ID: 1162044289

View in Genome Browser
Species Human (GRCh38)
Location 19:7988420-7988442
Sequence ACTCAGCCGGTTATGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044289_1162044303 26 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044303 19:7988469-7988491 CAGATGGGGCATGGCCTCAGGGG No data
1162044289_1162044296 -6 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044296 19:7988437-7988459 CTGAGTCAAAGGCTGGGGAAAGG No data
1162044289_1162044298 11 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data
1162044289_1162044299 12 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044299 19:7988455-7988477 AAAGGCGCTAAAGACAGATGGGG No data
1162044289_1162044301 24 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044301 19:7988467-7988489 GACAGATGGGGCATGGCCTCAGG No data
1162044289_1162044302 25 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044302 19:7988468-7988490 ACAGATGGGGCATGGCCTCAGGG No data
1162044289_1162044297 10 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data
1162044289_1162044300 17 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162044289 Original CRISPR ACTCAGCCGGTTATGCCAGA GGG (reversed) Intronic