ID: 1162044513

View in Genome Browser
Species Human (GRCh38)
Location 19:7989586-7989608
Sequence TCTGGTGCTCAGGAATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162044510_1162044513 -1 Left 1162044510 19:7989564-7989586 CCATGGGAATGCTTGCAATATCT 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1162044513 19:7989586-7989608 TCTGGTGCTCAGGAATATCAAGG 0: 1
1: 0
2: 0
3: 22
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162044513 Original CRISPR TCTGGTGCTCAGGAATATCA AGG Intronic
904778250 1:32925059-32925081 GCTGGTGCTCAGGGATGTCAGGG + Intergenic
905787965 1:40773086-40773108 TCTGGTGGCCAGGAAGCTCAGGG - Intergenic
906273684 1:44500820-44500842 TCTGGTGTCCAGGAAAATAAGGG + Intronic
906288809 1:44605943-44605965 TCTGGTGCCCAGGGATGTCCTGG - Intronic
908670113 1:66536874-66536896 TCTGCTGCTCAGAAAAAGCATGG + Intronic
909379585 1:74983091-74983113 TCTGGGCCATAGGAATATCAGGG + Intergenic
909837621 1:80276693-80276715 TCTGGTGCCCAGGAATAATCAGG - Intergenic
916059435 1:161088686-161088708 CCTGGTGCTCTAGAACATCATGG + Intronic
916204334 1:162300727-162300749 TCTGGGGCTCAGTGATATCTTGG - Intronic
917212526 1:172644862-172644884 TCTGGTGCTCAGACATCTCTCGG + Intergenic
920096832 1:203491959-203491981 TCTTGTTCTCATGAATATTAGGG - Intergenic
920503116 1:206497817-206497839 TCTAGTACCCAGGAACATCAAGG - Intergenic
921824898 1:219661360-219661382 TCTGCTGCTCAGGAAAAGCTTGG + Intergenic
922764827 1:228151308-228151330 TGTGGCGCTCAGGAATGTCAGGG - Intronic
1063684329 10:8222116-8222138 TCTGGAGATCAGGAATATGAAGG - Intergenic
1067410369 10:46059363-46059385 ACTGGTGCTTATCAATATCAGGG + Intergenic
1067665254 10:48272080-48272102 TCAACTGCTCAGGAATAGCAAGG - Intronic
1069457620 10:68565428-68565450 TCTGTCGCTCAGGTATATCAAGG - Intronic
1071155129 10:82678880-82678902 CACGGTGCTCAGAAATATCAAGG - Intronic
1073047512 10:100648923-100648945 TTTAGTTCTCAGGGATATCAAGG + Intergenic
1073685353 10:105746545-105746567 TCTGGGGCTCCAGAATATCTAGG - Intergenic
1078517178 11:12032450-12032472 TTTGGTGCCCAGGAACATGATGG - Intergenic
1080474721 11:32579341-32579363 TCTGCTGCTAAGGAATAAGAGGG + Intergenic
1081200612 11:40210658-40210680 CCTTGTGCTCAGGAACAACAAGG - Intronic
1081240117 11:40695177-40695199 TGTGGTGATCAGGAAGATCCTGG + Intronic
1081455476 11:43218071-43218093 TCTGGTGCTGGGGAATAACTTGG + Intergenic
1084856008 11:71986935-71986957 TCTGGTGATCAGGACCATTAAGG + Intronic
1084948094 11:72649796-72649818 TCTGTGGCTCAGGATGATCAGGG - Intronic
1085483257 11:76840137-76840159 TCTGGTGTTCAGTAAGATCAGGG - Intergenic
1086010569 11:82098294-82098316 TCTGAGGCTCAGAAATATGAAGG - Intergenic
1086464052 11:87035866-87035888 TCTGGTCCTGAGGAATATTCTGG + Intergenic
1087874025 11:103333908-103333930 TCTTTTGTTCAGTAATATCATGG + Intronic
1090412535 11:126519020-126519042 TCTGGCTCTCAGGAATTTCACGG + Intronic
1090494401 11:127195831-127195853 CCAATTGCTCAGGAATATCAGGG - Intergenic
1091578065 12:1757862-1757884 TCTGTTCCTTAGGAATATGATGG + Intronic
1091863975 12:3813733-3813755 TCTGGTACTCAGGCAAATTAAGG - Intronic
1091868654 12:3867938-3867960 TCAGATGTTTAGGAATATCAAGG - Intronic
1091871042 12:3891585-3891607 TCTGGGGCTCAGGCATGGCAGGG - Intergenic
1092787123 12:12037024-12037046 TCAGAGGCTCAGGAATGTCAGGG + Intergenic
1094268525 12:28585818-28585840 CCAGGTGCTAAGGAATACCAGGG - Intergenic
1098970476 12:76849706-76849728 TCTGGTGCTTAGAAATAGTAGGG + Intronic
1099232013 12:80037917-80037939 CCTGTTCCTCAGGAGTATCAAGG + Intergenic
1100015435 12:90005135-90005157 ACAGGTGCTCAGAAATATCTAGG - Intergenic
1102872255 12:116423145-116423167 TCTGGTCATCAGGAAGACCAGGG + Intergenic
1103821792 12:123704590-123704612 TCAGGTGAGCAGGAATATCCAGG - Exonic
1106484976 13:30164126-30164148 TATGGTGCTTAGGAACAGCAGGG - Intergenic
1110639719 13:77808699-77808721 TCTGGCTCTTTGGAATATCAGGG + Intergenic
1111418708 13:87981182-87981204 TCTGGTATTCAGAAATATGAAGG - Intergenic
1112294199 13:98172236-98172258 TCTGCTGCTCAGGGATGTCTCGG + Intronic
1113580158 13:111422946-111422968 TCTGTCGCTCAAGAATTTCATGG - Intergenic
1113986803 13:114324166-114324188 TCTGGTGTTCAGGAAGAGGAGGG - Exonic
1114383510 14:22233073-22233095 TTTGTTGCTAAGGAATAGCATGG + Intergenic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1115120944 14:29937078-29937100 TCTGGTGCTAAGGGATATAAAGG - Intronic
1116605223 14:46983654-46983676 CCTGGTTTTCAGTAATATCAAGG + Intronic
1116676422 14:47911738-47911760 TAGGGTGTTCAGGAATACCAAGG - Intergenic
1116996861 14:51333636-51333658 TCTTGTGCCCAGGAAGCTCATGG + Intergenic
1118388831 14:65279807-65279829 CCTGGTGCTCAGGATCATCGTGG + Intergenic
1119739571 14:77005402-77005424 TCCGTAGCTCAGGAGTATCAGGG + Intergenic
1126301993 15:47207577-47207599 CCTTGTGCTCAAGAATTTCATGG + Intronic
1126698298 15:51344000-51344022 TATTGTGCACAGGAATATCTTGG + Intronic
1126709735 15:51443075-51443097 TCTGGAGCTCAGGACTGCCAGGG + Intergenic
1126826091 15:52549680-52549702 TATCGTGGTCAGGAATAACATGG + Exonic
1127132330 15:55880373-55880395 TCTGGTGCTCTGAAATGTCACGG - Intronic
1127964005 15:63910425-63910447 TAGGGTGCTCAGGAATGTCTGGG - Intronic
1131172184 15:90186252-90186274 TCTGAAGCTCAGGAAAATCTAGG + Intronic
1132064193 15:98716891-98716913 ACAGATGCTCAGGGATATCAGGG - Intronic
1133663468 16:7942037-7942059 TCTTGTGCTAAGGTTTATCAAGG - Intergenic
1134035705 16:11029441-11029463 TCTGGAGTTCAGGGAGATCAAGG - Intronic
1136987438 16:35122357-35122379 TCTGATGCACAGGGATATGATGG - Intergenic
1138156602 16:54711219-54711241 TCTTGTACTCAGTAATATTAGGG - Intergenic
1139640393 16:68287524-68287546 ACTGGTGCTCAAGGATATGAAGG - Intronic
1141444728 16:84050562-84050584 TCTGGTGGTCAGGACCATAAAGG - Intergenic
1145000839 17:19303514-19303536 TCCGGTTCTCAGGAAGCTCAGGG - Intronic
1149057152 17:52379957-52379979 TCTGGTGCTCAGGAAGAATGAGG - Intergenic
1158787447 18:60732098-60732120 TCAGATACTCAGGATTATCACGG + Intergenic
1162044513 19:7989586-7989608 TCTGGTGCTCAGGAATATCAAGG + Intronic
1162778015 19:12991434-12991456 ACAGGTGCTCAGGAGTGTCAGGG - Intergenic
1163837883 19:19586718-19586740 TCAGGAGATCAGGATTATCATGG + Intronic
1167248880 19:48390514-48390536 TCTGGACCACAGGAATTTCAGGG - Exonic
1167356314 19:49006416-49006438 ACTGGTGCTCAGCAGTAACACGG - Intronic
928721617 2:34127684-34127706 CCTGGTGCTCAAAAATGTCAGGG + Intergenic
929157728 2:38803034-38803056 TCTGGAGCTCAGGAAAGTCACGG - Intronic
931896112 2:66731672-66731694 TCTGGTGCTCACATATTTCATGG - Intergenic
933090881 2:78114625-78114647 TCTGGTGCTGAGGAATAGAAAGG + Intergenic
934894414 2:98101593-98101615 TCTGGTACTAAGGAAGATCTAGG + Intronic
935745912 2:106190071-106190093 CCTGATGCTCATGAACATCATGG + Intronic
936084124 2:109455039-109455061 TCTGAGCCTCAGGAACATCATGG - Intronic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
936621979 2:114109506-114109528 TCTGGTTCTGAGGAGTAACAGGG + Intergenic
937360246 2:121224649-121224671 TGTGGTTCTCAGGGATATTATGG + Intronic
937933707 2:127225646-127225668 TCAGGTGACCAGGATTATCACGG - Intergenic
938913931 2:135915367-135915389 ACTTGTGCCCAGGAGTATCAAGG - Intronic
939001968 2:136747044-136747066 GCTGGTGGTTAGGAACATCAGGG + Intergenic
941307023 2:163882557-163882579 TCTGGTGTTCAGGATAATAAAGG - Intergenic
942664530 2:178303607-178303629 TCTGGAGCTCAGGGAAATCTAGG - Intronic
943308515 2:186297771-186297793 TCTGCTGCTCAGGCAAATCTTGG - Intergenic
944356467 2:198795049-198795071 TCTGCAGCTCAGGTATCTCAAGG + Intergenic
944903098 2:204235728-204235750 TCTGTTACACAGGCATATCAGGG + Intergenic
1169409694 20:5357080-5357102 TCTGGCATTCAGGAATACCATGG + Intergenic
1169572966 20:6926645-6926667 TCTGGTGCTCAGGATCACCCAGG - Intergenic
1169717744 20:8639409-8639431 TCAGGAGCTCAGGGATAACAAGG + Intronic
1170391867 20:15884076-15884098 CCTGAAGCTCAGGAAGATCAAGG + Intronic
1175016878 20:55801178-55801200 TCTCATGCTCATGAATATTAAGG - Intergenic
1175656733 20:60777196-60777218 TATGGTGCATAGGAATGTCATGG + Intergenic
1175998963 20:62823701-62823723 TCTGATGCTCAGGAAACCCAGGG - Intronic
1178063922 21:28882299-28882321 TCTGTTACTGAGTAATATCAAGG + Intronic
1179505553 21:41837747-41837769 TCTGGAGCTCAGGAGTTTAATGG - Intronic
1179505555 21:41837765-41837787 TCTGGAGCTCAGGAATGTTCTGG - Intronic
1182192491 22:28477292-28477314 TTTGGAGCTCAGGAATGACATGG - Intronic
1183279494 22:36924351-36924373 CCTGTTGCTCAGGAACATCACGG + Intronic
1183284111 22:36951954-36951976 CCTGTTGCTCAGGAACATCACGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1184827088 22:46959643-46959665 TCTGGTGCCCAGGATTGCCATGG + Intronic
949407707 3:3732123-3732145 TCTGCAGCTGAGGAATATCATGG - Intronic
951395003 3:22154115-22154137 TCTGGTCCTCGGGAATATACTGG + Intronic
953675589 3:44999244-44999266 CATGGTGCGCAGGAATATCCAGG + Intronic
955180539 3:56664922-56664944 CCTAGTGCTCTGGAATACCAAGG + Intronic
958416416 3:93879552-93879574 TGTGGTGTTAAGGATTATCATGG + Intronic
959098550 3:101984208-101984230 TGTGGTGATGAGGAATACCATGG + Intergenic
960520268 3:118646745-118646767 TCTGGTACTCAGAAATTTCTGGG - Intergenic
960551957 3:118985837-118985859 GCTGGTGCTCAGGAAGACAAGGG - Intronic
962422068 3:135237748-135237770 TTGGGTGGTGAGGAATATCAGGG - Intronic
963856023 3:150254762-150254784 TCTAAGGCTCAGGAATGTCAAGG - Intergenic
966081594 3:176010575-176010597 TTTGGTGCTCATGCATTTCATGG + Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
967429032 3:189360644-189360666 ACTGGTGCTTGGTAATATCAGGG + Intergenic
968762308 4:2449107-2449129 TCTGGAGCTCAGGGATATCTAGG + Intronic
970822692 4:20237438-20237460 TAAGGTGCTCAGGAATTTCAGGG + Intergenic
971365047 4:25970768-25970790 CCTGGGGCTCAGGAATGCCATGG - Intergenic
974663595 4:64927941-64927963 TGTGGTTCTAAGGAATATAAAGG - Intergenic
975171469 4:71236388-71236410 TCTGGTGCTCGAGAATATGCCGG - Intronic
977267214 4:94869322-94869344 TCTGGTGCTTAGTAAAATAACGG - Intronic
977444201 4:97108465-97108487 TCTGGTACTCAGGAGTCACATGG - Intergenic
977959937 4:103074241-103074263 TCAGTAGCTCAGTAATATCAGGG - Intronic
984085706 4:175308696-175308718 TCTGGGGATCAGGAATGTCAGGG - Intergenic
984851976 4:184162363-184162385 TCAAGTACTCAGGAAGATCAGGG - Intronic
988706946 5:33735827-33735849 TCTGGTGCCCAGGAACATCCTGG + Intronic
990688337 5:58333827-58333849 CCAGTAGCTCAGGAATATCAGGG - Intergenic
992221309 5:74576505-74576527 TCTGTTGCTCAGAAAAACCACGG - Intergenic
993951679 5:94183517-94183539 GCTGGTTCTCAGAAAGATCAAGG + Intronic
995669856 5:114590259-114590281 CCTGGAGCTCAGGAATCACATGG + Intergenic
996783925 5:127217757-127217779 TCTCATCCTCAAGAATATCATGG - Intergenic
997057730 5:130464593-130464615 TCTGATGACCAGGAATAACAGGG - Intergenic
1000612290 5:163387565-163387587 TGTGATTCTCAGGAATATAAAGG - Intergenic
1001007804 5:168069729-168069751 TCTGGTGCTCAGTCATTTCTAGG + Intronic
1002561684 5:180086702-180086724 TCTGGAACTCAGGAGGATCATGG + Intergenic
1002683125 5:180984845-180984867 TATCGTGGTCAGGAATAACAGGG - Intergenic
1003152187 6:3562273-3562295 TCTGGGGCTCAGGAAGACCCAGG + Intergenic
1004712312 6:18183824-18183846 TCTCGTGTTCATGAATATAAGGG + Intronic
1007110737 6:39312290-39312312 TCTGGTGCTCAGAAAGATCTGGG + Intronic
1008041580 6:46807047-46807069 TCTGGTGCTCAAAATTGTCAAGG - Intronic
1013364593 6:109426929-109426951 TCTTGTGCACAGGAAAAGCAGGG - Exonic
1015588134 6:134796964-134796986 TCTGATGCTGAGGATTATGATGG + Intergenic
1016001329 6:139044328-139044350 AATGTTGCTCAGGAATCTCATGG + Intergenic
1016445039 6:144122958-144122980 TCTGGTGGTCAGAAATCTGAGGG + Intergenic
1020601717 7:10283094-10283116 TCTGGTGTTCTGCAATATTAAGG - Intergenic
1020974463 7:14987958-14987980 CCAGATCCTCAGGAATATCATGG - Intergenic
1022692662 7:32672024-32672046 TCTGTGGCTAAGAAATATCAGGG + Intergenic
1022920334 7:35006550-35006572 TCTGTGGCTAAGAAATATCAGGG + Intronic
1024922100 7:54568877-54568899 TCTGGTGCTCATGAATGTCTTGG - Intronic
1029597210 7:101544194-101544216 TCTGGTACCCAGCAAGATCAGGG - Intronic
1032159637 7:129500873-129500895 TCTGGAGCTCAGGAAAAGCAGGG + Intergenic
1033212581 7:139471055-139471077 TCAGGAGCTCAGGACCATCATGG - Intronic
1039180655 8:34862272-34862294 CCTGAAGCTCAGAAATATCAGGG - Intergenic
1041283946 8:56241150-56241172 TATGGTGCTCATGAGGATCAGGG - Intergenic
1042594652 8:70433930-70433952 TCTGGTCCTCTGGAACTTCAGGG + Intergenic
1045250829 8:100482367-100482389 TCTGGTCCTCATAAATGTCACGG - Intergenic
1047620037 8:126597029-126597051 ACTGATGCTGAGGAGTATCATGG + Intergenic
1048398860 8:134044045-134044067 TCTGGTGATCAAGAAAATCTAGG - Intergenic
1055084434 9:72299605-72299627 TCAGGTGCTCAAGACTTTCAAGG - Intergenic
1055375129 9:75640648-75640670 TCTGTGGCTCAGGAATACCAGGG - Intergenic
1057609079 9:96524701-96524723 TCTCTTGCTCAGGAAAGTCAGGG - Intronic
1059159462 9:112020179-112020201 TCTGGTGTGAAGAAATATCAGGG + Intergenic
1186043332 X:5505543-5505565 TCTGTTTCTCTGGAATTTCATGG - Intergenic
1186382406 X:9074631-9074653 TGTGGTGCTCAGGGATGACACGG + Intronic
1187701633 X:21969084-21969106 TCTAGGTCTCTGGAATATCATGG - Intronic
1188107412 X:26161027-26161049 TCTGTTCCTCAGGAGTCTCAGGG + Intergenic
1189122714 X:38412243-38412265 GCTGGTGCTCAGGCGGATCAAGG - Intronic
1190503850 X:51105953-51105975 TCTTGTAAGCAGGAATATCATGG - Intergenic
1190543886 X:51504966-51504988 TCTGGCCCTCAGGTATCTCACGG - Intergenic
1193977663 X:88142598-88142620 ATTGCTGCTCAGGTATATCATGG - Intergenic
1195701924 X:107712159-107712181 TTTGTGGCTCAGGAAAATCAAGG + Intergenic
1197014300 X:121605051-121605073 TCTAGTGCTCATGAAGGTCATGG + Intergenic
1199671342 X:150150829-150150851 TTGGGTGCTCAGCAATAACAGGG + Intergenic