ID: 1162045443

View in Genome Browser
Species Human (GRCh38)
Location 19:7996799-7996821
Sequence TGGTTTTTGGAGATGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4690
Summary {0: 1, 1: 7, 2: 129, 3: 1336, 4: 3217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162045443_1162045448 17 Left 1162045443 19:7996799-7996821 CCAGACTCCATCTCCAAAAACCA 0: 1
1: 7
2: 129
3: 1336
4: 3217
Right 1162045448 19:7996839-7996861 AAACAACCTGGTTTCAAAAATGG 0: 1
1: 0
2: 18
3: 185
4: 909
1162045443_1162045447 5 Left 1162045443 19:7996799-7996821 CCAGACTCCATCTCCAAAAACCA 0: 1
1: 7
2: 129
3: 1336
4: 3217
Right 1162045447 19:7996827-7996849 AACATAATGAGCAAACAACCTGG 0: 1
1: 0
2: 1
3: 16
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162045443 Original CRISPR TGGTTTTTGGAGATGGAGTC TGG (reversed) Intronic
Too many off-targets to display for this crispr