ID: 1162043272

View in Genome Browser
Species Human (GRCh38)
Location 19:7983224-7983246
Sequence CTGGGTTCTCACTTTGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162043272_1162043279 9 Left 1162043272 19:7983224-7983246 CCCTGGACAAAGTGAGAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1162043279 19:7983256-7983278 ACCGTAGGACCAGGCCCGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 37
1162043272_1162043277 0 Left 1162043272 19:7983224-7983246 CCCTGGACAAAGTGAGAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1162043277 19:7983247-7983269 AGCACCAAGACCGTAGGACCAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1162043272_1162043282 19 Left 1162043272 19:7983224-7983246 CCCTGGACAAAGTGAGAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1162043282 19:7983266-7983288 CAGGCCCGTGTGGAGCGAATTGG 0: 1
1: 0
2: 0
3: 3
4: 60
1162043272_1162043283 20 Left 1162043272 19:7983224-7983246 CCCTGGACAAAGTGAGAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1162043283 19:7983267-7983289 AGGCCCGTGTGGAGCGAATTGGG 0: 1
1: 0
2: 0
3: 1
4: 52
1162043272_1162043274 -6 Left 1162043272 19:7983224-7983246 CCCTGGACAAAGTGAGAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1162043274 19:7983241-7983263 ACCCAGAGCACCAAGACCGTAGG 0: 1
1: 0
2: 0
3: 80
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162043272 Original CRISPR CTGGGTTCTCACTTTGTCCA GGG (reversed) Intronic
900538413 1:3190547-3190569 CTGGGGGCTCACTCTGTGCATGG + Intronic
902578833 1:17395694-17395716 CTGGGGTCTTCCTTTTTCCAGGG + Intronic
904456707 1:30652109-30652131 CTGGGGTCTCCCTTTATCCTGGG - Intergenic
905793789 1:40803998-40804020 CTGGGTTCTCAGTACTTCCAGGG - Intronic
905902734 1:41592521-41592543 ATGGATGCTCACTTTGACCAAGG - Intronic
907096512 1:51786161-51786183 CTGGGTTCTTACTATGTGCCAGG - Intronic
907140829 1:52183526-52183548 CTGGAGTCTCACTTTTTCCCTGG + Intronic
908179325 1:61588566-61588588 CTTGGTTCACACTTTGTTCAAGG - Intergenic
910135055 1:83957790-83957812 CTGCCTTCTCACTATGTCCTTGG - Intronic
911665223 1:100543791-100543813 CTGGGTTCCCACATTCTCTAAGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915074464 1:153297226-153297248 CTGGGTTGTAAGTTTCTCCAAGG - Intergenic
919145182 1:193625276-193625298 CTCGTTTTTCAGTTTGTCCAGGG - Intergenic
919424069 1:197406919-197406941 CTGAGTTTTAACTTTGTTCATGG - Intronic
920819137 1:209364175-209364197 CTGAGTTCTCTCTGTGTCCGAGG - Intergenic
921032308 1:211344559-211344581 ATTGGTTCTCCCTTTCTCCAAGG + Intronic
921796731 1:219353363-219353385 ATGGTTTCTCACTGTGTCTATGG - Intergenic
922222343 1:223618331-223618353 CTGGGTCCTCACCTGGTGCAAGG - Intronic
922979787 1:229816060-229816082 CTGGGTTCTCACTATGTATGAGG - Intergenic
1062781769 10:217679-217701 CTGGGTGCTCACATTGTGCCAGG + Intronic
1062850039 10:736525-736547 CTGGGGCCTCACTCTGTCCCGGG - Intergenic
1063021972 10:2137861-2137883 CTGAGGACTCACTTTGTCCATGG + Intergenic
1063801068 10:9578855-9578877 CTGGGTTCTCACATGGTAGAAGG + Intergenic
1065341825 10:24714434-24714456 CTGGGTACTCACTTTGCTGATGG + Intronic
1065721391 10:28631422-28631444 CTAGGTGCTCATTGTGTCCATGG - Intergenic
1066353447 10:34659122-34659144 CTGGTTCCTCACTTTGTGCTGGG - Intronic
1067011603 10:42719516-42719538 CTGTGCTTTCACTTTGACCACGG + Intergenic
1067311988 10:45122339-45122361 CTGTGCTTTCACTTTGACCACGG - Intergenic
1068098874 10:52527197-52527219 CTGCTTTCTAACTTTGCCCAGGG - Intergenic
1069812781 10:71174813-71174835 CTGGTCTCCCACTTTGGCCAGGG + Intergenic
1071420445 10:85492029-85492051 CTGTGTGTTCACTTTGTCCATGG + Intergenic
1073032388 10:100537023-100537045 TTGGCTTCTCACTTTGAACAAGG - Intronic
1073267513 10:102236726-102236748 GTGGGCTCTCACTATGTCCCTGG - Intronic
1074887825 10:117708424-117708446 TTGGGTCCCCACTTTGTTCATGG - Intergenic
1076479414 10:130775104-130775126 CTGAGTTCTCTCTGTGTCCTGGG - Intergenic
1077126438 11:940725-940747 CTGAGCTCTCACTTTGTGCTTGG + Intronic
1078186001 11:9052697-9052719 CTGGGGGCTCACTGTGTTCAAGG - Intronic
1078597623 11:12702105-12702127 CTGTGTACTCCCTTTATCCATGG + Intronic
1079138150 11:17788151-17788173 CCAGTTTCTCTCTTTGTCCATGG + Exonic
1079169211 11:18076156-18076178 ATGGGTTCTCACTGTTTCCCAGG - Intronic
1079280377 11:19081965-19081987 ATGGGGTCTCACTATGTCCTAGG + Intergenic
1083933047 11:65856502-65856524 CTGGGTTCACATTTTGGTCAAGG - Intronic
1083966049 11:66044515-66044537 CTGGCTCCTCACTTTGTAGATGG + Intronic
1084501581 11:69538593-69538615 CTGGTTTCTCACATTGTCCTGGG + Intergenic
1085536966 11:77227559-77227581 CTGAGTCCACACTTTGTGCAAGG - Intronic
1085688563 11:78647554-78647576 CTGTGTTTTCACTTTGTACTGGG - Intergenic
1089570376 11:119404088-119404110 CTGGGAGCTCTCTTTGTTCAAGG + Intergenic
1091922229 12:4314333-4314355 CTGGAGTCTCACTGTGTCCCAGG - Intergenic
1093842553 12:23922073-23922095 CTGGGCTCCCACTTTTTTCAGGG + Intronic
1093944274 12:25089660-25089682 CTTACTTCTCACTTTGTCTAAGG - Exonic
1095398140 12:41784491-41784513 CTGGGTTGTCACTTTATTGATGG - Intergenic
1095589425 12:43887230-43887252 CTGGATTCTAGCTTTGTCCCAGG - Intronic
1096650891 12:53061459-53061481 CTGGCTTCTCACCTTGGTCACGG - Exonic
1097250161 12:57628009-57628031 CGTGGTTCTCTCTTTGTCCTAGG + Intronic
1099057840 12:77867842-77867864 CAGGTTTCTTACTTTGTACACGG - Intronic
1099213385 12:79821725-79821747 ATGGGGTCTCACTCTGTCCCAGG - Intronic
1099933233 12:89097757-89097779 CTGAGTGTTCACTTTGTGCAGGG + Intergenic
1103424981 12:120825932-120825954 ATGGGACCTCTCTTTGTCCAGGG + Intronic
1104195081 12:126529192-126529214 CTGAGTTCTCACTGTGTTCTTGG - Intergenic
1104216972 12:126743006-126743028 CTAGGGCCTCAGTTTGTCCAAGG - Intergenic
1104430839 12:128714732-128714754 CTGGGAGCTCACATTGTCCCAGG - Intergenic
1105615309 13:22006401-22006423 ATGTCTTCTCACTTTGTCCATGG - Intergenic
1106216893 13:27709999-27710021 CTGGGTGTTTACTTTGACCATGG + Intergenic
1110658065 13:78023999-78024021 CTGGGTACTCCCTTTACCCATGG - Intergenic
1112405199 13:99113552-99113574 GTGAGGTCTCACTTTGTCCCAGG - Intergenic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1112821801 13:103346294-103346316 CTGAGCTCTCACTTTATTCAAGG + Intergenic
1112821948 13:103347907-103347929 CTGAGCTCTCACTTTATTCAAGG + Intergenic
1115229147 14:31139390-31139412 CTGTGTTCTCACATTGTAGAAGG - Intronic
1116959407 14:50954574-50954596 ATGGGTACTCACTGTGTACAAGG + Intergenic
1117627246 14:57652390-57652412 ATGGGTCCTCATTTTGTCCCAGG + Intronic
1118770952 14:68942353-68942375 CTGGGGTCTCACTGTCTCCCAGG - Intronic
1121619654 14:95337326-95337348 CTGGGGACTCCCCTTGTCCACGG - Intergenic
1121955275 14:98207633-98207655 CTGGGGTCTCCCATTGTGCACGG + Intergenic
1124966838 15:34438019-34438041 CTGGTGTCTCAATTTGTCCTGGG + Intergenic
1127381230 15:58432098-58432120 CTGGTTTCAGGCTTTGTCCAAGG - Exonic
1127833433 15:62770772-62770794 CTTGGTTTTTACTTTCTCCAGGG - Intronic
1128052180 15:64674280-64674302 GTGGGTTCTACCTTTGTCCCAGG - Exonic
1129652505 15:77501143-77501165 CTGAGTGCTTACTTTGTCCCAGG - Intergenic
1129804767 15:78446590-78446612 CTGCCTGCTCACTTTGTACATGG + Intronic
1130238200 15:82159087-82159109 GTGGGATTTCACTGTGTCCAGGG + Intronic
1130540001 15:84815736-84815758 CTGGGTTCCAGCTTTGTCCCTGG - Intergenic
1131193611 15:90337225-90337247 TTGGGTTCTGGCTTTCTCCATGG - Intergenic
1133532409 16:6667246-6667268 CTGGGTTACCACTGTGTCCATGG - Intronic
1135794549 16:25428670-25428692 CTTAGTTATCTCTTTGTCCAAGG + Intergenic
1136180432 16:28548260-28548282 CTGGGTTTTCACGTTCACCAGGG + Intergenic
1136341456 16:29646596-29646618 ATGGGGTCTCACTCTGTCCCAGG + Intergenic
1138532279 16:57640920-57640942 CTGTGTTCCCACGTTGCCCAAGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1142102408 16:88282289-88282311 CTGTGTTCTCACTGTGTTCCAGG + Intergenic
1143645563 17:8227901-8227923 CTGGGTTCTGACTTTGTCGCAGG - Exonic
1144430762 17:15189681-15189703 CTAGGTTCTCACTTGGTCAGTGG + Intergenic
1144838404 17:18170758-18170780 CTGAGTTCTTACTTTTTGCAAGG + Intronic
1147914913 17:43880409-43880431 CTGGGCACTCACTTTCTTCATGG + Intronic
1148818472 17:50346784-50346806 CCGGGTACACACTTTGTCCCAGG - Intronic
1150232291 17:63562477-63562499 CTGTCTTTTGACTTTGTCCATGG - Intronic
1151217769 17:72589490-72589512 CTGGGTTCCCACTTTTTACAAGG + Intergenic
1156835179 18:41544628-41544650 TAGGGTCATCACTTTGTCCATGG - Intergenic
1157222976 18:45840344-45840366 CTGGGGTCCTACTTTGACCAGGG + Intronic
1158831785 18:61287582-61287604 CTGAGTACTCACTTGGCCCAAGG - Intergenic
1158847881 18:61463765-61463787 CTGTGTCCTCACTCTGTCCAGGG + Intronic
1160974986 19:1788797-1788819 CAGGGTTCTCAGTGCGTCCAGGG + Intronic
1162043272 19:7983224-7983246 CTGGGTTCTCACTTTGTCCAGGG - Intronic
1162472240 19:10879403-10879425 GTATGTTCTCTCTTTGTCCATGG - Intronic
1164681349 19:30135800-30135822 ACGGGTACTCACTTTGTGCAGGG - Intergenic
1165927436 19:39335731-39335753 CTGGGTTCCCGCCTTCTCCACGG + Intronic
1166234192 19:41443873-41443895 CAGGGTCCTCACTGTGCCCATGG - Intronic
1166826913 19:45615640-45615662 CTGGCTTCTCATTTTCTCCCTGG - Intronic
1166836902 19:45672912-45672934 CTGGGTTCTCACATTGTGTATGG - Exonic
1167701215 19:51047261-51047283 TTGAGTTCTCACTCTGTGCAAGG + Intergenic
927821719 2:26271943-26271965 ATGGAGTCTCACTCTGTCCAAGG + Intronic
930560374 2:52952787-52952809 TTGAGTTCTGACTTTGTACAAGG + Intergenic
931880859 2:66569163-66569185 CTTTGTTTTCACTTTGTCCTAGG + Intronic
931906841 2:66851744-66851766 CTGGGTTCTCACATACTTCAGGG + Intergenic
932185788 2:69694247-69694269 CTGCGTTCTCACATTGTGGAAGG - Intronic
932565039 2:72900867-72900889 CTGGGTTTCCAGTGTGTCCAGGG - Intergenic
932574863 2:72957046-72957068 CTGGGTTCTCCCTGTGCCCTTGG + Intronic
932688663 2:73894252-73894274 CTGGGACCACACTTTGTACAGGG + Intronic
934058402 2:88271542-88271564 CTGGGCCATCCCTTTGTCCAAGG - Intergenic
935513801 2:104008491-104008513 CAGGCTGCTGACTTTGTCCATGG + Intergenic
938861823 2:135377352-135377374 CTGGGTGCTCCATTTCTCCAGGG - Intronic
938946055 2:136212962-136212984 CTGTGTTCTCACTTGGTAGAAGG + Intergenic
939268347 2:139905063-139905085 TTGGGTTCTCACTCTTTTCAAGG + Intergenic
939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG + Intergenic
940173594 2:150854414-150854436 CTGGGTGATCTCTTTCTCCAAGG + Intergenic
941686343 2:168452765-168452787 CTGGGATCTGACTTTGATCATGG - Intergenic
941870208 2:170376512-170376534 CTGAGTTCTCTCTATGGCCATGG + Intronic
942336479 2:174892394-174892416 CTGTGTTCTCACATTGTGAAAGG - Intronic
943070248 2:183132611-183132633 CTGGCTTCTAAATTTGTGCAAGG + Intronic
945152557 2:206806444-206806466 CTGGGCTTTCACTCTGTCCTGGG + Intergenic
945440867 2:209877983-209878005 CTGGGCTCTCACTTTCCCCGTGG - Exonic
946818167 2:223601646-223601668 CTGGATTCTTCCTTTTTCCAGGG - Intronic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
1169003043 20:2182105-2182127 CTGGGCTCTACCTTTGTCCTTGG + Intergenic
1169057038 20:2631680-2631702 CTGGATTCTCTCTTTGACTATGG + Intronic
1169277956 20:4246187-4246209 CTGGGTCATCACTGAGTCCACGG - Intronic
1169825974 20:9769076-9769098 CTGTGTTCTCACTGTGTTAAAGG - Intronic
1170353333 20:15465929-15465951 CTTGCTTATCACTGTGTCCACGG - Intronic
1170978277 20:21187329-21187351 CTGGGTTCTGACTTTGCTCGGGG - Intronic
1171023515 20:21608262-21608284 CGGGGTTCTCGCGTTGCCCACGG + Intergenic
1171297519 20:24031651-24031673 CTGTGTTCTCACTTAATCCAGGG + Intergenic
1173154125 20:40593565-40593587 CTGGGATCTGAATTTGTCCTGGG + Intergenic
1174126494 20:48310681-48310703 CTGGATACTCACTTGCTCCAGGG + Intergenic
1174707524 20:52671568-52671590 CTGTGTTCTGACTGTGTCCAGGG + Intergenic
1176952233 21:15062153-15062175 GTGGCTTATCACATTGTCCATGG - Intronic
1179092609 21:38280912-38280934 CTGTGTTCTCATTTCTTCCATGG - Intronic
1179590119 21:42402547-42402569 CTGGAGTCTCACTCTGTCCCAGG + Intergenic
1181437909 22:22921075-22921097 CAGGATTCTCACTTCTTCCATGG + Intergenic
1182352386 22:29706146-29706168 CTGGGTCCTCACTCTGTGCCAGG - Intergenic
1182696131 22:32200424-32200446 CTGGGTTCTCAGTGTGTGTAAGG + Intronic
1183374902 22:37457465-37457487 CTGGCTTCTCACCTGGCCCAGGG - Intergenic
1183612921 22:38922770-38922792 CTGGTTTCTCTGTTTGTACAAGG - Intergenic
1184231187 22:43159299-43159321 GTGGGCTCCCGCTTTGTCCACGG + Exonic
1184347228 22:43921412-43921434 CTGGGTCCTCTCTTTGTCTCTGG + Intergenic
1184856073 22:47147514-47147536 CTGGGTCCTCACGATGTCCCAGG - Intronic
949179730 3:1114353-1114375 CTGGGTTCTCAACATCTCCAAGG - Intronic
949343937 3:3059196-3059218 CTGGCTTCTAACTTTGTACCTGG + Intergenic
950027907 3:9833307-9833329 CTGGCTTCTCACTGTGCCCCAGG - Intronic
952311244 3:32192447-32192469 CTGGGTTCTCACTGGGTTCTGGG - Intergenic
952514652 3:34091674-34091696 CTGGGAATTCCCTTTGTCCAGGG + Intergenic
954134132 3:48574369-48574391 CTGGGTCCTGACTCTGTCTAGGG - Intronic
955725914 3:61932535-61932557 CTGAGTTCTTACTGTGTGCAAGG + Intronic
956691171 3:71878931-71878953 CCTGTTTCTCACCTTGTCCAAGG - Intergenic
958455239 3:94322913-94322935 CTGTGTCCTCACTGTTTCCAAGG - Intergenic
960036055 3:113104368-113104390 CTCACTTCTCACTCTGTCCAGGG + Intergenic
961035296 3:123637802-123637824 CTGGGTGCTCACTGTCCCCAAGG - Intronic
962476741 3:135761630-135761652 CTGGTTTCTCTCTGTGTCCTCGG + Intergenic
964928754 3:161989288-161989310 CTGAGTTCTAACAATGTCCATGG - Intergenic
966527244 3:180932825-180932847 TTGGGTTCTTACTTTGTGCCAGG + Intronic
967903216 3:194478340-194478362 CTTGGTTCTCTCTTTCTCCCTGG - Intronic
972139645 4:35941767-35941789 CTGGGTACTCACTTTATCTTGGG - Intergenic
974208492 4:58738975-58738997 TTGGGTTCTCACTATGTGCCAGG + Intergenic
976186061 4:82443700-82443722 CTGGAGTCTCACTCTGTCCCAGG - Intronic
976495563 4:85725851-85725873 TTGGCTTGTCACTTTCTCCAGGG + Intronic
976700106 4:87960373-87960395 CTGTGTTCTCACTTGGTATAAGG + Intergenic
979040117 4:115780015-115780037 ATGGGGTCTCACTCTGTCCCAGG + Intergenic
979297817 4:119053004-119053026 CTGGGTTGTCACTTCCACCATGG - Intronic
980789945 4:137607597-137607619 ATTGGTTGTCACTTTTTCCAAGG - Intergenic
982114423 4:152085830-152085852 CTGGGTTCCCTCTTTGATCATGG - Intergenic
984905456 4:184621811-184621833 CTGTCTTCTCACTTGGTTCATGG + Intergenic
985140642 4:186837161-186837183 CTAGGTTCTCACCTTGACCGTGG + Intergenic
985773557 5:1827877-1827899 CTGTGTCCTCACTTTGTGGAAGG - Intergenic
987075994 5:14382411-14382433 CTGGGCTCTCTCCTTTTCCACGG + Intronic
988856239 5:35230256-35230278 ATGGGTACTCACTTTTGCCAGGG + Exonic
989419376 5:41218659-41218681 CTGGCCTATCACTTTGTCCAAGG - Intronic
989591372 5:43116178-43116200 CTGTGTTATTACTGTGTCCAGGG + Intronic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
994888479 5:105598510-105598532 CAGGGGTCTCACTCTGTCCCCGG + Intergenic
995546661 5:113239387-113239409 CAGGGTACTCCCTTTCTCCAGGG + Intronic
995775006 5:115715744-115715766 CAGGGATCTCTCTTTGTCTATGG + Intergenic
998291231 5:140916539-140916561 ATGGGTTTTCTATTTGTCCAGGG + Intronic
999413014 5:151368839-151368861 CTGGGTTCTGCCTTTGTTCAAGG - Intergenic
999921282 5:156323865-156323887 CTCGGTTCTCACTTTTGCAAAGG - Intronic
1000670066 5:164050505-164050527 CTGGTTGCTCACTTTTTCTAAGG - Intergenic
1000681417 5:164189662-164189684 CTTGGTTTTCACTGTTTCCATGG + Intergenic
1001324610 5:170713182-170713204 CTGTGTTCTCTTTTTCTCCATGG + Intronic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1007248745 6:40481602-40481624 CTGGGGTCTCAGTTTCTCAAAGG - Intronic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1009708162 6:67282672-67282694 CTGGGTTCTCCCTTTTGCAAAGG - Intergenic
1010100002 6:72092817-72092839 CTAGCTTCTCACTTTCTCCATGG - Intronic
1012373520 6:98533796-98533818 CTGGGATTTCATTTTGTTCATGG - Intergenic
1015451419 6:133371536-133371558 ATGGGTTCTAACTTTTTGCAGGG + Intronic
1015545461 6:134356913-134356935 CTGGGTTCTTACTCTGCACAAGG + Intergenic
1018240439 6:161769420-161769442 CAGGGTCCTCACTTTGCCCAAGG + Intronic
1018873741 6:167802630-167802652 GTGGAGTCTCTCTTTGTCCAGGG + Intergenic
1020688603 7:11326888-11326910 CTGTGTCCTCACATTGTCAAAGG - Intergenic
1021917170 7:25445108-25445130 CTGGGTTCTTGCTCTTTCCAAGG + Intergenic
1025031330 7:55559546-55559568 CTGTGATCTCAATTTGTCCAAGG + Intronic
1026168604 7:67933162-67933184 CTGGGTTCTTCCTGTGTACATGG - Intergenic
1026504430 7:70970153-70970175 CAGGGTTCTCACTTTTACCATGG - Intergenic
1027307214 7:76912069-76912091 CTGGCTTCACGCTTTGTCCTGGG + Intergenic
1028525028 7:91774656-91774678 GTGGGTCCTCACCATGTCCAAGG - Intronic
1029298791 7:99562165-99562187 CTCTGTTTTCTCTTTGTCCATGG + Intronic
1029954260 7:104621057-104621079 CTGAGTTCTCATTTTGCCCCAGG - Intronic
1032642599 7:133786304-133786326 CAGGTCTCTCACTTTGGCCAGGG + Intronic
1032683288 7:134207593-134207615 CTGGGTTCTCACTGAGCCCCTGG - Intronic
1033397716 7:140991839-140991861 CTGGGCTCTTACTTTGTGCTTGG - Intergenic
1034140436 7:148810638-148810660 TTGGTTCCTCACTTTCTCCAAGG - Intronic
1038405772 8:27321481-27321503 CTAGGTTCAGACTATGTCCAGGG + Intronic
1038929665 8:32178657-32178679 CTGGACTCTGACTTTGCCCATGG - Intronic
1038974379 8:32676705-32676727 CTCTGTTCTCACCTTGTCCTTGG + Intronic
1041807072 8:61863361-61863383 CTTGGTTCTTGCTTTCTCCATGG - Intergenic
1042012041 8:64257421-64257443 CTGTGTCCTCAGTTTGTCAATGG + Intergenic
1042240899 8:66663208-66663230 CCGGGTTCTAAATTTGTGCAGGG + Intronic
1045236300 8:100355421-100355443 CTAGGTTTTCACTTTGTACTGGG + Intronic
1045809921 8:106209424-106209446 CAGGGGTCTCACTTTGTCACAGG - Intergenic
1047221000 8:122918083-122918105 CTGAGCTCTCACTTTGACCCAGG + Intronic
1048256750 8:132910620-132910642 CTGTCTTCTCACTGTGTCCATGG - Intronic
1048863933 8:138745319-138745341 CTGGGTTCTCACCTTCCACAGGG - Intronic
1049076092 8:140397207-140397229 CTGGGTTACCACTGTGTCAAAGG + Intronic
1049261077 8:141639534-141639556 CTTGGTCTTCACTTTGTCCCTGG + Intergenic
1051351669 9:16203575-16203597 CTGTGTCCTCACTTTGCCCCTGG + Intergenic
1051498866 9:17755491-17755513 ATGGGGTCTCACTTTTTCCCAGG + Intronic
1056064902 9:82923909-82923931 CTTGTTTCTCCCTTTGTCTATGG + Intergenic
1057057790 9:91977315-91977337 CTGTGTTCTCACTTAGTGGAAGG - Intergenic
1057086324 9:92214145-92214167 CTGGGTTGTCAGTGTCTCCAAGG + Intronic
1057401224 9:94725493-94725515 CTACTTTCTCACTTTCTCCAAGG + Intergenic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1058799132 9:108527906-108527928 TTGGGTGCTCACTTTGTTCCAGG - Intergenic
1059091313 9:111361561-111361583 CTGGGTTCTGACTTTGGCACAGG + Exonic
1060056729 9:120420436-120420458 CTGGGCTCTCACATTCTCCTGGG - Intronic
1060929263 9:127478705-127478727 CTGGGCTGTCACTGTGTGCATGG - Intronic
1061216358 9:129224167-129224189 CTGGGGCCTCTCTTTGTTCAGGG + Intergenic
1061233930 9:129331449-129331471 CTGGGTGCTCACTCTGTACCAGG + Intergenic
1062272404 9:135715531-135715553 CGGGGTTGTCACTGTCTCCAGGG + Intronic
1203770202 EBV:46070-46092 CTGGCTTTTCAGATTGTCCACGG + Intergenic
1187358800 X:18604771-18604793 CTTGGCTCTCACTTTGTCACGGG - Exonic
1188980610 X:36723770-36723792 CTGGGTGCTCACTTGACCCATGG - Intergenic
1189767116 X:44383105-44383127 CTGGGTTCTCTCTTGCTTCATGG - Intergenic
1192359869 X:70432686-70432708 CTGGGTCCTTACTTTCTCCAGGG + Intronic
1195221543 X:102748935-102748957 CTTGGTTCTCAATGTGTCCTAGG - Exonic
1195420187 X:104666816-104666838 CTGGGTGCTAGCTTTCTCCAGGG - Intronic
1195974615 X:110512923-110512945 CTAGGTTCTGAATTTATCCAAGG - Intergenic
1196538536 X:116877334-116877356 GTGGATTATCACTTTGTCGACGG + Intergenic
1199702984 X:150399037-150399059 GTGGCTTCCCACTTTCTCCAGGG - Intronic
1199825334 X:151493074-151493096 CTGAGTGCTTACTTTGTCCCTGG - Intergenic
1200818537 Y:7558011-7558033 CTGGGTTTTCACTCTGCCCCGGG - Intergenic
1201470173 Y:14324550-14324572 CTGGCTTCTCAAGTTGTCAAAGG - Intergenic