ID: 1162044297

View in Genome Browser
Species Human (GRCh38)
Location 19:7988453-7988475
Sequence GGAAAGGCGCTAAAGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044290_1162044297 9 Left 1162044290 19:7988421-7988443 CCTCTGGCATAACCGGCTGAGTC No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data
1162044287_1162044297 23 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data
1162044295_1162044297 -3 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data
1162044289_1162044297 10 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data
1162044286_1162044297 24 Left 1162044286 19:7988406-7988428 CCCTCTGAGCATAACCCTCTGGC No data
Right 1162044297 19:7988453-7988475 GGAAAGGCGCTAAAGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162044297 Original CRISPR GGAAAGGCGCTAAAGACAGA TGG Intronic