ID: 1162044303

View in Genome Browser
Species Human (GRCh38)
Location 19:7988469-7988491
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044290_1162044303 25 Left 1162044290 19:7988421-7988443 CCTCTGGCATAACCGGCTGAGTC No data
Right 1162044303 19:7988469-7988491 CAGATGGGGCATGGCCTCAGGGG No data
1162044295_1162044303 13 Left 1162044295 19:7988433-7988455 CCGGCTGAGTCAAAGGCTGGGGA No data
Right 1162044303 19:7988469-7988491 CAGATGGGGCATGGCCTCAGGGG No data
1162044289_1162044303 26 Left 1162044289 19:7988420-7988442 CCCTCTGGCATAACCGGCTGAGT No data
Right 1162044303 19:7988469-7988491 CAGATGGGGCATGGCCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type