ID: 1162044298

View in Genome Browser
Species Human (GRCh38)
Location 19:7988454-7988476
Sequence GAAAGGCGCTAAAGACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044286_1162044298 25 Left 1162044286 19:7988406-7988428 CCCTCTGAGCATAACCCTCTGGC No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data
1162044289_1162044298 11 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data
1162044290_1162044298 10 Left 1162044290 19:7988421-7988443 CCTCTGGCATAACCGGCTGAGTC No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data
1162044295_1162044298 -2 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data
1162044287_1162044298 24 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA No data
Right 1162044298 19:7988454-7988476 GAAAGGCGCTAAAGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162044298 Original CRISPR GAAAGGCGCTAAAGACAGAT GGG Intronic