534 1:11327561-11327583 GACCTGAAGCGGGCACTGAGTGG + Intergenic
902398314 1:16144213-16144235 GAGCTGAGGGTGGGGCAGACAGG + Intronic
902469451 1:16638376-16638398 GAGCTCAGGACAGCACTGACTGG - Intergenic
902698534 1:18156179-18156201 GGGCTGGGGCTGGCACTTCCAGG + Intronic
903739047 1:25547680-25547702 ATGCTGAGGCTGGCGCAGACTGG - Intronic
904472421 1:30744254-30744276 GGGCTGTGGCTGACACTCACAGG + Intronic
905204985 1:36338380-36338402 GAGCTGAGAGTGGCACTGGTGGG + Intergenic
905548412 1:38817825-38817847 GGGCTGAGGCAGGCAGGGACCGG + Intergenic
905617240 1:39409382-39409404 GACCTGAGGCTGGCGCGGCCGGG + Intronic
905653904 1:39673620-39673642 GAGCTGGGGCTGGGACAGCCAGG - Intergenic
906244412 1:44262944-44262966 GAGCTGTGGCTGGAAGTGATGGG - Intronic
906346574 1:45019316-45019338 GAGCTCAGGCTCCCCCTGACAGG - Exonic
908555611 1:65254383-65254405 GAGCCGTGGCTGGCGCCGACAGG - Intronic
908559650 1:65292871-65292893 CAGCTGAGGTTGGCCCAGACTGG - Intronic
909290603 1:73878425-73878447 GTGCTGAGTCTGCCACTGGCTGG - Intergenic
910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG + Intergenic
912455131 1:109792087-109792109 GAGGCGAGGCTGGCCCTAACAGG - Intergenic
912508404 1:110172227-110172249 GGGCTGGGGCAGGCACTGAGTGG + Intronic
912553012 1:110496656-110496678 GAGCTGAGGCTGATGCTGGCTGG + Intergenic
912631168 1:111247892-111247914 GCTCTGTGGCTGGCACTGAGCGG - Intergenic
915489878 1:156245043-156245065 GGGCTGAGGCAGGGACTGAGGGG + Intronic
919823690 1:201489030-201489052 CAGGTGGGGCTGGCACTGAGAGG + Intronic
920068279 1:203284587-203284609 GAGCTGGGGCTGGGACTGACGGG + Intergenic
920182134 1:204138490-204138512 GAGCAGAGGCTGGCACTGGCAGG - Intronic
920802708 1:209204383-209204405 TATCTGAGACTGGCACTGAGAGG - Intergenic
920877468 1:209849909-209849931 GAGCTGAAGCTGGCTCACACTGG + Intronic
924457153 1:244228021-244228043 CAGCTGAGCCTGGCACAGATAGG - Intergenic
1063371994 10:5528082-5528104 GTGCTCAGGCAGGCACTGGCTGG + Intergenic
1065293538 10:24254367-24254389 GAGCTGGCTCTGGCACTCACAGG - Intronic
1069667123 10:70170320-70170342 GAGCGGAGGCTGGCCCTGGCGGG - Intronic
1069807433 10:71134724-71134746 GGGCTGGGGCTGGCACTGGGTGG - Intergenic
1070165145 10:73891726-73891748 CAGAGGAAGCTGGCACTGACAGG + Intergenic
1071508636 10:86247741-86247763 GAGCAGAGACTGGCACCGGCTGG + Intronic
1071568549 10:86684173-86684195 CTTCTGAGGCTGGCACTGAAGGG + Intronic
1072753604 10:98002026-98002048 GAGCTGAGGCTGACCCTCCCTGG - Intronic
1073070195 10:100788433-100788455 GACCAGAGGCTGCCACTGCCTGG + Intronic
1073131156 10:101190054-101190076 GAGCTGAGGCTGGGGCTGGCAGG + Intergenic
1075776605 10:124993157-124993179 GAGCTGAGGCTGCCCTTGGCAGG + Intronic
1075872248 10:125779461-125779483 GCCCTGAGGCTGGGACTGGCTGG + Intergenic
1076109706 10:127851222-127851244 GAGGTGGAGCTGGCACTGCCTGG + Intergenic
1076573990 10:131451864-131451886 GAGCTGAGGAAGGCACAGATGGG + Intergenic
1077439671 11:2562091-2562113 GGGCTGAGGGTGGCACAGTCGGG - Intronic
1077658372 11:4044309-4044331 GAGCTGTGGCTATCAGTGACAGG - Intronic
1078334422 11:10452085-10452107 GAGCTAAGGATGGGACTGAGAGG - Intronic
1078582110 11:12546749-12546771 GATCCGAGGCTGGGAATGACAGG + Intergenic
1078932233 11:15921470-15921492 GAGCTCAGTCAGGCACTGGCAGG + Intergenic
1078969841 11:16395570-16395592 GAGCTGAGGCTGGCAATAGAGGG + Intronic
1080410170 11:32015804-32015826 GAGCTGAGGCTTGCTCTTAAAGG + Intronic
1080919731 11:36696886-36696908 GAGCTGAGGCCGGCAATACCTGG + Intergenic
1081366568 11:42242499-42242521 GAGATTAGGCTGGCAGGGACTGG + Intergenic
1082084263 11:48036290-48036312 GAGCTGAGGCAGGCCCTCTCGGG + Intronic
1083225455 11:61281724-61281746 TAGCTGGGGCAGGCACTGAGGGG + Intronic
1083344314 11:61978932-61978954 GAGCTGAGGCTGGCACACAGGGG - Intergenic
1083863810 11:65442482-65442504 AAGCTGGGGCTGGCAGGGACAGG + Intergenic
1084085394 11:66852779-66852801 GGGCTGGGGCTGGCCTTGACGGG + Exonic
1084710879 11:70843105-70843127 GAGCTGAGGCTGGAAGGTACAGG + Intronic
1085312526 11:75525102-75525124 AAGCAGAGGCTGGAACTGGCTGG - Intronic
1086449997 11:86906342-86906364 GAGCTGAGGGTGGCGCTGGTGGG - Intronic
1089387888 11:118079850-118079872 GAGCCTAGGATGGCACTGCCAGG - Intronic
1089572227 11:119418429-119418451 CAGCAGGGGCTGGCACTGATGGG + Exonic
1089709188 11:120302660-120302682 GAGCTGAGCCTGGCTCTCAGAGG - Intronic
1090223842 11:125056497-125056519 GGGCTGGGGGTGGCACTGGCTGG + Intergenic
1091406593 12:213337-213359 CAGCTGAGACCGGCACTCACGGG - Exonic
1093759420 12:22890794-22890816 ATGCTGAGGTTGGCACTGATTGG + Intergenic
1095420340 12:42018305-42018327 GAGCTGAGGCTGGCTGTGGTAGG - Intergenic
1095492230 12:42746726-42746748 GAGGTGAAACTGGCCCTGACAGG - Intergenic
1096101265 12:48971719-48971741 GAGCTCAGGGTGGCTCTGCCGGG + Exonic
1097233773 12:57526715-57526737 GAGCAGGGCCTGGCACTGAGTGG + Exonic
1098494124 12:71115276-71115298 GAGCTGAGAATGGCAAGGACTGG - Intronic
1101836963 12:108302642-108302664 GACCTGAGGCTGGGAGTGGCTGG - Intronic
1101988052 12:109462615-109462637 GGGCTGAGGCTGGGGCTGACAGG + Intronic
1102833700 12:116032859-116032881 GAGATGAGGCTGAGAGTGACAGG + Intronic
1103049354 12:117766383-117766405 GAGCTGGGGCTGGCAGGGAATGG + Intronic
1103994396 12:124819773-124819795 GACATGGGGCTGGCCCTGACTGG - Intronic
1104543848 12:129693545-129693567 GCGCTGAGGCTGGGTCTGTCAGG - Intronic
1104622251 12:130325410-130325432 GACCTGAGGCTGGCCCTCACTGG + Intergenic
1104758516 12:131283409-131283431 GAGCAGAGGCTGGGAATGCCGGG + Intergenic
1104822173 12:131683582-131683604 GAGCAGAGGCTGGGAATGTCGGG - Intergenic
1115349679 14:32380425-32380447 GATCTGAGGTAGGCACTGGCAGG - Intronic
1116329117 14:43574100-43574122 GAACTGAGGCAGTCACTGAGCGG + Intergenic
1119495087 14:75071028-75071050 CAGGTGAGGCTGGCACTGATGGG + Exonic
1119543275 14:75454489-75454511 GAGCTGAGCATGGCACAGAATGG - Intronic
1121339411 14:93096246-93096268 GAGCTGTGGCTGCTGCTGACAGG - Intronic
1121611877 14:95286851-95286873 GAGCAGAGGCTGGCACACACAGG - Intronic
1122272713 14:100575575-100575597 GATCTGAGGCTGGAGCTGAGGGG + Intronic
1122445814 14:101767793-101767815 GAGCTGAGGCTGCGGCTGCCAGG - Intronic
1122812383 14:104295470-104295492 GTGCTGAGCCTGGCTCTGCCCGG - Intergenic
1122885881 14:104710068-104710090 TAGCTGGGGATGGCACAGACAGG - Exonic
1124053924 15:26224420-26224442 GGGCTTGGGCTGGCATTGACAGG + Intergenic
1124222748 15:27864148-27864170 GTGCTGAGCCTGGTACTGATGGG - Intronic
1124256486 15:28146860-28146882 TAGCAGAGGATGGCACTGAGAGG + Intronic
1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG + Intronic
1124567744 15:30832233-30832255 TAGCAGAGGATGGCACTGAGAGG - Intergenic
1124926660 15:34076618-34076640 GACCTGAAGCTGGCTGTGACTGG - Intergenic
1125725203 15:41864735-41864757 GAGCTGAGGCTGGTGCTGCTTGG + Intronic
1126220760 15:46209857-46209879 GCGCTGATGGTGGCAGTGACAGG - Intergenic
1126365967 15:47894904-47894926 GAGCTGAGGCAGCCACTTTCGGG - Intergenic
1127015107 15:54676054-54676076 GAGGGGAGGGTGTCACTGACTGG + Intergenic
1129605670 15:77023858-77023880 GAGCTGAGGGGTGAACTGACAGG + Intronic
1130234777 15:82124127-82124149 GCCCTGAGGCTGACACTCACTGG + Intergenic
1131661413 15:94521828-94521850 GAGCTGATGGGGGCACTGAAGGG + Intergenic
1132546915 16:537465-537487 GAGCTGAGGTTGGCCCTGGCAGG + Intronic
1132815915 16:1826537-1826559 GCGCTGAGGCTGGCGCGGAGCGG - Intronic
1132897172 16:2234549-2234571 AAGGCCAGGCTGGCACTGACAGG + Intronic
1133267187 16:4592189-4592211 GAGCTGGGCCGGGCACTGGCAGG + Intronic
1134390985 16:13819829-13819851 GGGATGAGGCTGGCATGGACAGG - Intergenic
1137062366 16:35802978-35803000 AAGCTGATGCTGGCACAGAGGGG - Intergenic
1137564400 16:49524411-49524433 ACTCTGAGGCTGGCACTGAAGGG - Intronic
1138249388 16:55490412-55490434 GTGCTGAGGATGGAGCTGACTGG + Intronic
1139265720 16:65636472-65636494 GAGCTGAGGCTGTCAATCATGGG + Intergenic
1141529717 16:84637737-84637759 GGGCTGGGGCTGACAGTGACTGG - Intergenic
1141771407 16:86091943-86091965 AAACTGAGGCTGGCACATACTGG - Intergenic
1142220745 16:88853819-88853841 GAGCTGAGCCGGGCAAGGACGGG - Intronic
1142745451 17:1954936-1954958 GAGCTGAGGCTGGAAATGGCTGG - Intronic
1143269507 17:5665471-5665493 CAGCTGAGGATGCCACTCACAGG - Intergenic
1143336830 17:6177962-6177984 GAGGTGACGTTGGCACTGACTGG - Intergenic
1143584980 17:7846490-7846512 GAGGTGAGGCTGGCACTGGGTGG + Exonic
1143874506 17:9981609-9981631 GAGCTGCTGCTGGCACTGCCAGG + Intronic
1148088733 17:45009927-45009949 GAGCTGGGGCTGGCAGGGCCTGG + Intergenic
1148493337 17:48037368-48037390 GAGCCGAGTCTGGGACGGACAGG + Intronic
1149684588 17:58528039-58528061 GAGCTGAGCCCAGCACTGCCAGG - Intronic
1150130599 17:62666812-62666834 GAGCGGAGGCTGGCAGTGGTCGG + Exonic
1150710265 17:67525234-67525256 CAGCTGAGGGTGGCCCAGACTGG + Intronic
1151475951 17:74344446-74344468 CGGCTGAGGCTGGGACAGACAGG + Intronic
1152634174 17:81423656-81423678 GGTCTGAGGCTGTCACTGAGCGG - Intronic
1153020480 18:624111-624133 GGGCTGAGGCTCGCAGGGACAGG + Intronic
1157246630 18:46060578-46060600 GAGCTGTGGCTGCCATTGGCTGG + Intronic
1157470454 18:47984237-47984259 GAGCTGAGGCTGGCATCTGCAGG + Intergenic
1159440946 18:68479244-68479266 TAGCTGGGGCTGTTACTGACAGG - Intergenic
1161506965 19:4649290-4649312 GAGCTGAGGTGGGCACGGAAGGG + Intronic
1161619051 19:5288915-5288937 GGGCTGAGTCAGGCACAGACAGG + Intronic
1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG + Intronic
1163169859 19:15523575-15523597 GAGATGAGGCTGGTACTGCCCGG + Intronic
1165816822 19:38647697-38647719 GAGCTGAGGCGGGAGCGGACAGG + Exonic
1165936495 19:39392105-39392127 ATGCTGAGGCTGGGACTGGCCGG + Intronic
1165982141 19:39734004-39734026 GAGCTGAGGATGGCAGTGCAAGG + Intronic
1166071903 19:40392907-40392929 GAGCTGAGACCAGCACTGACAGG + Intergenic
1166231963 19:41429886-41429908 GAGGTGAGGCTTGCAGTGAGCGG - Intronic
1166471908 19:43085111-43085133 GAGCTCAGGCTGTGACTGAGAGG - Intronic
1166670060 19:44704251-44704273 TCGCTGCGGCTGACACTGACCGG - Exonic
1166768180 19:45264920-45264942 GGGCTGAGGGTGGGGCTGACTGG + Intronic
1166873037 19:45882430-45882452 GAGCCCAGGCTGGCAGTGCCAGG + Intergenic
1166955748 19:46463734-46463756 GAGCTGCGGCGGGGACCGACTGG + Intergenic
1167260397 19:48454709-48454731 GCGCTGAGCCTGTCACTGATGGG - Exonic
1167850648 19:52198762-52198784 GAGGTGAGGCTGTCACTTACTGG - Intronic
1168161948 19:54516237-54516259 CAGATGAGGCTGGCAGTGACTGG + Intergenic
926616585 2:15002577-15002599 GAGCAGGGGGTGGCACTCACTGG + Intergenic
928395644 2:30941566-30941588 GAGCTGAGGCTTGCAGCCACAGG - Intronic
929839335 2:45441131-45441153 GACCTGAGGCTGACACTGCCAGG + Intronic
931228078 2:60351322-60351344 CAGCTGAGGCTGGAAGGGACTGG - Intergenic
931585922 2:63827985-63828007 AATTTGAGTCTGGCACTGACAGG + Intergenic
932302449 2:70676770-70676792 GAGCAGAGGCTGCCCCTGACTGG - Intronic
934993863 2:98939512-98939534 GAGCAGAGGGTGGTACTGAAAGG - Intergenic
935697583 2:105783465-105783487 GAGCTAAGTCTGGCTCAGACAGG - Intronic
937140537 2:119596205-119596227 GAGCTGAGGTTGGCTCGGATGGG + Intronic
937884698 2:126891808-126891830 GAGCTGATGCTGGCTCTCGCAGG - Intergenic
939944450 2:148392666-148392688 GAGCTGAGGCTGGCTCTCATTGG - Intronic
940258525 2:151757490-151757512 GAGCTGGGGTTGGAGCTGACAGG - Intergenic
941416288 2:165225489-165225511 GGGCTGAGGCTGTCAAGGACAGG + Intergenic
942170287 2:173282926-173282948 GGGCTGCGGCTGGCACTTGCGGG - Intergenic
944214071 2:197236359-197236381 AAACTGAGGCTGCCACTCACAGG + Intronic
947663137 2:231884989-231885011 GAGCTGAGGCTGGGAGTTGCAGG + Intergenic
947736796 2:232459351-232459373 GAGCTGAGCCTGGGACTTCCAGG + Exonic
948274782 2:236699938-236699960 GAGCTGGGGCTGGCATTTGCCGG + Intergenic
948455833 2:238104251-238104273 GAGCTGAGGGTTGCACTGGCTGG - Intronic
948762239 2:240199340-240199362 GAGCTGTGGCTGGCACAGCAGGG + Intergenic
948777458 2:240297064-240297086 GAGATGGTGCTGGCACTGCCAGG - Intergenic
948830372 2:240595652-240595674 GAGCTGGGACTGGCCCTGACAGG - Intronic
949049218 2:241888339-241888361 GAGCTGTGGCTGCCTCTGAGAGG - Intergenic
1169499664 20:6147409-6147431 GACCTGCAGCTGGCAATGACAGG - Intergenic
1170466158 20:16624180-16624202 CAGCTGAGGGTGACACTGAGTGG - Intergenic
1170850064 20:19996632-19996654 GAGCGGAGGTTGGCACTGGGAGG + Intronic
1172272162 20:33660707-33660729 TAGCTGTGGCTGGGACTCACTGG - Intronic
1172444454 20:34985701-34985723 GAGCGCAGGCAGGCAGTGACGGG + Intronic
1172960360 20:38794840-38794862 GAGCGCAGGGTGGCACTCACTGG + Intergenic
1173929204 20:46804422-46804444 GAGGAGAGGCTGGGAGTGACTGG + Intergenic
1175251463 20:57612562-57612584 GGGCTGATGCTGTCACTCACAGG + Intronic
1175646122 20:60673314-60673336 GTGCTGAGGCTGTCACTCACTGG - Intergenic
1175812094 20:61863909-61863931 AAGCTGAGGCAGGCAGTGTCTGG - Intronic
1178796456 21:35748982-35749004 GCCCTGAGTCTGCCACTGACTGG + Intronic
1180140829 21:45892638-45892660 CAGCTGAGGCTGGCACTGCCAGG + Intronic
1180676602 22:17590774-17590796 GGGCTGAGGCCGGCTCTGACTGG + Exonic
1180948736 22:19710869-19710891 GGGCTGAGGCCACCACTGACAGG - Intergenic
1181289015 22:21776276-21776298 GAGTTGAGGATGGAAGTGACAGG - Intronic
1181419715 22:22789330-22789352 GAGCTGAGGATGGCAATGGCTGG + Intronic
1181753832 22:25008895-25008917 GCCCTGAGGCTGGCAGTGCCAGG + Intronic
1181795393 22:25305100-25305122 GAGCTGAGAGTGGCCCTGGCTGG + Intergenic
1181835931 22:25608617-25608639 GAGCTGAGAGTGGCCCTGGCTGG + Intronic
1182372460 22:29821054-29821076 GAGCTGGGCCTGGCACAGAGGGG - Intronic
1182512653 22:30830021-30830043 GAGCTGGAGCTGGGACTGAGGGG + Intronic
1183256893 22:36768238-36768260 GAAGTGTGACTGGCACTGACAGG + Intronic
1183523338 22:38309272-38309294 GAGCTGACGGTGGCCCTGCCTGG + Intronic
1184346976 22:43919570-43919592 GAGGTCAGGCTGACACTGTCTGG + Intergenic
1184900620 22:47444382-47444404 GAGCTGAGGCTGGTAGAGAGAGG + Intergenic
1185137126 22:49079509-49079531 GCGGTGATGCTGGCACTGCCAGG + Intergenic
1185216213 22:49601324-49601346 CAGCTGAGCTTGGCACTGGCAGG - Intronic
951307269 3:21080523-21080545 GAGAAGAGGATGGCAGTGACTGG + Intergenic
952495868 3:33915234-33915256 GCCCTGTGGCTGGCACTGAGTGG - Intergenic
953411647 3:42693582-42693604 GACCTGGGGCTGGGACTGGCTGG - Intronic
953570906 3:44070866-44070888 GAGCTGCTGCTGGCCCTGCCAGG - Intergenic
954299987 3:49695836-49695858 GAGCTCAGGACAGCACTGACTGG + Intronic
954375266 3:50191285-50191307 GAGGTGGGGCTGGCAGTGAGAGG - Intergenic
954406375 3:50347590-50347612 GAAGTGAGGCTGGTAGTGACTGG - Exonic
954759002 3:52860678-52860700 GACCACATGCTGGCACTGACCGG + Intronic
956160907 3:66351582-66351604 GATCTGAGGCTGCCACTCAGAGG - Intronic
956972580 3:74544167-74544189 GAGGTCAGGTTGGCACTGAAAGG + Intergenic
957154859 3:76534575-76534597 AAGCTGAGGCTGGCAAAGAGAGG + Intronic
960914267 3:122680875-122680897 GAGCTGAGGATGGCTGTGCCCGG + Exonic
962278330 3:134031769-134031791 GAGATGATGCTGGCGCTGACGGG - Intronic
962378542 3:134878123-134878145 GTGCTGAGGCTGGAACTTCCTGG + Intronic
963824173 3:149933123-149933145 GAGCTGAGGCTGGAGCAGCCAGG + Intronic
964138387 3:153370097-153370119 GGGCTGCGTCTGGCACTCACAGG - Intergenic
968584214 4:1408499-1408521 GAGCTGGCGCTGGCGCTGGCGGG - Intergenic
968813645 4:2810991-2811013 GGACTGAGGCTGGCACAGGCTGG + Intronic
968930396 4:3575828-3575850 GAGCAGTGGGTGGCAGTGACAGG - Intergenic
969112682 4:4853506-4853528 GAGCTGAGGCTGGAAAGGAGGGG - Intergenic
969272249 4:6110894-6110916 GGGCTGGGGCTGGGGCTGACTGG - Intronic
969417948 4:7073390-7073412 GGGCTGAGGCTGGGGCTTACAGG + Intergenic
969652110 4:8474087-8474109 GTGCCGAGGCTGGCTCTGAGGGG + Intronic
972599595 4:40560516-40560538 GACCAAAGGCTGGCACTGCCGGG - Intronic
973788315 4:54355649-54355671 GAGCTGAGGATGGAATTAACAGG + Intergenic
977499546 4:97821787-97821809 GAGCTGAGGCTTGGTCTGAGTGG + Intronic
977693801 4:99946312-99946334 GGGCTGGGGCTGGCTCAGACAGG + Intronic
978036899 4:104006121-104006143 GTGGTGAGGATGGCAGTGACAGG + Intergenic
981489486 4:145324707-145324729 GAGCTGTGGCTGGCAGTAAGGGG - Intergenic
983940856 4:173532875-173532897 GAGGCCAGGCTGGCCCTGACTGG + Intergenic
985390852 4:189490755-189490777 GGGCTGTGGCTGGCCCTCACTGG + Intergenic
985390876 4:189490845-189490867 GGGCTGTGGCTGGCCCTCACTGG + Intergenic
985390908 4:189490965-189490987 GAGCTGTGGCTGACCCTCACTGG + Intergenic
985606652 5:861631-861653 GAGCAGAGGGCGGCAGTGACAGG - Intronic
985971430 5:3381372-3381394 GAGCTGAGGCTGACAGTGTGTGG + Intergenic
986648965 5:9945294-9945316 GAGCTGTGGGTGGCAAGGACAGG - Intergenic
987093633 5:14529156-14529178 GAGCCCAGGCTGTCACTGATTGG + Intronic
989184504 5:38610170-38610192 GGGCAGAGGCTGGGACAGACAGG + Intergenic
994353684 5:98773197-98773219 GAGCTGAAGCTGGCAGGGCCAGG + Intronic
1002941567 6:1721014-1721036 GAGCTGAGGGAAGCTCTGACTGG + Intronic
1003129881 6:3386547-3386569 CAGAGGAGGCTGGCACTGCCAGG + Intronic
1003375351 6:5571949-5571971 GAGCTGAGGCTGCAGGTGACAGG - Intronic
1006096355 6:31659126-31659148 GGGATGAGGCGGCCACTGACTGG - Exonic
1006155938 6:32012776-32012798 AAGCTGAGGGTGGAACTGGCTGG + Intergenic
1006162271 6:32045630-32045652 AAGCTGAGGGTGGAACTGGCTGG + Exonic
1007344962 6:41222567-41222589 GAACAGTGGCTGGCACTGCCAGG - Intergenic
1017010927 6:150063576-150063598 GACCTGAGGCTGGTAATGAGGGG + Intronic
1017543328 6:155425474-155425496 GAGCTGAGACTGGAACTTAATGG - Intronic
1019257236 7:60182-60204 GGGCTGAGCCGGGCCCTGACGGG + Intergenic
1019403906 7:872567-872589 GAACTGGGACTGGCACTGCCTGG + Intronic
1019410487 7:904596-904618 GAGCCGTGGCGGGCACTGGCTGG - Intronic
1019581058 7:1763367-1763389 GAGATGCGGCTGGCACATACCGG - Intergenic
1019628393 7:2033047-2033069 CAGCTGACGCTGCCACTGACTGG + Intronic
1022220917 7:28312545-28312567 GTGCTGAGTCTGGCATTTACTGG + Intronic
1023226407 7:37974056-37974078 GAGTTGAGACAGGCACTGAGAGG + Intronic
1024113907 7:46174057-46174079 GGGCTGAGGCTGATACCGACTGG - Intergenic
1024368251 7:48548865-48548887 CACCTGTGCCTGGCACTGACAGG - Intronic
1024508702 7:50185370-50185392 GAGCTGAGGCTGGGCATGTCAGG - Intergenic
1025962064 7:66231525-66231547 CAGCTAAGGCTGGCACTGCTGGG + Intronic
1031134528 7:117872146-117872168 GAGCTGAGCCTGGCAATGGAAGG - Intronic
1032682961 7:134204134-134204156 AATCTGAGGTTGCCACTGACTGG + Intronic
1034036805 7:147833525-147833547 AAGCTGAGGCCAGCAGTGACTGG - Intronic
1035474477 7:159132372-159132394 GAGCTCAGCCTGGGTCTGACAGG + Intronic
1035478778 7:159164516-159164538 GAGCTCAGCCTGGGTCTGACAGG - Intergenic
1036914988 8:12796470-12796492 CAGCTAAGGCTGGCACTGCTCGG - Intergenic
1040102459 8:43517891-43517913 GAGCTGGAGCTGGCACTGCAGGG - Intergenic
1040530286 8:48261057-48261079 GAGCTGAGCCTGGCACAGGTGGG + Intergenic
1040603409 8:48906774-48906796 GAGCTGAGGTGGACACTGAAGGG + Intergenic
1042533361 8:69835664-69835686 GAGCTGGCTCTGGCAGTGACAGG + Intergenic
1043542806 8:81281408-81281430 GACCTGCTGCTGGCACTGCCGGG + Intronic
1043803545 8:84642873-84642895 GTGCTGAGGCTCTCTCTGACAGG - Intronic
1044942157 8:97354295-97354317 GAGCTAAGGCTGGCAGAGAAAGG - Intergenic
1045522637 8:102916589-102916611 GAGATGAGACTGACACTGGCTGG - Intronic
1046160233 8:110353347-110353369 GAGCTGAGACTGGCACCTACTGG - Intergenic
1046185647 8:110712870-110712892 GAGCTGATGCTGGGTCTGACAGG + Intergenic
1047274551 8:123395984-123396006 GAGCTGAGGCTGGCCGGGAGAGG - Intronic
1049287090 8:141781738-141781760 GAGCTGAGCCTGGCACGGCATGG + Intergenic
1049470507 8:142773234-142773256 GCCCTGAGGCTGGCACTTGCAGG + Intronic
1051366485 9:16325088-16325110 GAGCTGAGGCCCGCTCTGATAGG + Intergenic
1052881571 9:33603898-33603920 GAGCTGGTGCTGACACTGTCAGG - Intergenic
1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG + Intergenic
1054459711 9:65456086-65456108 GAGCAGTGGGTGGCAGTGACAGG + Intergenic
1055038508 9:71844060-71844082 GTGCTGAAGCTGGCACTTGCTGG + Intergenic
1056691702 9:88813490-88813512 GAGCTGCAGCCGGCTCTGACAGG + Intergenic
1059389007 9:113987145-113987167 AAGCTGAGGCTTGCACATACTGG - Intronic
1059415753 9:114161626-114161648 GGGCTAAGGCTGGGACAGACAGG - Intronic
1060731489 9:126039691-126039713 GAGCTGAGGCTGGGCCTTCCTGG - Intergenic
1061036521 9:128117408-128117430 GACCTGAGGATGGCACTAATGGG + Intergenic
1061278139 9:129581372-129581394 GAGCTGAAGCTTGCTCTGACGGG + Intergenic
1061509604 9:131052580-131052602 CAGCTGAGGCTGGAAGGGACAGG + Exonic
1061845393 9:133385310-133385332 GAGCTGTGGCAGGCAGTGCCAGG - Intronic
1062125018 9:134855568-134855590 GAGCTGAGGCAGACACAGGCAGG - Intergenic
1062393317 9:136342624-136342646 CAGCTGAGCCTGGCAGGGACAGG + Intronic
1062434420 9:136540408-136540430 GGGCTGGGCCTGGCACTGCCTGG - Intronic
1062656464 9:137606387-137606409 GAGGTGAGGCTGCCTCTGCCCGG + Intronic
1188237362 X:27747028-27747050 GAGCTGAGTGTGACAGTGACCGG + Exonic
1190263584 X:48814826-48814848 CAGCTGAGGCTGGAACTGAAGGG - Exonic
1190911327 X:54774880-54774902 GAGCTGAGACTGGTCCTGAGGGG - Intronic
1190919896 X:54841335-54841357 GAGCTGAGACTGGTCCTGAGGGG + Intergenic
1192040274 X:67613086-67613108 GAGCTGAGGCAGGCACAAGCAGG - Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195519543 X:105815234-105815256 GAGATGAGACTGGAGCTGACAGG - Intergenic
1197704298 X:129622894-129622916 CAGCTGGGGATGACACTGACAGG - Intergenic
1200053332 X:153446006-153446028 TACCTGGGGCGGGCACTGACCGG + Exonic
1200159678 X:153999844-153999866 GATCTGAGGCCGGCTCTGTCGGG + Intergenic