ID: 1162043592

View in Genome Browser
Species Human (GRCh38)
Location 19:7984826-7984848
Sequence GTTTCTATTGGAGGCAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162043592_1162043597 17 Left 1162043592 19:7984826-7984848 CCACCTTTGCCTCCAATAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1162043597 19:7984866-7984888 TAAGCCACCACTGACTGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162043592 Original CRISPR GTTTCTATTGGAGGCAAAGG TGG (reversed) Intronic
900253128 1:1682105-1682127 AGTTCTATGGGAGGCCAAGGCGG - Intronic
901135054 1:6987712-6987734 GTTGCTATTGGATGCAATGTGGG + Intronic
903968293 1:27102997-27103019 GTTTCAAATGGAGGCAGAGATGG + Intronic
906031564 1:42724415-42724437 GTTATTATTAGAGACAAAGGAGG + Intergenic
907073331 1:51557216-51557238 CTTTCTCTTGGAGGCAAGGTTGG - Intergenic
908391987 1:63691596-63691618 GTTTGTCTGGGAGGCCAAGGCGG + Intergenic
908785450 1:67730622-67730644 GTTTCCTTTGAAGGGAAAGGTGG + Intronic
910261151 1:85294915-85294937 GTTCCTTTGGGAGGCCAAGGCGG - Intergenic
911070806 1:93830549-93830571 TTTTCTCTTGGAGGCAGGGGCGG - Intronic
913077103 1:115349762-115349784 GTTTGTATTGGAAGAAAGGGAGG + Intergenic
915056368 1:153134424-153134446 GTTTCTAGTGGTGGCAGTGGGGG - Intergenic
918038049 1:180894629-180894651 ATTTCTATGGGAGACAATGGAGG + Intergenic
919160000 1:193816702-193816724 GTTTCTAATGGATGAAAAAGTGG - Intergenic
919853055 1:201686715-201686737 GGCTCTTTAGGAGGCAAAGGTGG - Intronic
920794320 1:209124019-209124041 GTTCCAACTGGAGGCAGAGGTGG - Intergenic
920873130 1:209810564-209810586 ATCTCTATGGGAGGCGAAGGAGG + Intergenic
924552993 1:245095640-245095662 GGTTCTTTGGGAGGCCAAGGTGG - Intronic
1063669330 10:8087359-8087381 GTTTCTATTTGAGGTTGAGGAGG - Intergenic
1066342680 10:34551493-34551515 GTTGCAATTGGAATCAAAGGTGG - Intronic
1069088199 10:64166697-64166719 ACTTCTACTGGAGGGAAAGGGGG + Intergenic
1070356820 10:75647976-75647998 GTATCATTTGGAGGCAAGGGTGG - Intronic
1072536566 10:96368828-96368850 GGTTCTAGTGGAGCCAAAGTGGG + Intronic
1072672547 10:97441458-97441480 GTTACTATGGGAAACAAAGGTGG + Intronic
1075548327 10:123373126-123373148 GGTTATATTGGAGGAAGAGGGGG - Intergenic
1075588344 10:123673547-123673569 GTTACAGTTGGAGGCACAGGTGG + Intronic
1076792163 10:132783002-132783024 GTTTCTATTGGAAGCAAACTAGG - Exonic
1078963898 11:16314113-16314135 CTTTATATTGAAGGCAATGGAGG - Intronic
1080033742 11:27689084-27689106 GTCTCTGCTGGAGACAAAGGTGG + Intronic
1080471896 11:32553940-32553962 AGTTCTATAGGAGGCTAAGGTGG - Intergenic
1080763093 11:35271594-35271616 GTTTCTCTGGGAGGCTGAGGTGG + Intronic
1083562060 11:63681064-63681086 GTTTTTATTGGAGTCACAGGTGG + Intergenic
1083931101 11:65846022-65846044 AGTTCTATGGGAGGCCAAGGTGG + Intronic
1084054699 11:66624883-66624905 GTTACCATAGGAGGCAAGGGAGG - Exonic
1084096693 11:66916002-66916024 GTTTGTTTTGGAGGGTAAGGAGG - Intronic
1084871558 11:72102073-72102095 GTTTGTATGGGAAGCAAGGGTGG - Intronic
1085692765 11:78677500-78677522 ATTGCTTTTGGAGGCTAAGGTGG - Intronic
1086320398 11:85640910-85640932 GTTTCTATTGGAGGCCCCGAAGG - Intergenic
1092263779 12:6966006-6966028 TTTTCTCTTGGGAGCAAAGGAGG - Intronic
1092605930 12:10118698-10118720 GTTTCTATTATTGGAAAAGGAGG + Intronic
1092927459 12:13284608-13284630 GTTTCTCTAGGATGCAAAGGAGG - Intergenic
1092930371 12:13309857-13309879 ATGTCTATTGGAGGGGAAGGAGG - Intergenic
1094589525 12:31807450-31807472 TTTTCTCTTGCAGGCATAGGTGG - Intergenic
1094625172 12:32116710-32116732 GTTTTTACTGGAGGCTCAGGTGG + Intronic
1094723348 12:33088025-33088047 TTTTCTCTTGCAGGCAGAGGCGG + Intergenic
1097369832 12:58764556-58764578 TTTTCTTTGGGAGGCAAAGGTGG + Intronic
1097479743 12:60107861-60107883 GTTACTTTGGGAGGCCAAGGCGG - Intergenic
1099461614 12:82928848-82928870 TTTTCCATTGGAAGCAAAGAAGG + Intronic
1100366631 12:93927299-93927321 GCTTCTTTTGGAGGCATAGACGG + Intergenic
1100497597 12:95140371-95140393 CTTTCTTTGGGAGGCCAAGGCGG + Intronic
1100885226 12:99062681-99062703 GTTTGTATGGGAAGAAAAGGGGG + Intronic
1102564259 12:113784710-113784732 GTTTTTAGTGGATGCAAAAGCGG - Intergenic
1103028217 12:117591450-117591472 GTTACAATTGGAGGCAGTGGTGG + Intronic
1103078597 12:118005397-118005419 ACTTCTCTTGGAGGAAAAGGAGG + Intergenic
1104527835 12:129540735-129540757 GTTACTTTAGGAGGCCAAGGTGG - Intronic
1105061184 12:133152525-133152547 GGTTCTTTGGGAGGCTAAGGCGG - Intronic
1105675820 13:22670841-22670863 GGTTCTCTTGGAGACAAAGTAGG + Intergenic
1106179168 13:27356302-27356324 GTCTCCATGGGAGGCAAATGTGG - Intergenic
1109043373 13:57373214-57373236 GTTTTTACTTGAGGCAAAGTTGG - Intergenic
1111864827 13:93755362-93755384 GCTTCTATAGGAGGCAAAAGTGG - Intronic
1112633445 13:101187354-101187376 GTTTCCCTTGGGGACAAAGGAGG + Intronic
1114282254 14:21204012-21204034 GTTTGTGTAGGACGCAAAGGGGG + Intergenic
1116527425 14:45923596-45923618 TTTTCTTTGGGAGGCTAAGGTGG + Intergenic
1117073217 14:52074884-52074906 GTCTCTCTTGCAGCCAAAGGTGG + Intergenic
1117360526 14:54968791-54968813 AATACTTTTGGAGGCAAAGGTGG + Intronic
1117431170 14:55663317-55663339 GATTCTCTTGGAGGCGAAAGAGG - Intronic
1119176621 14:72573240-72573262 GCTTCTATTGGACACAAAGTGGG - Intergenic
1121964194 14:98289099-98289121 CTTTCCATATGAGGCAAAGGGGG - Intergenic
1125385357 15:39130936-39130958 GTCTCAACTGGAGGCAAAGGTGG - Intergenic
1125758605 15:42082666-42082688 GTTTCTAATGCAACCAAAGGTGG + Intronic
1128019541 15:64378516-64378538 CCTTCTTTTGGAGGCGAAGGCGG - Intronic
1129860637 15:78858339-78858361 GGTTCTTTTGGAGGCCGAGGCGG + Intronic
1135037318 16:19089162-19089184 CTTCCTATTAGAAGCAAAGGTGG - Intergenic
1135180693 16:20271644-20271666 GTTTCTCTGGGAGGCAAACTGGG + Intergenic
1137657680 16:50174343-50174365 ATTACTTTGGGAGGCAAAGGTGG - Intronic
1138075252 16:54035930-54035952 GTTTTTGTTGGTGGCAGAGGTGG + Intronic
1141284608 16:82659924-82659946 GTGTCTCCTGGAGGGAAAGGGGG + Intronic
1142655335 17:1388656-1388678 ATTGCTTTTGGAGGCCAAGGTGG - Intronic
1142902144 17:3018699-3018721 GTTCCCATTTGAGGAAAAGGAGG + Intronic
1143491580 17:7288273-7288295 GTTTTTACTGGAGGCTCAGGTGG + Exonic
1144323811 17:14157607-14157629 GTTTCTGTTGGAAGCAACTGTGG - Intronic
1145180117 17:20742042-20742064 GTTTGTAGTCGAGGAAAAGGTGG - Intergenic
1146818982 17:35969331-35969353 TTTTCTTTGGGAGGCAGAGGTGG - Intergenic
1147294533 17:39471486-39471508 GCTGGTATTGGAGGCAAAGGTGG - Exonic
1149032907 17:52104135-52104157 CTTTGTATGGGAGCCAAAGGAGG - Intronic
1149460032 17:56821168-56821190 GTTCCTTTGGGAGGCCAAGGGGG - Intronic
1149839831 17:59951749-59951771 GTTTGTAGTCGAGGAAAAGGTGG - Intronic
1158426950 18:57348832-57348854 GTTCCTTTGGGAGGCAGAGGCGG - Intergenic
1159546065 18:69840267-69840289 GTTTCTATTTTACCCAAAGGAGG - Intronic
1159573702 18:70149478-70149500 GTCTCTTTTGGATGAAAAGGTGG - Intronic
1160924259 19:1535544-1535566 GTTTCTCTTAGTGGCAGAGGTGG + Intergenic
1162043592 19:7984826-7984848 GTTTCTATTGGAGGCAAAGGTGG - Intronic
1162643154 19:12028936-12028958 ATTGCTTTTGGAGGCCAAGGTGG - Intronic
1163101022 19:15096603-15096625 GTTGCTTTGGGAGGCCAAGGAGG - Intergenic
1163161257 19:15465455-15465477 GTTTCTTTTGGAGGCACTGGTGG + Intergenic
1163298344 19:16427175-16427197 TTTTCTGTCGGAGGCCAAGGGGG + Intronic
1165638288 19:37362572-37362594 GTGTCTTCTGGAGGCTAAGGAGG - Exonic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
928233270 2:29518416-29518438 GTTTTTCTTGCAGGCAAAGAAGG - Intronic
929291243 2:40194600-40194622 CTTAATATTGGAGGCAAATGAGG + Intronic
930104611 2:47630195-47630217 CTCTCTGTTGGTGGCAAAGGAGG - Intergenic
930149892 2:48048488-48048510 GTTTCTTTGGGAGACAAAGAGGG + Intergenic
933492053 2:82997756-82997778 TCTTCTATTTGAGGCAAAGAGGG - Intergenic
933834606 2:86235547-86235569 GTTGCTATTGAAAGCAGAGGTGG + Intronic
934112574 2:88756873-88756895 GTCTCTTCAGGAGGCAAAGGGGG + Intergenic
935383215 2:102474809-102474831 GTTTATAGCTGAGGCAAAGGAGG - Intronic
936163783 2:110103334-110103356 GTCTCTTCAGGAGGCAAAGGGGG + Intronic
937143004 2:119618143-119618165 GTGTGTATAGGAGGCAAAGTGGG - Intronic
937440173 2:121908546-121908568 GTTTCCCTAGGAGGCTAAGGAGG - Intergenic
937736872 2:125301930-125301952 GTTACTTTGGGAGGCCAAGGCGG - Intergenic
941075797 2:161005122-161005144 GTAGCTATTTGAGGCAAAGATGG - Intergenic
941213964 2:162682169-162682191 TTTTGAATTGGAGGGAAAGGAGG - Intronic
941369207 2:164643495-164643517 GTTTGTATTTGAGGAACAGGAGG - Intergenic
943292764 2:186095987-186096009 TTTTTTATTGAAGGTAAAGGAGG + Intergenic
944512153 2:200475430-200475452 GGGACTACTGGAGGCAAAGGCGG + Intronic
946082026 2:217128781-217128803 CTTTCTGTTGGTGGCAATGGTGG - Intergenic
946956633 2:224937543-224937565 GATTCTACTGGAGGCAAAAATGG + Intronic
948343827 2:237278776-237278798 GTTTCCAAAGGAGGCAAATGAGG + Intergenic
1170159866 20:13299780-13299802 GTTTCAAAGAGAGGCAAAGGGGG + Exonic
1171120580 20:22565423-22565445 TTTTATATTGGAGGTAAAGAGGG + Intergenic
1173985981 20:47261822-47261844 ATTACTTTTGGAGGCAGAGGTGG + Intronic
1176911942 21:14576612-14576634 GTTTCAGTTGGAGGAACAGGTGG - Intronic
1177041278 21:16114471-16114493 GTTTCTTTGGGAGGCCGAGGTGG - Intergenic
951525392 3:23648137-23648159 GCTTCTGTTGGAGGCACAGCGGG - Intergenic
951613591 3:24519474-24519496 GTTTCACTTTGAAGCAAAGGGGG - Intergenic
952407272 3:33015724-33015746 ATTTATACTGGAGGCAAAGGTGG + Intronic
953273043 3:41464803-41464825 GGTTCTTTAGGAGGCAGAGGTGG + Intronic
957299588 3:78374726-78374748 TTTTCTTGTGGAGGCGAAGGTGG - Intergenic
957648698 3:82970172-82970194 GTTTCTAAGAGAGGCAAAGGGGG - Intergenic
958878043 3:99638088-99638110 GTTTCTAAGCGAGGCAAGGGAGG - Intergenic
963660048 3:148114005-148114027 GTTCCTAAGGGAGGAAAAGGGGG + Intergenic
963802348 3:149688441-149688463 GATTCTATTTGAGGGAAAGTAGG + Intronic
966181650 3:177194142-177194164 GTTTCTATTGGTGGCAGAGCAGG + Intronic
977101811 4:92825690-92825712 GTTTCTGTTGGGGGCGGAGGTGG - Intronic
977385350 4:96332440-96332462 GTTCCTTTGGGAGGCCAAGGTGG + Intergenic
981355985 4:143789561-143789583 GTTTCTATTGGCTGCAAAATTGG + Intergenic
981473993 4:145169717-145169739 GGTACTATAGGAGGCAGAGGCGG - Intronic
983180369 4:164641565-164641587 GTATCTTTGGGAGGCCAAGGCGG + Intergenic
983889950 4:173020474-173020496 GTTTCTATTGGAATCAAGGGAGG + Intronic
986332520 5:6727776-6727798 GTTTATATGGGAGGGACAGGGGG - Intronic
989341535 5:40380918-40380940 GTTTCTTATGAAGACAAAGGTGG - Intergenic
989454783 5:41630720-41630742 GATTGTTTTGGTGGCAAAGGAGG + Intergenic
989485507 5:41986383-41986405 CTTTCACTTGGAGGCACAGGTGG + Intergenic
990032284 5:51276221-51276243 GCTGCTATTAGAGGCAAGGGTGG + Intergenic
990568594 5:57055129-57055151 GGTACGATGGGAGGCAAAGGAGG - Intergenic
991703460 5:69336245-69336267 GTTCCTGTTGGAGGCAAATGTGG + Intergenic
992385896 5:76284535-76284557 GTTGCTCTTTGAGGCACAGGTGG - Intronic
1005255681 6:24000400-24000422 GTTTCAATTTGAGGCAAGGCTGG - Intergenic
1008320209 6:50103130-50103152 GTTTTTATTGGATCCAAAGATGG + Intergenic
1008500612 6:52177796-52177818 CTTCCTATTACAGGCAAAGGAGG + Intergenic
1010021821 6:71169220-71169242 GTTTCTTTTGGAAAAAAAGGAGG + Intergenic
1012510499 6:99995824-99995846 ATTTCTATTGGTGTCAATGGAGG + Intergenic
1013031666 6:106339643-106339665 CTGTTTATTGGAGGCAAAAGAGG - Intergenic
1014917236 6:127166374-127166396 CTTTCTATCAGAGGAAAAGGAGG + Intronic
1017234687 6:152106941-152106963 TTTTGTATTGGAAGCAATGGAGG - Intronic
1020036778 7:4968598-4968620 GCTCCCATTGGCGGCAAAGGAGG - Intergenic
1020152108 7:5690543-5690565 GTTTCTAGGGGAGGTGAAGGTGG - Intronic
1020164583 7:5797893-5797915 GCTCCCATTGGTGGCAAAGGAGG + Intergenic
1021458264 7:20855232-20855254 TTTTCTATATGCGGCAAAGGAGG + Intergenic
1023462179 7:40410672-40410694 ATTTCTCTAGGAGGCATAGGTGG + Intronic
1023732444 7:43205328-43205350 GTTTGTTTGGGAGGCCAAGGCGG - Intronic
1023931889 7:44711264-44711286 GTTTCTGCTGGAGGAAAGGGAGG - Intergenic
1024980923 7:55156984-55157006 GTTTCTCCTGCAGGCAAAAGGGG + Intronic
1026937561 7:74267305-74267327 GTTTCTTTGGGAGGCTGAGGTGG + Intergenic
1029465415 7:100721667-100721689 GTACCTCTTGGAGGCCAAGGAGG + Exonic
1031026588 7:116686154-116686176 GTTTTTATTGGAGTGAAATGGGG - Intronic
1031604745 7:123755414-123755436 GTTTTTATTTGAATCAAAGGTGG - Intergenic
1033969654 7:147024440-147024462 GTTATTATTGGAGGAAACGGGGG + Intronic
1035149486 7:156856322-156856344 GTTTTTACTGGAGGCACAGGTGG + Intronic
1038396445 8:27249141-27249163 GTTTTGATTGGAGGCAGACGTGG + Intronic
1040632539 8:49232419-49232441 GTTTCAAGTGGAGGCAAATTAGG + Intergenic
1042497057 8:69466885-69466907 TTTGCTTTTGGAGGAAAAGGAGG + Exonic
1044848665 8:96406731-96406753 GTTTATTTGGGAGGCCAAGGCGG + Intergenic
1046027355 8:108740903-108740925 GTTTGTATTGGAAGAAAAGCTGG + Intronic
1046863563 8:119121270-119121292 GTATCTATTGGAGGCCAGTGTGG + Intergenic
1047609718 8:126509172-126509194 GATTTTATGGGAGCCAAAGGAGG - Intergenic
1048660307 8:136592415-136592437 GTTTCCACTGAAGGAAAAGGAGG + Intergenic
1049972425 9:833047-833069 GTTTGGATTGGAGGAACAGGAGG - Intergenic
1051114558 9:13679540-13679562 GTTTCGTTGGGAGGCCAAGGCGG - Intergenic
1051282727 9:15458677-15458699 GTTGCTTTTGGAGGCTGAGGTGG + Intronic
1051960454 9:22755105-22755127 GTCTCTATTGTAGTCAAAAGAGG - Intergenic
1052281705 9:26740772-26740794 GTTCCTCTGGGAGGCAGAGGTGG + Intergenic
1052352659 9:27473310-27473332 GTGTCTGAGGGAGGCAAAGGGGG + Intronic
1052354268 9:27488174-27488196 GTATCCATGGGAGGCAGAGGAGG + Intronic
1056241909 9:84656020-84656042 GGTCCTATAGGAGACAAAGGAGG - Intergenic
1059748242 9:117223497-117223519 GTGTCTATTGGTGGGGAAGGGGG + Intronic
1059763393 9:117360883-117360905 GTTTCTATTAGAAGCAAAGAAGG - Intronic
1059899637 9:118909303-118909325 GATTCTTTTGCAGGTAAAGGGGG - Intergenic
1062270700 9:135707035-135707057 GGTGCTTTTGGAGGCTAAGGCGG + Intronic
1188200089 X:27286398-27286420 TTTTCTATTGCAGGCAGGGGTGG + Intergenic
1189029693 X:37437958-37437980 GTTTCTATGGGAGGCTGAGGTGG + Intronic
1191123442 X:56929153-56929175 TTGTCTCTTGGATGCAAAGGCGG + Intergenic
1193258053 X:79373097-79373119 GTCTCTATTGAAGTAAAAGGAGG + Intergenic
1195097773 X:101522244-101522266 ATTTTTATTAGAGGCAAAGAAGG - Intronic
1199050026 X:143227325-143227347 GTTTCTATTGGAGGTGATGTGGG + Intergenic
1199103270 X:143831834-143831856 GTGTCTATTGGAGGCACAGAGGG + Intergenic