ID: 1162044300

View in Genome Browser
Species Human (GRCh38)
Location 19:7988460-7988482
Sequence CGCTAAAGACAGATGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044295_1162044300 4 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA 0: 1
1: 0
2: 3
3: 14
4: 285
Right 1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG 0: 1
1: 0
2: 0
3: 5
4: 109
1162044287_1162044300 30 Left 1162044287 19:7988407-7988429 CCTCTGAGCATAACCCTCTGGCA 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG 0: 1
1: 0
2: 0
3: 5
4: 109
1162044290_1162044300 16 Left 1162044290 19:7988421-7988443 CCTCTGGCATAACCGGCTGAGTC 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG 0: 1
1: 0
2: 0
3: 5
4: 109
1162044289_1162044300 17 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162044300 Original CRISPR CGCTAAAGACAGATGGGGCA TGG Intronic
901219083 1:7572805-7572827 TGCTAAAGACAGAAGGGAAATGG + Intronic
902151337 1:14445813-14445835 CGCTAGAGACAAATGGGAGATGG - Intergenic
904029913 1:27527657-27527679 CGCTGGAGGCAGATGGCGCAGGG + Intergenic
905863313 1:41364187-41364209 CGTTAAAGGCAGATGTGTCAAGG - Intronic
906132692 1:43470315-43470337 TGCAAAAGCCAGATGGGGCATGG - Intergenic
906590151 1:47017454-47017476 AGCAAAAGACACATAGGGCAGGG + Intergenic
907271086 1:53291503-53291525 GACTAAAGACAGCTTGGGCAAGG - Intronic
909392271 1:75131719-75131741 CCCTAAAAACAGATGGGGGCAGG - Intronic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
920337237 1:205253246-205253268 TACTAAAGAAAGAAGGGGCATGG + Intronic
920711424 1:208298934-208298956 TGCTTAAGAGAGATGGGGCTGGG + Intergenic
921560393 1:216651259-216651281 CACAAAAGATACATGGGGCAAGG + Intronic
1063162620 10:3430648-3430670 AGCTCAAGACAGATGGGTGAAGG - Intergenic
1064489188 10:15832187-15832209 CGCTAAAGACAGTGTGGGAAGGG + Intronic
1064574433 10:16730059-16730081 CGCTCAAGGCAGAAGGGGAAGGG + Intronic
1070350892 10:75591352-75591374 AGTTAAAAACAGATGGGGCAAGG + Intronic
1071505204 10:86227838-86227860 GGCTAAGCACAGATGAGGCATGG - Intronic
1072619290 10:97068887-97068909 CTCTCAAGACATATGGGGCTGGG - Intronic
1073046373 10:100641343-100641365 CCCTAAAGACTGAGGGAGCATGG - Intergenic
1079315764 11:19406724-19406746 GGCTATAGGGAGATGGGGCAGGG - Intronic
1081875996 11:46408724-46408746 GACTAAAGTCAGATGGGGCTTGG + Intronic
1084544636 11:69808725-69808747 CTCTAGAGTGAGATGGGGCAGGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1091675465 12:2485939-2485961 CGCCAAGGACTGATGGTGCAGGG - Intronic
1093414174 12:18901319-18901341 TGTTAAAAACAGTTGGGGCAAGG + Intergenic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1099675676 12:85757784-85757806 CGTTAATGACAGGTAGGGCAGGG - Intergenic
1100605548 12:96149456-96149478 CGCTGAAGCGAGGTGGGGCAGGG - Intergenic
1104710043 12:130979203-130979225 CCCTAAGGACAGATGCCGCAGGG + Intronic
1106177174 13:27341457-27341479 CGGTAAAGAAAGATGGACCATGG - Intergenic
1106922424 13:34577692-34577714 AGGTAAAGAAAGATGGGGCCTGG + Intergenic
1114653237 14:24299943-24299965 CGCGAAGCACACATGGGGCAGGG + Exonic
1114654251 14:24306562-24306584 AGCTAAAGAGGGAAGGGGCATGG - Exonic
1117434685 14:55704502-55704524 GGATGAAGACAGATGGGGAAAGG + Intergenic
1120688552 14:87566534-87566556 CGCTTAATACATATGGGGTAGGG + Intergenic
1125118420 15:36122897-36122919 CGCAAAAGACTGGTGGGGAATGG + Intergenic
1130963803 15:88682332-88682354 CACCAAAGGCAGATGGGGAAGGG - Intergenic
1137695296 16:50457608-50457630 GACTAAAGACAGAAGGAGCATGG + Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1147806192 17:43133575-43133597 AGCTAAAGACAGACTGAGCAAGG - Intergenic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1149025337 17:52020794-52020816 GGGTAAAGAAGGATGGGGCAAGG - Intronic
1149623074 17:58060587-58060609 TGCTGAGGACAGATGGGGCTGGG - Intergenic
1151221056 17:72613435-72613457 CTCTGAAGTCAGACGGGGCAAGG + Intergenic
1152663563 17:81554062-81554084 CGCCAAGTACAGGTGGGGCACGG - Intergenic
1156263998 18:35469489-35469511 AGGAAAGGACAGATGGGGCATGG - Intronic
1157438752 18:47693554-47693576 CGCTAAAGACATCAGAGGCAAGG - Intergenic
1158005683 18:52669589-52669611 AGCAAAAGACAGATGAGACATGG - Intronic
1161707075 19:5827235-5827257 CACTAAAGAGGGATAGGGCATGG + Intronic
1161726593 19:5932953-5932975 TGCCAAAGGCAGATGGGACAAGG + Intronic
1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG + Intronic
1163026752 19:14517352-14517374 GGCTAAAGACACATGGTCCAGGG + Intronic
1163113524 19:15175947-15175969 CGCAGAGGACAGAAGGGGCAGGG + Intronic
1163114623 19:15181435-15181457 CTCTGATGACTGATGGGGCAGGG - Intronic
1165164255 19:33840395-33840417 CCCTACAGAAAGATGGGGAATGG - Intergenic
1165999641 19:39870713-39870735 GGCTACAGACAGAAGGGTCAGGG + Intronic
1166099150 19:40560679-40560701 GGCTAAAGACAGGATGGGCAAGG + Intronic
1167373970 19:49101557-49101579 CGCTAATGTCAGGTGTGGCAGGG - Intronic
926154359 2:10444354-10444376 CACTAAAGGCAAATGGGGCGGGG - Intronic
926546410 2:14246091-14246113 TGCAAAAGCCAGATGTGGCATGG + Intergenic
928228505 2:29475980-29476002 TGCTTCGGACAGATGGGGCAGGG + Intronic
928424546 2:31167203-31167225 CACAAAAGACAGATGGTGCCTGG + Intergenic
934040942 2:88127063-88127085 TGCTGAAGACAGCAGGGGCAGGG - Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1171328173 20:24314255-24314277 CTCTAAAGCCAGGTGGGGCAGGG + Intergenic
1172936578 20:38624783-38624805 GGCTAGAGAGTGATGGGGCAGGG - Intronic
1174144550 20:48442283-48442305 CTCAAACGACAGAAGGGGCAAGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176609946 21:8871694-8871716 AGAAAAAGACAGATGGGGAAAGG - Intergenic
1179732558 21:43375819-43375841 CCCTAAAGACAGAGGGTGCTTGG - Intergenic
1179788863 21:43744127-43744149 CCCTAAAGGCGGAAGGGGCAAGG + Intronic
1182497662 22:30721276-30721298 CCCAAAAGACAAATGGTGCATGG + Intronic
1183267812 22:36840099-36840121 CCCTCAGGACAGATGGGGCGTGG + Intergenic
1185242505 22:49754250-49754272 CCTTGAAGACACATGGGGCAGGG + Intergenic
953187608 3:40653148-40653170 GGCTGAGGGCAGATGGGGCAAGG + Intergenic
953811370 3:46115638-46115660 CTTTAAAGACAGAAGGGCCAGGG + Intergenic
955821221 3:62897690-62897712 TGCTAAAGACAGATAGTGCCAGG - Intergenic
959016380 3:101138909-101138931 GGCTGGAGAAAGATGGGGCATGG - Intergenic
961936370 3:130588754-130588776 TGCTAGAGTGAGATGGGGCAGGG + Intronic
962993469 3:140601700-140601722 AAATAATGACAGATGGGGCAGGG - Intergenic
967288603 3:187897598-187897620 CACTCAATACAGAGGGGGCAGGG - Intergenic
969631477 4:8341160-8341182 GCCTGAAGACAGATGGGGCCTGG - Intergenic
973712364 4:53642534-53642556 CTCTAAAGTCATATGTGGCACGG + Intronic
982367602 4:154597382-154597404 CGTTAAAGAAAACTGGGGCAGGG + Intergenic
986606182 5:9525491-9525513 AGCTAAGGACAGAAGGGACAAGG + Intronic
994055095 5:95405988-95406010 CTCTAAAGAAAGATTAGGCAGGG - Intronic
994490343 5:100434928-100434950 CTCTAAATAGAGATGGGGCTGGG - Intergenic
1001673106 5:173490852-173490874 CCCCAGAGACAGCTGGGGCATGG + Intergenic
1002253901 5:177945170-177945192 TGCTGAGGACAGGTGGGGCAGGG + Intergenic
1002653069 5:180718075-180718097 CACAAAACAGAGATGGGGCAGGG + Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1004607503 6:17207534-17207556 AGCTGATGACAGATGGAGCAAGG + Intergenic
1009008952 6:57820772-57820794 AGCTAAAGACAGATGGGATCTGG + Intergenic
1011087172 6:83554632-83554654 AGCTAAAGAAAAAGGGGGCATGG + Intronic
1012841430 6:104333493-104333515 CACTAAAGAGAGTGGGGGCAGGG - Intergenic
1013935206 6:115586192-115586214 CCTCAAAGAGAGATGGGGCATGG - Intergenic
1019001340 6:168755514-168755536 CGACATAGACAAATGGGGCAGGG - Intergenic
1019552209 7:1608628-1608650 AGCTGGAGACAGATGGGGCTTGG + Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1024048245 7:45599924-45599946 GGAAAAAGACAGATGTGGCAAGG - Intronic
1024298100 7:47862438-47862460 CGCTCAAGAGAGATGGGCAATGG - Intronic
1033663322 7:143418691-143418713 TGCAGAACACAGATGGGGCAAGG + Intergenic
1035417308 7:158700950-158700972 AGCTAGAGACAGGTTGGGCATGG - Intronic
1040610482 8:48977720-48977742 CGCTAAGGAGAGGTGGGGCCTGG - Intergenic
1044802556 8:95972272-95972294 GGCTGAAGACAGATGGTGCTGGG - Intergenic
1045049571 8:98310472-98310494 AACTAAAGACAGGTCGGGCATGG - Intergenic
1047263890 8:123287340-123287362 GGTTAAAAACAGATGGGGCCGGG - Intergenic
1047411765 8:124629964-124629986 CGCTGAGGACAGATGTGGCAAGG + Intronic
1048045545 8:130769089-130769111 CCCTGAAGATAGATGGGGAAGGG + Intergenic
1048527065 8:135212974-135212996 GGCTAAAGACAGAGGGAACAGGG - Intergenic
1060195884 9:121623045-121623067 TGCTTAAGAGAGATGGCGCAAGG - Intronic
1188816266 X:34718497-34718519 AGCTAAAGACCCAGGGGGCAAGG - Intergenic
1198398828 X:136250913-136250935 CCCCAAGGGCAGATGGGGCACGG + Intronic
1201241902 Y:11965481-11965503 CCATAAATACAGATGGGGTATGG + Intergenic