ID: 1162046163

View in Genome Browser
Species Human (GRCh38)
Location 19:8001842-8001864
Sequence CAAAATATCAACCACGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162046159_1162046163 3 Left 1162046159 19:8001816-8001838 CCAATCTTTCCTTTCCCTGGCAC 0: 1
1: 1
2: 4
3: 36
4: 429
Right 1162046163 19:8001842-8001864 CAAAATATCAACCACGTGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 146
1162046160_1162046163 -6 Left 1162046160 19:8001825-8001847 CCTTTCCCTGGCACAGACAAAAT 0: 1
1: 0
2: 3
3: 26
4: 331
Right 1162046163 19:8001842-8001864 CAAAATATCAACCACGTGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 146
1162046157_1162046163 25 Left 1162046157 19:8001794-8001816 CCAGTCGCTTCTGAGTAGTCTGC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1162046163 19:8001842-8001864 CAAAATATCAACCACGTGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162046163 Original CRISPR CAAAATATCAACCACGTGCC AGG Intronic
905781376 1:40713200-40713222 CAAAATATCAACCCCACCCCTGG - Intronic
905937003 1:41832671-41832693 CTAAATATCTACTATGTGCCAGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908390954 1:63683233-63683255 GCAAATATCAACCATGTACCAGG - Intergenic
912656179 1:111488143-111488165 CAAAAAATGACCCACGTGCCTGG - Intronic
912820399 1:112863178-112863200 CAAGAACTCAACCACATGCCAGG + Intergenic
914783433 1:150806678-150806700 CAATATAACAACAAGGTGCCTGG - Exonic
916294899 1:163207476-163207498 CCAAATATGAAACACTTGCCAGG + Intronic
921082444 1:211753308-211753330 CAAACTATCAACCAAGTTCGAGG - Intronic
922470091 1:225871268-225871290 CACAATATACACCACATGCCTGG + Intronic
922530289 1:226340027-226340049 CAAGTTAGCAACCAAGTGCCGGG + Intergenic
924199886 1:241647669-241647691 CCAAATATCAACAAAGTGCAAGG + Intronic
1065138421 10:22696118-22696140 CAAAGTATCAGCCATGTGTCTGG + Intronic
1065538678 10:26739417-26739439 CAAAATATCAAACTCTTCCCCGG - Intronic
1067268896 10:44772797-44772819 CAAAAAGTCATCCACCTGCCCGG + Intergenic
1073508685 10:104026956-104026978 TAGAATTTCAACCACGTGTCAGG + Exonic
1075181840 10:120218120-120218142 CAAAAAACCAACCATGTGCCTGG - Intergenic
1076064283 10:127436893-127436915 GATAATATCAACCAAGTGCAAGG - Intronic
1079243353 11:18736302-18736324 CAGAATGTCTACCATGTGCCAGG + Intronic
1081170880 11:39868854-39868876 CTAAATAACAACCATGTGCCTGG - Intergenic
1090711255 11:129387824-129387846 ATAAATGGCAACCACGTGCCCGG + Intronic
1090949790 11:131463510-131463532 CTAAATATTCACCATGTGCCTGG - Intronic
1091372643 11:135073715-135073737 CCAAGTTTCCACCACGTGCCAGG + Intergenic
1092798751 12:12141442-12141464 CAAATTATCAACCAAGTGTGAGG + Intronic
1093374170 12:18403842-18403864 GAAAATAGCAACCATCTGCCAGG - Intronic
1096732016 12:53621484-53621506 CAAAAAATCAACTACATGGCCGG + Intronic
1097596479 12:61638796-61638818 CAACATATCAACCAGTTGCAAGG - Intergenic
1101803176 12:108040477-108040499 CTAAATCCCAACCACTTGCCAGG - Intergenic
1104093622 12:125536605-125536627 CTGAATATCTACCATGTGCCAGG - Intronic
1110823525 13:79944937-79944959 TACAAAATCAACCATGTGCCAGG - Intergenic
1114977429 14:28119297-28119319 CAAAATATCAACCAGGAGTTGGG + Intergenic
1115037049 14:28870597-28870619 CAAAATATCATCAATGTCCCAGG - Intergenic
1115308099 14:31952448-31952470 CAGAATAGCAGCCACATGCCAGG + Intergenic
1116355680 14:43925536-43925558 CTAAAAATAGACCACGTGCCTGG - Intergenic
1116726656 14:48569686-48569708 CTAAATATCTAGCACGTTCCAGG + Intergenic
1118617433 14:67583991-67584013 CAACATATCTGCCAGGTGCCTGG - Exonic
1124428914 15:29589146-29589168 CAGAATCTCCTCCACGTGCCTGG - Intergenic
1125367108 15:38929860-38929882 CTAAAAATCAACCACATGCTTGG - Intergenic
1127816171 15:62611006-62611028 GAAAATATCAGGCAGGTGCCAGG - Intronic
1131183403 15:90255752-90255774 CAGAAAATCAACCACTTCCCTGG + Intronic
1133230911 16:4366126-4366148 CCAAATCTGAGCCACGTGCCCGG + Intronic
1133985439 16:10664771-10664793 CAAAATTCAAACCAGGTGCCAGG + Intronic
1135082737 16:19450343-19450365 TAAAATACCTACTACGTGCCAGG - Intronic
1138983129 16:62294914-62294936 TAATATATCAACTACCTGCCAGG - Intergenic
1141120151 16:81347635-81347657 CAAACTATCAATCAAGTGGCAGG - Intronic
1141323608 16:83035390-83035412 CAAAGCACCAACCATGTGCCAGG + Intronic
1142158769 16:88546541-88546563 CAAAAGCTCAACCTCGGGCCTGG - Intergenic
1148242593 17:46010370-46010392 GATAATATCAAACACGTCCCGGG + Exonic
1148244001 17:46018692-46018714 GACAATATCACCCACGTCCCTGG + Exonic
1150541227 17:66102200-66102222 CTAAACATCTACCATGTGCCAGG + Intronic
1150734890 17:67728282-67728304 TAAAATAACTACCATGTGCCTGG + Intronic
1150801277 17:68284980-68285002 CAAAATACCTATCAGGTGCCAGG + Intronic
1153518175 18:5924462-5924484 CAAGATATTAACCACCAGCCAGG + Intergenic
1154012652 18:10589108-10589130 CAAAGTATCAAGGACGTGGCTGG - Intergenic
1155240159 18:23857037-23857059 CAAAATTTCATCCCAGTGCCTGG - Intronic
1155659778 18:28234484-28234506 CACAATATCAACAACGTGTTTGG - Intergenic
1158932614 18:62336012-62336034 TGAAATATCTACTACGTGCCAGG - Intronic
1159611749 18:70533309-70533331 AAAAATACCAACCACTTGGCGGG + Intergenic
1160245616 18:77156491-77156513 CAAAATGTCAACCTGCTGCCCGG - Intergenic
1160989099 19:1853357-1853379 CAAGACCTCAACCACGGGCCAGG + Exonic
1161085364 19:2332713-2332735 CAGAAGAAAAACCACGTGCCAGG - Intronic
1161270353 19:3386232-3386254 CAAAAAATTAGCCACCTGCCTGG + Intronic
1162046163 19:8001842-8001864 CAAAATATCAACCACGTGCCAGG + Intronic
1164498478 19:28792350-28792372 CAAAAAATCAACAACCAGCCAGG - Intergenic
925285754 2:2714654-2714676 CCAAATATCAATGATGTGCCAGG + Intergenic
929841224 2:45466007-45466029 CTGAATATCTACCATGTGCCAGG + Intronic
931185176 2:59943940-59943962 CACAGTATCCACCACCTGCCAGG + Intergenic
934476002 2:94593922-94593944 CTAAATATAAATCAAGTGCCAGG + Intronic
936937124 2:117849183-117849205 CAAGATAAAAACCATGTGCCTGG + Intergenic
937678243 2:124615622-124615644 CAAAATATCAAACAGGAGACTGG - Intronic
937694886 2:124797782-124797804 CAAAATAATGACCACTTGCCTGG - Intronic
939472721 2:142644980-142645002 AAAAATATCAAAGATGTGCCTGG + Intergenic
941137050 2:161731126-161731148 CAGAATACCTACCATGTGCCAGG - Intronic
945787309 2:214258077-214258099 TAAAATATCTACCACATGCCAGG - Intronic
947682664 2:232049733-232049755 CAAAATATCAACAAGGTCACAGG - Intronic
1169014546 20:2280842-2280864 GTAAATACCTACCACGTGCCAGG - Intergenic
1169823109 20:9735725-9735747 AAAAATATCCACCACTGGCCAGG + Intronic
1172179763 20:32995407-32995429 CAAACTATCAACCAAGTACAAGG + Intronic
1173376503 20:42488667-42488689 AATAAAATCAACCAAGTGCCAGG + Intronic
1173899430 20:46576340-46576362 CACACTACCAGCCACGTGCCAGG - Intronic
1177503293 21:21987227-21987249 CAAAATGGCAACCAAATGCCAGG + Intergenic
1178322916 21:31619345-31619367 CAAAATACCAGCCACGTGGGGGG + Intergenic
950079698 3:10212577-10212599 GGAAACATCAACCATGTGCCAGG + Intronic
951549647 3:23864115-23864137 CAAACTATCAATCAAGTGCTAGG - Intronic
952006977 3:28852750-28852772 TAAAATATCATCCATCTGCCAGG - Intergenic
953907262 3:46874578-46874600 CAAAATATCACCGAGGTCCCGGG - Intronic
954674023 3:52305820-52305842 CAACCTATAAACCACATGCCTGG - Intergenic
954725270 3:52603102-52603124 CAAAATATCATCTACTTGTCTGG + Intronic
961055064 3:123780781-123780803 CTGAATATCTACCACGGGCCGGG + Intronic
962698888 3:137978088-137978110 CAAAATATCAATGACAGGCCAGG - Intergenic
963082730 3:141409585-141409607 CTTAGTATCAACTACGTGCCAGG + Intronic
964718411 3:159747104-159747126 CCAAATATCTACTATGTGCCAGG - Intronic
964956719 3:162368088-162368110 CCAGATATCAGCCAAGTGCCAGG + Intergenic
965380283 3:167980041-167980063 TAAAATAACAACCATGGGCCGGG + Intergenic
974779560 4:66535961-66535983 CTAAATATCAGCCAAGTGCAGGG + Intergenic
975668023 4:76753336-76753358 CACAAGATCATCCAAGTGCCAGG - Intronic
976808483 4:89074367-89074389 CAAAATATCAACTTCCTGACTGG - Intronic
978431141 4:108634615-108634637 CAAAATATAAAGCAGATGCCGGG + Intergenic
983356193 4:166660597-166660619 CAAAATATCAACTGCCTGCTTGG - Intergenic
985272054 4:188203019-188203041 CAAAGAACCAACCACGTACCTGG - Intergenic
988997263 5:36726200-36726222 CTTAATATTAACCACGTGGCAGG + Intergenic
992100656 5:73404340-73404362 GAGAATATCAACCACCAGCCTGG - Intergenic
994323931 5:98426928-98426950 GAAAATATCAGCCAGGTGCAGGG + Intergenic
994480554 5:100328958-100328980 TAAAATATCTACTAAGTGCCAGG - Intergenic
995112141 5:108440404-108440426 AAATAGATCAACCACTTGCCAGG + Intergenic
995781271 5:115777924-115777946 CCAAGTGTCAACCATGTGCCAGG + Intergenic
996024340 5:118628312-118628334 CACAGTATCTACTACGTGCCTGG + Intergenic
996623337 5:125537867-125537889 CAAAAACTCATCCACATGCCAGG - Intergenic
997341441 5:133148051-133148073 CCAAATAACAACTATGTGCCAGG - Intergenic
1004572930 6:16865457-16865479 CAAAATATCCAGAAAGTGCCTGG + Intergenic
1004678667 6:17870478-17870500 CAATATATCACTCATGTGCCTGG - Intronic
1005615017 6:27564396-27564418 CAAAAAATGCACCACGGGCCAGG + Intergenic
1006033477 6:31194652-31194674 TCAAATACCTACCACGTGCCAGG - Intergenic
1008615817 6:53224502-53224524 CAAAATATTATTCACCTGCCAGG + Intergenic
1013416293 6:109927745-109927767 CTAAATATCAACTATGTGTCAGG + Intergenic
1014083559 6:117315603-117315625 CAAATTATCAACCAAGTGTGAGG + Intronic
1014657660 6:124128122-124128144 TAAAATAGCAACCATGGGCCAGG - Intronic
1014822379 6:126005494-126005516 CTAAATGTCTACCACGTGTCAGG - Intronic
1017791214 6:157801431-157801453 CAAAATATCCACTGTGTGCCAGG + Intronic
1021117563 7:16760934-16760956 CTAAATGCCAACCACATGCCAGG - Intronic
1021640404 7:22730657-22730679 CTAAATATGAACTATGTGCCAGG + Intronic
1021731818 7:23602939-23602961 CAAAGTACCTACCATGTGCCAGG - Intronic
1023492597 7:40760299-40760321 CATAGTATCAACCACATGCTTGG - Intronic
1024940006 7:54752706-54752728 AAAAATATCAACTACATGACAGG + Intronic
1026838945 7:73657701-73657723 CAAAAAATCAGCCAGGGGCCGGG + Intergenic
1028217881 7:88157463-88157485 CAAAATATCAAACAAGTGTGAGG + Intronic
1030537957 7:110792425-110792447 CAAGAGATCAACCAAGTGGCAGG - Intronic
1030662705 7:112238768-112238790 AAAAATATCATCCAGGAGCCAGG - Intronic
1034005646 7:147469382-147469404 AAAAATATCAAGCATGTGCCAGG + Intronic
1034777176 7:153838906-153838928 CTGAATATCATTCACGTGCCAGG - Intergenic
1034789526 7:153955732-153955754 TAAAATAACAACAACGGGCCGGG - Intronic
1037467888 8:19177814-19177836 CAAAATATCAAGTGGGTGCCGGG + Intergenic
1039890500 8:41682511-41682533 TCAAGTATCAACCACATGCCAGG - Intronic
1041757219 8:61327876-61327898 AATAATATCCACCATGTGCCTGG + Intronic
1041976842 8:63809111-63809133 CAAATTATCAACTATTTGCCAGG + Intergenic
1042837185 8:73089777-73089799 CTAAATGTCTACCACATGCCAGG + Intronic
1043037389 8:75215054-75215076 AAAAATATCAACCAGCTGTCTGG + Intergenic
1043704106 8:83327472-83327494 CAAAAAATCAACAACGACCCAGG - Intergenic
1045140989 8:99282156-99282178 TAAAACATCAACCATGTGCAGGG - Intronic
1048203187 8:132394056-132394078 CCAAATACCAACCACGTGCCAGG + Intronic
1050815652 9:9808474-9808496 CAAAATATCACCACCGTACCCGG + Intronic
1053682059 9:40492161-40492183 CTAAATATAAATCAAGTGCCAGG - Intergenic
1053932046 9:43120487-43120509 CTAAATATAAATCAAGTGCCAGG - Intergenic
1054281654 9:63132771-63132793 CTAAATATAAATCAAGTGCCAGG + Intergenic
1054295157 9:63327658-63327680 CTAAATATAAATCAAGTGCCAGG - Intergenic
1054502551 9:65884164-65884186 CTAAATATAAATCAAGTGCCAGG + Intronic
1186286087 X:8045526-8045548 CAAAACATCACCCATCTGCCTGG - Intergenic
1189268523 X:39734476-39734498 GAAAATAGCTACCATGTGCCAGG - Intergenic
1191906800 X:66101821-66101843 CAAAATATCAAGCACGAGGTAGG - Intergenic
1198340241 X:135707041-135707063 CAAATTATCAGCCACTTGCAGGG + Intergenic
1198408614 X:136342341-136342363 CTAAACATCTACCATGTGCCAGG + Intronic
1199505255 X:148554239-148554261 TAAAACATCAACCATATGCCAGG + Intronic
1199748299 X:150790370-150790392 CAAAACATCAACCAGGTGGGTGG + Intronic