ID: 1162044287

View in Genome Browser
Species Human (GRCh38)
Location 19:7988407-7988429
Sequence TGCCAGAGGGTTATGCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044287_1162044298 24 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data
1162044287_1162044292 0 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044292 19:7988430-7988452 TAACCGGCTGAGTCAAAGGCTGG No data
1162044287_1162044297 23 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data
1162044287_1162044291 -4 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044291 19:7988426-7988448 GGCATAACCGGCTGAGTCAAAGG No data
1162044287_1162044299 25 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044299 19:7988455-7988477 AAAGGCGCTAAAGACAGATGGGG No data
1162044287_1162044293 1 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044293 19:7988431-7988453 AACCGGCTGAGTCAAAGGCTGGG No data
1162044287_1162044296 7 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044296 19:7988437-7988459 CTGAGTCAAAGGCTGGGGAAAGG No data
1162044287_1162044294 2 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044294 19:7988432-7988454 ACCGGCTGAGTCAAAGGCTGGGG No data
1162044287_1162044300 30 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162044287 Original CRISPR TGCCAGAGGGTTATGCTCAG AGG (reversed) Intronic