ID: 1162044295

View in Genome Browser
Species Human (GRCh38)
Location 19:7988433-7988455
Sequence TCCCCAGCCTTTGACTCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044295_1162044300 4 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG No data
1162044295_1162044299 -1 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044299 19:7988455-7988477 AAAGGCGCTAAAGACAGATGGGG No data
1162044295_1162044302 12 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044302 19:7988468-7988490 ACAGATGGGGCATGGCCTCAGGG No data
1162044295_1162044301 11 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044301 19:7988467-7988489 GACAGATGGGGCATGGCCTCAGG No data
1162044295_1162044304 25 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044304 19:7988481-7988503 GGCCTCAGGGGCAGTTAGACAGG No data
1162044295_1162044298 -2 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data
1162044295_1162044303 13 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044303 19:7988469-7988491 CAGATGGGGCATGGCCTCAGGGG No data
1162044295_1162044306 28 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044306 19:7988484-7988506 CTCAGGGGCAGTTAGACAGGTGG No data
1162044295_1162044307 29 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044307 19:7988485-7988507 TCAGGGGCAGTTAGACAGGTGGG No data
1162044295_1162044297 -3 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162044295 Original CRISPR TCCCCAGCCTTTGACTCAGC CGG (reversed) Intronic