ID: 1162043995

View in Genome Browser
Species Human (GRCh38)
Location 19:7987039-7987061
Sequence CGGAAGGACATTCCTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162043991_1162043995 -4 Left 1162043991 19:7987020-7987042 CCATCAGGCTGGGAAAGTCCGGA 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1162043995 19:7987039-7987061 CGGAAGGACATTCCTGCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162043995 Original CRISPR CGGAAGGACATTCCTGCAGA GGG Intronic
900531237 1:3154504-3154526 AGGAAGGCCATTCCTGGAGGCGG - Intronic
903226649 1:21897499-21897521 AGGAAGGGCATTCCAGCAGAGGG - Intronic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
906265677 1:44427243-44427265 AGGAAGGACACTCCAGGAGAGGG + Intronic
907334378 1:53690738-53690760 GGAAAGGGCATTCCGGCAGAGGG + Intronic
908509182 1:64837564-64837586 CTTAAACACATTCCTGCAGAGGG - Intronic
911356583 1:96828402-96828424 GGGGAGGACATTCCAGCAGAAGG - Intergenic
920343179 1:205288515-205288537 CAGAGGGACCTTCCTGCAGCTGG - Intergenic
920850140 1:209623069-209623091 GGGAAGGACACCCCTGCAGCGGG + Exonic
922798573 1:228353517-228353539 AGGAAGGACATCTCTGCAGAGGG + Intronic
923405867 1:233659374-233659396 CTGAAGGACTTTCCTGAAGCTGG + Intronic
924592652 1:245418245-245418267 CCGGAGGACATTCCTGCTGACGG - Intronic
1063534852 10:6873390-6873412 GGGAGGGAGATGCCTGCAGAGGG - Intergenic
1064465211 10:15572807-15572829 TGGATGGACATTCTTCCAGAGGG - Intronic
1066095808 10:32070808-32070830 AGGTAGTACATTCCTGCAAAAGG - Intergenic
1066391155 10:34978286-34978308 TGGAGGGGCATTCCTGCAGAAGG + Intergenic
1069338721 10:67385758-67385780 AGGAACTACATTCCTACAGAGGG + Intronic
1071450218 10:85786772-85786794 AGGAAGGAGATTTGTGCAGAAGG + Intronic
1071492327 10:86144292-86144314 AGGAAGAACATTCCAGGAGAGGG + Intronic
1072284028 10:93895411-93895433 CAGAAGGACATTCACCCAGAGGG - Intronic
1076544660 10:131237158-131237180 GGGAAGAATATTCCAGCAGAGGG - Intronic
1080289082 11:30650923-30650945 AGGAATGTCATTCCTACAGAAGG - Intergenic
1080815537 11:35752757-35752779 GGGACGAGCATTCCTGCAGAGGG - Intronic
1081487817 11:43545578-43545600 AGGGAGGTTATTCCTGCAGAGGG - Intergenic
1085083035 11:73649214-73649236 GGGAAGGACCTTCAGGCAGAGGG - Intronic
1085478243 11:76801362-76801384 CAGAGGGACATTCCTGCATTTGG - Intergenic
1085694554 11:78692800-78692822 GGGAAGAGCATTCCCGCAGAGGG - Intronic
1086313021 11:85557320-85557342 TGGAAAAACATTCCTGCTGATGG + Intronic
1086544681 11:87953975-87953997 AGGAAAGACATTCCAGCAGGAGG + Intergenic
1086654566 11:89337357-89337379 TGGAAGAAAATTCCTGCAGGTGG - Intronic
1088689459 11:112312928-112312950 CGGAAGGACACCCTTGGAGAAGG + Intergenic
1089021196 11:115216717-115216739 GGGAAGGAAATTCCAGCACATGG + Intronic
1089117165 11:116104928-116104950 CTCAACGACATTCCTGAAGAAGG - Intergenic
1089527385 11:119106416-119106438 GGGAAGGAAATACCTGCAAAAGG - Intronic
1090409288 11:126496615-126496637 TGGAGGGACATTCCTGGAGAAGG + Intronic
1093788473 12:23219135-23219157 GGGGAGGATATTCCTGCAGGAGG + Intergenic
1094657620 12:32436018-32436040 CGGAAGGACATATCTGCTGTCGG + Intronic
1094671036 12:32569478-32569500 GGGAAGGGCTTTCCAGCAGATGG - Intronic
1095944859 12:47748063-47748085 TGGAAGGATATTGGTGCAGAAGG + Exonic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1100114526 12:91288065-91288087 GCTATGGACATTCCTGCAGAGGG + Intergenic
1101541589 12:105670457-105670479 GGGGAGGACATTTCAGCAGAGGG + Intergenic
1108855290 13:54786076-54786098 GGGAAAGACATTCCTGCTCAAGG - Intergenic
1111920447 13:94404592-94404614 CTGAAGCACACTCATGCAGAAGG - Exonic
1114701177 14:24680045-24680067 AGAAAGGACATTCCTGCAGGTGG - Intergenic
1118339132 14:64879951-64879973 AGGAGGGACATTCCTGCCGGGGG + Intergenic
1118991604 14:70801827-70801849 GGGAAGGACAATCAGGCAGACGG + Intronic
1119912543 14:78363095-78363117 GGGAAGGTCATTCCTGCTGCAGG + Intronic
1121448979 14:93996020-93996042 GGGAAGGGCATTCTGGCAGAAGG - Intergenic
1124034304 15:26039791-26039813 TGCAAGGAGACTCCTGCAGAAGG - Intergenic
1125238847 15:37550090-37550112 CTGAATGACCTGCCTGCAGAGGG - Intergenic
1128095199 15:64949049-64949071 CGTGAGGACATGCCTGCTGAGGG + Intronic
1128893602 15:71352883-71352905 TGGAAGGACATTCTAGGAGAAGG + Intronic
1131184690 15:90264717-90264739 CAGAAGGACAAGCCAGCAGAAGG + Exonic
1132020964 15:98362090-98362112 AGGTAGGCCATTGCTGCAGATGG + Intergenic
1134245210 16:12534644-12534666 CTGAAGGAGTTCCCTGCAGACGG + Intronic
1134914306 16:18056989-18057011 GGGAAGGGCATTCCTGGAAAAGG - Intergenic
1135825099 16:25720186-25720208 AAGAAGGACATTCCAGCTGAGGG + Intronic
1138483153 16:57317415-57317437 AGGAAGGACTTTCCTGTAGGAGG + Intergenic
1139788212 16:69411323-69411345 GGGGAGACCATTCCTGCAGAGGG + Intergenic
1140895565 16:79321547-79321569 AGGAAGGGCATTTCAGCAGAGGG + Intergenic
1142057813 16:88010883-88010905 CGGAATGCCATTCGTGCACATGG + Intronic
1142482137 17:225621-225643 CAGGAGGACAGTCCTGCGGAGGG + Intronic
1144959285 17:19035831-19035853 AGGAATGGCATCCCTGCAGAGGG - Intronic
1144975874 17:19138693-19138715 AGGAATGGCATCCCTGCAGAGGG + Intronic
1145817970 17:27809076-27809098 GGGAAGGACATTCCAGCAACAGG - Intronic
1146231195 17:31111645-31111667 CTGAAGGATATTTCTGCTGAAGG - Intronic
1146849011 17:36205911-36205933 CAGAAGGTCATACCTGTAGAGGG + Intronic
1148144541 17:45354661-45354683 GGAAAGGACATTCCTGAGGAGGG + Intergenic
1151950501 17:77350917-77350939 AGGAAGGGCTTTCCTGCAGGGGG + Intronic
1152774380 17:82191313-82191335 CAGACAGACACTCCTGCAGAAGG + Intronic
1154165987 18:12014855-12014877 CGGCAGGCCATAACTGCAGAGGG - Intronic
1159289966 18:66404352-66404374 CTGAAGGAAATTTCTGGAGAAGG + Intergenic
1160178054 18:76612201-76612223 CGGAAGACCACTCCTGCGGAGGG - Intergenic
1160484381 18:79275470-79275492 GCTAAGGACATTCCTGCAAATGG - Intronic
1160879837 19:1314372-1314394 AGGAAGGGCGTTCCTGCAGGGGG + Intergenic
1161243353 19:3235165-3235187 GGGAAGAACATTTATGCAGAGGG - Intronic
1162043995 19:7987039-7987061 CGGAAGGACATTCCTGCAGAGGG + Intronic
1162467206 19:10849382-10849404 GGGAAGGGCATTCCAACAGAGGG - Intronic
1163472217 19:17504330-17504352 GGGAAGAACATTCCTGCCCAGGG + Intronic
1164483785 19:28637451-28637473 CTGGAGGAATTTCCTGCAGAGGG - Intergenic
1164617876 19:29677472-29677494 GGAGAGGACATTCCAGCAGAGGG + Intergenic
1165306667 19:35006929-35006951 TGGAAGGACATTCAGGCGGAGGG + Intronic
1166849750 19:45753845-45753867 AGTAAGGACATCCCTGGAGAAGG - Intronic
1167218977 19:48184986-48185008 CACAGGGACAATCCTGCAGAGGG - Intronic
927558727 2:24053900-24053922 AGGAAGGACATTCCCCAAGAAGG + Exonic
927892358 2:26759716-26759738 CAGAAGGGCTTTCTTGCAGATGG - Intergenic
932766268 2:74472454-74472476 CCGTAGGACCTTCCTGCAGACGG - Exonic
933180594 2:79222361-79222383 CTGAACCAGATTCCTGCAGAAGG - Intronic
933984626 2:87580516-87580538 AGTGAGGACATTCCTGCAGATGG - Intergenic
934612425 2:95751263-95751285 GGGAAGGACATCCAGGCAGAGGG - Intergenic
934648494 2:96073160-96073182 GGGAAGGACATCCAGGCAGAGGG + Intergenic
934841728 2:97628184-97628206 GGGAAGGACATCCAGGCAGAGGG + Intergenic
936089916 2:109494884-109494906 AGGAAGGACATTCAAGTAGAAGG + Intronic
936309225 2:111370284-111370306 AGTGAGGACATTCCTGCAGATGG + Intergenic
937993606 2:127677485-127677507 CGGAATGCTTTTCCTGCAGATGG - Intronic
939538110 2:143458501-143458523 GGGAAGGAGATTCCTGCTGAAGG + Intronic
941842797 2:170105838-170105860 GGGAAGAACATTCTAGCAGAGGG + Intergenic
942547739 2:177082039-177082061 AGGAAGGATATTGGTGCAGAGGG - Intergenic
948131311 2:235602540-235602562 CGGAAGGGCACTCAGGCAGAGGG - Intronic
948374978 2:237515449-237515471 AGGGAGGAGTTTCCTGCAGAGGG + Intronic
1170621424 20:17999681-17999703 AGGAAGAATATTCCAGCAGAAGG + Intronic
1170678328 20:18502733-18502755 CTGCAGGACATTTCTCCAGACGG + Intergenic
1172013085 20:31857783-31857805 AGGAGGGACATTCCTGCAGGAGG + Intronic
1172052853 20:32132435-32132457 GGGAAGGGCATTCCACCAGAAGG + Intronic
1172181723 20:33007844-33007866 TGGAAGGACCCTTCTGCAGAGGG - Intronic
1172234430 20:33360748-33360770 TGGAGGTCCATTCCTGCAGAAGG - Intronic
1172762542 20:37332520-37332542 AGGAAGGACATCCCAGCAGAGGG + Intergenic
1172796865 20:37546175-37546197 GGGAAGAGCATTCCAGCAGAGGG - Intergenic
1175533658 20:59692117-59692139 CGGAAGGAAGTTCTTTCAGAGGG + Intronic
1179134416 21:38667256-38667278 GGGAAGGACATTCCAGGACAAGG - Intergenic
1179146511 21:38773181-38773203 GGCAATGACATTCATGCAGAAGG - Intergenic
1183309009 22:37099220-37099242 GGGAAGTACCTTCCAGCAGAGGG + Intronic
1183468149 22:37990461-37990483 AGGAAGGGCATTCCAGCAGCTGG - Intronic
949163630 3:911294-911316 TGTAAATACATTCCTGCAGAGGG + Intergenic
950721288 3:14884508-14884530 GGGTAGGACCTTCCAGCAGAGGG - Intronic
950723454 3:14900668-14900690 CGGGAGGACATCCCGTCAGAGGG + Intronic
951742516 3:25940149-25940171 CTGAGGGCAATTCCTGCAGAGGG - Intergenic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
955088800 3:55729298-55729320 GGGAAGGATTTTCCAGCAGACGG - Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
961766839 3:129218102-129218124 TGGAAGGACGCTCCTTCAGATGG - Intergenic
962349850 3:134648738-134648760 CAGAAGGCCCTTCCAGCAGAAGG + Intronic
964374204 3:156033621-156033643 CGGAAGGGGATTCGTTCAGAGGG + Intergenic
964409256 3:156381260-156381282 AGGATGGACATTTCTGCAAAAGG + Intronic
966245604 3:177804642-177804664 GGGAAGAACATTTCAGCAGAGGG + Intergenic
966301375 3:178483176-178483198 CGGAAGTGCATTCCTGGATATGG + Intronic
967000112 3:185326149-185326171 GGGACGGACATTCCAGCAGGAGG - Intronic
967011517 3:185439242-185439264 GGAAGGGACATTCATGCAGAGGG + Intronic
967309276 3:188090762-188090784 TGGAAGAACAGGCCTGCAGAGGG - Intergenic
969292322 4:6247960-6247982 AGGAAGGATTTACCTGCAGATGG + Intergenic
975247751 4:72139884-72139906 CGGAAGAACATTCATGCTCATGG - Intronic
976414221 4:84753052-84753074 CTGAAGCACATTTTTGCAGAGGG - Intronic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
979591829 4:122490160-122490182 GGGAAAGATATTCCTGTAGATGG + Intergenic
988031980 5:25773902-25773924 CTAAAGGAAATTCCTCCAGAAGG + Intergenic
994572881 5:101536314-101536336 CTGAAGAACATTCCAGCATAAGG + Intergenic
995589166 5:113680716-113680738 GGGAAGCACATTCCAGAAGAAGG - Intergenic
995591219 5:113701732-113701754 GGAAAGAACATTCCTACAGAAGG - Intergenic
996826472 5:127687508-127687530 AGGAAGGACATTCATGTAGAGGG + Intergenic
998500775 5:142630705-142630727 GGGAAGGGCACTGCTGCAGAGGG - Intronic
999663571 5:153890435-153890457 TGGAAGGGCATTCATGCAGAGGG + Intergenic
1000187270 5:158871497-158871519 CAGAAAGTCATTCTTGCAGATGG + Intronic
1001570343 5:172726733-172726755 GGGAAGGGCATTCCAGCAGAGGG - Intergenic
1001756198 5:174172290-174172312 CCTAATGACATTCCTGAAGATGG + Intronic
1002359174 5:178656591-178656613 CAGACGGACATTCCAACAGATGG + Intergenic
1002456860 5:179350296-179350318 TGGAAGGACATTGCCACAGAGGG - Intergenic
1002865112 6:1115036-1115058 AGGAAGGACATTACTGCAGCTGG - Intergenic
1006033545 6:31195158-31195180 CTGAAGGAAATTCCTGTTGATGG - Intergenic
1007640228 6:43332384-43332406 TGGTAAGACATTCCTGAAGAAGG + Intronic
1007727808 6:43927228-43927250 CTGAGGGACATTCCAGCAGAGGG - Intergenic
1015816541 6:137217440-137217462 GGGAAGGACATTCTCGTAGAGGG - Intronic
1018199867 6:161384711-161384733 GTAAAGGACATTCCAGCAGAGGG - Intronic
1021213477 7:17886227-17886249 CTGAAGGATCTTCCTGTAGAGGG - Intronic
1022033459 7:26513162-26513184 GGGAAGGGCATTCCAGCAGAAGG + Intergenic
1022414706 7:30167973-30167995 CAGAAGGACGTTCCTGTAGGAGG + Intergenic
1023115144 7:36855227-36855249 AGGAAGGGCATGCCTGCAGAGGG + Exonic
1023358460 7:39391700-39391722 CTGAAGGACAGTACTGCAGAAGG - Intronic
1023964429 7:44955443-44955465 CAGAAGAATAATCCTGCAGATGG - Intergenic
1024167524 7:46749699-46749721 GAGAAGGACATCCCTGCAGAAGG + Intronic
1025095492 7:56092653-56092675 CTGTAGAAAATTCCTGCAGATGG + Intronic
1026931760 7:74226843-74226865 GGGAAGGACATCCAGGCAGAGGG + Intronic
1033288123 7:140059948-140059970 AGGAAGAACATTCCAGAAGAGGG + Intronic
1033774126 7:144587920-144587942 CAGAACTTCATTCCTGCAGAAGG + Intronic
1040905346 8:52463959-52463981 CTGAAGGGAAGTCCTGCAGAAGG + Intergenic
1042784893 8:72536700-72536722 CGGGAGGACAGCCCTGCAGTTGG + Intergenic
1043791116 8:84469078-84469100 CGGAAGGACATTCAAACCGAAGG - Intronic
1044946857 8:97397416-97397438 GGGAAGCACATTCCAGCAGAGGG - Intergenic
1045986400 8:108254284-108254306 AGGAAGAACATTCCTGGTGAAGG + Intronic
1049225070 8:141446504-141446526 GGGAAGAACATTCCAGCAGGGGG + Intergenic
1053286099 9:36850420-36850442 AGGAAGGACATTCTTGGGGAAGG + Intronic
1059177496 9:112180566-112180588 CAGAAGGGCATTTCTCCAGAGGG - Intergenic
1059925034 9:119200858-119200880 AGGAAGCACATTCAAGCAGAAGG + Intronic
1060088868 9:120725464-120725486 AGGAGGGAAATTCCTGGAGAGGG - Intergenic
1060179099 9:121520045-121520067 TGGAATGACATTGCTGCAGATGG - Intergenic
1060265835 9:122111042-122111064 AGGAAGGGCATTCCTGACGAAGG + Intergenic
1060461987 9:123865085-123865107 GGTGAGGACATTCCAGCAGAAGG - Intronic
1062453495 9:136625222-136625244 CAGCACGAGATTCCTGCAGATGG - Intergenic
1062514703 9:136926808-136926830 GGGAAGAACATTCCAGAAGAGGG - Intronic
1187176186 X:16898167-16898189 CACCCGGACATTCCTGCAGAAGG - Intergenic
1187778448 X:22790347-22790369 AGGAAAAACATTCTTGCAGAGGG - Intergenic
1188320346 X:28728834-28728856 TGGAAGGACATGACTCCAGAGGG - Intronic
1188434925 X:30148810-30148832 CGGGACGACCTGCCTGCAGACGG + Intergenic
1189579517 X:42390914-42390936 CGGAAGCATATTCCAGCCGAAGG - Intergenic
1190066655 X:47245963-47245985 GGGAACAACATTCCTGGAGAAGG - Intronic
1190471038 X:50779861-50779883 TGGAAGGACATTCCTGGAAGGGG + Intronic
1192226358 X:69230899-69230921 GAGAAGGACACTCCTGTAGAGGG - Intergenic
1192619487 X:72662887-72662909 GGGAAAGACTTTCCTGGAGATGG - Intronic
1197827859 X:130609356-130609378 GGGAAGGGCATTCCTGCACTGGG - Intergenic
1199113922 X:143967656-143967678 GGGATGAACATTCCGGCAGAGGG - Intergenic
1201623942 Y:15992621-15992643 AGAAAGGCCATTCCTGCAGAAGG - Intergenic