ID: 1162050005

View in Genome Browser
Species Human (GRCh38)
Location 19:8027409-8027431
Sequence GTGCTGAATGGGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 391}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162050005_1162050011 1 Left 1162050005 19:8027409-8027431 CCATCCTCATTCCCATTCAGCAC 0: 1
1: 0
2: 0
3: 25
4: 391
Right 1162050011 19:8027433-8027455 TGATGTACTTCTCTCTTACTGGG 0: 1
1: 0
2: 0
3: 9
4: 194
1162050005_1162050013 13 Left 1162050005 19:8027409-8027431 CCATCCTCATTCCCATTCAGCAC 0: 1
1: 0
2: 0
3: 25
4: 391
Right 1162050013 19:8027445-8027467 CTCTTACTGGGGTGCACCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 82
1162050005_1162050015 15 Left 1162050005 19:8027409-8027431 CCATCCTCATTCCCATTCAGCAC 0: 1
1: 0
2: 0
3: 25
4: 391
Right 1162050015 19:8027447-8027469 CTTACTGGGGTGCACCCCAGGGG No data
1162050005_1162050012 2 Left 1162050005 19:8027409-8027431 CCATCCTCATTCCCATTCAGCAC 0: 1
1: 0
2: 0
3: 25
4: 391
Right 1162050012 19:8027434-8027456 GATGTACTTCTCTCTTACTGGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1162050005_1162050010 0 Left 1162050005 19:8027409-8027431 CCATCCTCATTCCCATTCAGCAC 0: 1
1: 0
2: 0
3: 25
4: 391
Right 1162050010 19:8027432-8027454 CTGATGTACTTCTCTCTTACTGG 0: 1
1: 0
2: 3
3: 11
4: 127
1162050005_1162050014 14 Left 1162050005 19:8027409-8027431 CCATCCTCATTCCCATTCAGCAC 0: 1
1: 0
2: 0
3: 25
4: 391
Right 1162050014 19:8027446-8027468 TCTTACTGGGGTGCACCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162050005 Original CRISPR GTGCTGAATGGGAATGAGGA TGG (reversed) Intronic
900037272 1:425652-425674 GTATTGAATAGGAATGATGAAGG + Intergenic
900058901 1:661393-661415 GTATTGAATAGGAATGATGAAGG + Intergenic
902160456 1:14526159-14526181 TTGCTAAATGACAATGAGGAGGG - Intergenic
903210176 1:21813800-21813822 CTGCTGACTGAGGATGAGGATGG - Intronic
903227885 1:21904156-21904178 GTGCTGAAGGGGAAGGAAGGGGG + Intronic
903310241 1:22449873-22449895 GTGCTGTATGTGAATGCAGATGG - Intergenic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
903546663 1:24128277-24128299 GTGCTGAATTGGACAGAGAATGG + Exonic
904236046 1:29117962-29117984 CTGGTGAGTGGGAATGAGCAGGG - Exonic
904545385 1:31266563-31266585 GTGCTGAATGAGAAACAGAAGGG - Intronic
904855889 1:33498058-33498080 GTGCTGAATGGAGAGGAAGATGG + Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905940893 1:41862499-41862521 GTGCTGGGTGGCAAAGAGGAGGG - Intronic
906269182 1:44460935-44460957 GTGCTGACAGGGAAGGGGGAAGG - Intronic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906513602 1:46425101-46425123 GTGGTGAATGGGCATGATGGAGG + Intergenic
906522151 1:46474016-46474038 TTGCTAAGTGGGGATGAGGATGG + Intergenic
907428970 1:54399873-54399895 GTGATGAATGGGGATTATGAAGG - Intronic
907601473 1:55775283-55775305 ATGCTGAAGGGCTATGAGGATGG + Intergenic
908165297 1:61451552-61451574 GTGCTGAGCGGGAGTGGGGAGGG - Intronic
909204640 1:72739800-72739822 GGCCTGAAGGGGAAAGAGGAAGG - Intergenic
910107880 1:83651246-83651268 GTGATGGAGAGGAATGAGGAAGG + Intergenic
912021810 1:105115296-105115318 CTGCTGGATGGGGATGAAGAAGG - Intergenic
912415686 1:109507137-109507159 GAGTTGGATGGGAATGAGGAAGG - Exonic
912582368 1:110732248-110732270 GTGATGATTAGGAATGGGGATGG + Intergenic
912889875 1:113518584-113518606 CTAATAAATGGGAATGAGGATGG - Intronic
913134301 1:115873135-115873157 GGTCTGAAGGGGAAAGAGGAAGG - Intergenic
913548008 1:119888588-119888610 GTACTAAATGGGAATCATGAAGG + Intergenic
914802930 1:150974049-150974071 GTGCTTAACGGGAAACAGGAAGG - Intronic
916070109 1:161165168-161165190 GGGCTGAGTGGGAATGGGGCAGG - Intronic
916244755 1:162676335-162676357 GTGCTGTGTGGGCATAAGGAGGG - Intronic
916507737 1:165443352-165443374 GCTCTGAATGGGACTGAGGTGGG + Intronic
916790551 1:168121490-168121512 GTGCTGACTGGGAAACATGAAGG - Intronic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
917905645 1:179585149-179585171 GAAGTGAATGGGAATGAGGTGGG - Intergenic
918056317 1:181024666-181024688 GGGCTGAATGGGTTTCAGGAGGG + Intergenic
919569103 1:199223476-199223498 GTGCAGAATTGGATTGGGGAAGG - Intergenic
919810019 1:201403090-201403112 TTGCTGAGTAGGAAGGAGGAGGG + Intergenic
920971480 1:210746909-210746931 CTGCAGAATGGGACAGAGGAAGG + Intronic
921209648 1:212883190-212883212 GTTCTGAAAGGGAATGACAATGG + Intronic
921560267 1:216649349-216649371 TTGGTGAATGAAAATGAGGATGG - Intronic
921587092 1:216960346-216960368 CAGCTGAATGGAATTGAGGAAGG - Intronic
922782784 1:228266550-228266572 GTGCTGAATGGAAGTTGGGATGG - Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924477890 1:244397387-244397409 GTGTTGAATGGGGATGTGGTGGG + Intergenic
924758259 1:246961749-246961771 TTCCAGAATGGGAATGAGGCAGG - Intronic
924869399 1:248025005-248025027 GTCCTGAATGGTAATGAAAATGG - Intronic
1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG + Intronic
1064754996 10:18565566-18565588 GTGCTGAATGGAATGGAGAATGG - Intronic
1064897634 10:20257053-20257075 GTGCTGGATGGATCTGAGGAAGG + Intronic
1065882360 10:30047664-30047686 CTGCAGAACGGGCATGAGGATGG - Exonic
1066049132 10:31618988-31619010 GTGATGGATGGGCCTGAGGACGG - Intergenic
1067125673 10:43513482-43513504 GAGCTGAATGGGGATGTGGTGGG + Intergenic
1067821129 10:49531800-49531822 GGGCTGAACGGGATGGAGGATGG - Intronic
1067868882 10:49939240-49939262 GTGTTTAAAGGGTATGAGGAAGG - Intronic
1069509786 10:69033442-69033464 GTGGTGGAGGGGAATGAGTAGGG - Intergenic
1069683497 10:70301327-70301349 TTGCTGGGTGGGCATGAGGAGGG + Exonic
1069709049 10:70477795-70477817 GTCCTGAATGGGGGTGAGGCAGG + Intergenic
1070531492 10:77341466-77341488 AACCTGAATGGGAATGAGGGAGG - Intronic
1071326514 10:84523993-84524015 GTGTTGAGTGGGGATGGGGATGG - Intergenic
1072348236 10:94530115-94530137 GTGCTGATGGGGTTTGAGGAAGG - Intronic
1074148468 10:110738141-110738163 GTGCTGAAGAGGAAAGAGGCAGG + Intronic
1074350732 10:112734243-112734265 GTGAGGGATGGGAATGATGAAGG - Intronic
1074355620 10:112780902-112780924 GGGGTGAGTGGGAATGAGAAAGG - Intronic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1076461223 10:130648928-130648950 GGCCTGAATGGGCAGGAGGAGGG - Intergenic
1076530824 10:131143197-131143219 CTACTGCATGGGACTGAGGAGGG + Intronic
1076927538 10:133500140-133500162 GAGTTGAATGGGAATGTGGTGGG + Intergenic
1076963998 11:63575-63597 GTATTGAATAGGAATGAAGAAGG + Intergenic
1077098988 11:812988-813010 GTGCAAAATGAGCATGAGGAGGG + Intergenic
1077111621 11:864556-864578 GTGCTCCCTGGGAGTGAGGATGG - Intronic
1077190533 11:1254325-1254347 ATGGTGCATGGGAAGGAGGAGGG + Exonic
1077422557 11:2459816-2459838 GTGCTGCATGGGAAGGAGAGTGG - Intronic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1078050896 11:7963836-7963858 GTGTTGAGAGGGAAAGAGGAAGG - Intronic
1078156056 11:8801080-8801102 GAGCAGAATGGGAATTGGGAAGG - Intronic
1078264999 11:9748645-9748667 GTGCTGAAGGGACACGAGGAGGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1079471678 11:20784403-20784425 ATGCTGAATGCGAAGGAGTAAGG + Intronic
1080020249 11:27552595-27552617 GTGTTGAATGGGAATGTGATGGG + Intergenic
1082129559 11:48471500-48471522 GTGCTGCATGGGCTTGGGGAAGG + Intergenic
1082563088 11:54642392-54642414 GTGCTGCATGGGCTTGGGGAAGG + Intergenic
1084271900 11:68033421-68033443 CTCGTGAATGGGAATGATGAGGG + Intronic
1084305921 11:68283227-68283249 CTGCTGAAAGAGAATGAGGTGGG - Intergenic
1084720434 11:70902248-70902270 CTGCTGGCTGGGAAGGAGGAAGG + Intronic
1084961451 11:72718800-72718822 ATGCAGAATGGGTAAGAGGAGGG + Intronic
1085189154 11:74602790-74602812 GTGCTGTAGTGGAATAAGGACGG - Intronic
1085414323 11:76310213-76310235 GTGGAGAATGGGAGTGAGGTCGG - Intergenic
1085720819 11:78911146-78911168 GGGGTGTATGGAAATGAGGAAGG + Intronic
1086140992 11:83500090-83500112 GTACCGAAGGGGCATGAGGAAGG - Intronic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1088449237 11:109964424-109964446 GAGTTGAATGGGAATGTGGTGGG - Intergenic
1088841901 11:113634507-113634529 GTGCAGAAAGGGAAGGAGCAGGG - Intergenic
1089257311 11:117200649-117200671 GTGCTGGGTGGGAGTGGGGATGG + Intronic
1089517849 11:119045038-119045060 GAGCTGGATGGGAATGGGGAAGG + Exonic
1090473633 11:127001166-127001188 GGGCTGAAAGGGAACTAGGAAGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090736705 11:129617333-129617355 GTGCAGGATGGGACTGAGGCAGG + Intergenic
1090903695 11:131055040-131055062 CTGCTGAACGGCAATGAAGATGG + Intergenic
1091168834 11:133502861-133502883 CTTCTGGATGGGACTGAGGAGGG + Intronic
1091296452 11:134477179-134477201 GTGCTGAGTATGGATGAGGAAGG + Intergenic
1092239706 12:6829141-6829163 GAGCAGAATGGGAATGGGGCGGG + Intronic
1092358116 12:7813871-7813893 GAGCTGTATGGAAGTGAGGAAGG + Intronic
1092371562 12:7920969-7920991 GAGCTGTATGGAAGTGAGGAAGG + Exonic
1092962780 12:13611838-13611860 GCGCTGAATGGCTCTGAGGAAGG + Exonic
1093034958 12:14324245-14324267 TTGGTGAATGGGAAATAGGACGG - Intergenic
1093155100 12:15674466-15674488 GTGCTTAATGGGAATCAGTGAGG + Intronic
1093649931 12:21631484-21631506 GTGTTGGAAGGCAATGAGGAAGG + Intergenic
1093975893 12:25421751-25421773 GTGCTGTAATGTAATGAGGAGGG - Intronic
1094454912 12:30621299-30621321 GTGTTGGATGGAAGTGAGGAGGG + Intergenic
1095328915 12:40933139-40933161 GTGCTGCATGGAACTCAGGAAGG - Intronic
1095636921 12:44445897-44445919 GTGCTGGTTGGGAATGGGGTGGG - Intergenic
1096790120 12:54039260-54039282 GTGCTGTTGGGGGATGAGGAGGG + Intronic
1097242408 12:57584702-57584724 GTGCTATATGTGAAAGAGGAGGG - Exonic
1097931528 12:65192441-65192463 GTGCACAATGGGAAGGAAGACGG - Intronic
1098599838 12:72317881-72317903 GGGCTGAAGGGGCAGGAGGAAGG + Intronic
1098832023 12:75374962-75374984 GAGCTGAATGGGGATGTGGTGGG + Intronic
1100368601 12:93944138-93944160 GGGCTGAAGGTGAATGATGAAGG - Intergenic
1100871297 12:98913318-98913340 GTCCTGAATGTCAAGGAGGAGGG - Intronic
1100900633 12:99236697-99236719 ATGTTGAATAGGAATAAGGAGGG + Intronic
1101264005 12:103065177-103065199 GAGTTGAATGGGAATGTGGTGGG - Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1105513207 13:21068248-21068270 GTGTTGAATGTGAATGTAGAAGG + Intergenic
1105519850 13:21122457-21122479 GTGCCTACTGGGATTGAGGAGGG - Intergenic
1105551365 13:21398963-21398985 GGGCTGAAGGGGAAAGAGAAAGG + Intronic
1106654737 13:31731189-31731211 GATCTGAAAGGGATTGAGGAAGG - Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108269874 13:48749020-48749042 GGGATGAATGGGAATCAGGCAGG - Intergenic
1108544783 13:51481962-51481984 GTGGAGAATGGGAGTGATGAAGG - Intergenic
1108573750 13:51773618-51773640 CTGCTCAGAGGGAATGAGGACGG - Intronic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109712803 13:66181839-66181861 GTGTTGAATGGGGATGTGGTAGG + Intergenic
1111109121 13:83684495-83684517 CAGCTGAATGGGAATGCGGCGGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111859233 13:93680557-93680579 GAGTTGAATGGGATTAAGGAGGG + Intronic
1112620653 13:101050833-101050855 GTGCAAAATGGAATTGAGGAGGG - Intergenic
1112702191 13:102022524-102022546 TTGCTGAATTGGTATGAAGATGG + Intronic
1113033975 13:106028200-106028222 GAGGTGAATGGAAGTGAGGATGG - Intergenic
1113149467 13:107246057-107246079 GTGCAGAATGAGATAGAGGAGGG - Intronic
1114351271 14:21854318-21854340 TTGCTGGATGGGTATAAGGAAGG + Intergenic
1114382658 14:22224404-22224426 CAGCTGAATGGGAATGGGGAAGG - Intergenic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1114847332 14:26338983-26339005 GTGCAGGGTGGGAATGAGGGAGG - Intergenic
1116748248 14:48848799-48848821 GTGCTGTATGGAAATGGGGCAGG - Intergenic
1117291403 14:54337239-54337261 TTGCTGGAGGGCAATGAGGAAGG + Intergenic
1118370367 14:65132590-65132612 CAGCTATATGGGAATGAGGATGG - Intergenic
1119984222 14:79117636-79117658 ATGGTGAGTGGGAGTGAGGAAGG + Intronic
1120407597 14:84108352-84108374 CTGCTGAATATGAATGAAGAAGG + Intergenic
1121402156 14:93689365-93689387 GTGTAGAGTGGGAATGAGAAGGG + Intronic
1122027273 14:98886996-98887018 GGGCAGAATGGGAAAGAGGGAGG + Intergenic
1122152708 14:99733360-99733382 GTGAGGAATGGGGATGGGGATGG - Intergenic
1122481910 14:102052697-102052719 GGGCTCCATGGGAGTGAGGAAGG + Intergenic
1123914916 15:25014353-25014375 GTAAAGATTGGGAATGAGGAAGG + Intergenic
1125470099 15:39993975-39993997 ATGTTGGATGAGAATGAGGAAGG + Intronic
1125550333 15:40540055-40540077 GTAATGAATGGGCAAGAGGAGGG + Intronic
1126721258 15:51582898-51582920 TTGCTTCCTGGGAATGAGGAGGG - Intronic
1128673881 15:69594911-69594933 GAAATGAATGGGAAGGAGGAGGG + Intergenic
1129168807 15:73795509-73795531 GTCCTGAGTGGGGATGGGGAAGG + Intergenic
1130384543 15:83399870-83399892 GTGCTGCATGTGGCTGAGGAAGG + Intergenic
1131253138 15:90844076-90844098 GGGCTGAATGGGAAGGAGGGAGG - Intergenic
1132444554 15:101901606-101901628 GTATTGAATAGGAATGATGAAGG - Intergenic
1132673932 16:1114006-1114028 GTGGTGAATGGGGGTGAGGGTGG - Intergenic
1132673952 16:1114062-1114084 GTGGTGAATGGGGGTGAGGCTGG - Intergenic
1132923168 16:2410797-2410819 CAGCAGACTGGGAATGAGGAAGG - Intergenic
1134840049 16:17394511-17394533 GTGCTGTATGTCAGTGAGGATGG - Intronic
1137395281 16:48112734-48112756 GGGCTAAATGGGGATGATGAGGG - Intronic
1137499121 16:48997035-48997057 GCGCTGGCTGGGCATGAGGAAGG + Intergenic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138673455 16:58633757-58633779 GAGAGGAGTGGGAATGAGGAAGG + Intergenic
1139479876 16:67224557-67224579 GTCCTAAATGGGACTGGGGAAGG + Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1145293227 17:21566702-21566724 ATGCTGGAGGGGAAAGAGGAAGG + Intronic
1145386740 17:22419235-22419257 TTGCTGGAGGGGAAAGAGGAAGG - Intergenic
1145788447 17:27609364-27609386 GTGCTGGATGGGGAAGAGCAGGG + Intronic
1145995873 17:29104644-29104666 GTGATGAGTGTGAATGAGGATGG + Intronic
1147768049 17:42849956-42849978 GTGTTGTATGGGCATGAGGCTGG + Intronic
1152212576 17:79010175-79010197 GGGCTGCCTGAGAATGAGGATGG - Intergenic
1154299514 18:13180931-13180953 GGGCTGGAGGGGAAAGAGGAGGG - Intergenic
1155037541 18:22037591-22037613 GTGCTCGATGGGAAAGAGAAAGG + Intergenic
1155443335 18:25884730-25884752 GTGCTGGCTGGGACTGGGGAAGG - Intergenic
1156014465 18:32532472-32532494 GTGCTTGAGGGGATTGAGGAAGG + Intergenic
1156041056 18:32823473-32823495 GTGCTGTGGGGAAATGAGGATGG + Intergenic
1156347214 18:36268617-36268639 GTGTTGAAAGAGAATGTGGAAGG + Exonic
1157630534 18:49091156-49091178 TTGCTGAATGGGAGGGAGGGAGG - Intronic
1157947600 18:51998268-51998290 GTGCTGAGTGGGAAGAAGGAGGG + Intergenic
1158828098 18:61246978-61247000 GTCCTGAATGGGAATCAGGGTGG + Intergenic
1158949121 18:62475470-62475492 GTGCTGCATGGGGTTGGGGAAGG + Intergenic
1159096047 18:63903132-63903154 ATGGTGGATGTGAATGAGGAGGG + Exonic
1160249683 18:77190732-77190754 GTGCTTAGTGGGAAAGAGCAGGG + Intergenic
1160640801 19:133207-133229 GTATTGAATAGGAATGAAGAAGG + Intergenic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1163493170 19:17629189-17629211 ATGCTGAATGGGGCTGAGGAGGG + Intronic
1164924030 19:32112620-32112642 GTGCTGAATTGGAATCAAAAGGG - Intergenic
1165402432 19:35610376-35610398 TAGGTAAATGGGAATGAGGAAGG - Intergenic
1166689631 19:44814619-44814641 GTGCTGAATGTGAATCTCGAGGG + Exonic
1166702333 19:44889267-44889289 GACATGAAGGGGAATGAGGAAGG + Intergenic
1167298120 19:48663709-48663731 GTGGCAAGTGGGAATGAGGATGG - Intronic
1167321583 19:48799976-48799998 GTGCTCATTGGGAACGAGGTGGG - Exonic
1168439840 19:56354719-56354741 GAGCTGAATGGGAAGGTGGGAGG - Intronic
925052750 2:829995-830017 GAGCTGGAGGGGAAAGAGGAAGG + Intergenic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
928053544 2:28027104-28027126 GAGCTGAATTTGAAAGAGGAAGG - Intronic
928314060 2:30232394-30232416 GTGCTGAAGGGGAAGGAGCCCGG + Intronic
928825543 2:35416145-35416167 TTGCTCAGTGGGAATGATGAAGG + Intergenic
929272984 2:39994313-39994335 GTACTGAATGGGAATGTGCCAGG + Intergenic
929574280 2:43042258-43042280 GTGTTGCATGGGACTGAGCATGG + Intergenic
929785589 2:44988574-44988596 GGGGTGAGTGGCAATGAGGAGGG - Intergenic
929822012 2:45281548-45281570 ATGTTGAATGGGAATGATGGTGG + Intergenic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930605680 2:53490717-53490739 GTGCTGAGAGGGAGTGAGGCTGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
931959410 2:67465528-67465550 GTTCTGAATGGCAAAGAGCATGG - Intergenic
933505782 2:83175653-83175675 GTTCTGAAAAGGAAGGAGGAGGG - Intergenic
933889154 2:86750158-86750180 GTGCTGAAGTGGAATTAGGCTGG + Intronic
936386207 2:112031749-112031771 GTGATGAATGAGAATGAAGCTGG + Intergenic
937217048 2:120319360-120319382 GTGCTGTATTGGAATGCGTAGGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
939500140 2:142974246-142974268 GGGCTGGAGGGGAAAGAGGAAGG + Intronic
939550501 2:143609688-143609710 GTGGAGAATGGGTATGAGGTGGG - Intronic
939936381 2:148298389-148298411 CTGGTGAGTGGGAGTGAGGAAGG + Intronic
940481258 2:154234016-154234038 GAGCTGAAAGGGAAAGAGGCAGG + Intronic
940777393 2:157899147-157899169 ATGATGAATGGAAATGATGAGGG - Intronic
941442685 2:165557579-165557601 GTGCTGGAGGAGAAAGAGGAGGG + Intronic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942603144 2:177661781-177661803 ATGCTGAAAGGGAATATGGAAGG - Intronic
943490758 2:188553215-188553237 GTGTTGAATAGGAGTGATGAAGG + Intronic
944419989 2:199519331-199519353 TTTGTGAATGGGAATGAAGAAGG + Intergenic
946301575 2:218827506-218827528 GAGCTGAGTGGGACTGGGGAAGG + Intronic
946363373 2:219233200-219233222 GTGCTGCATGGGGGTAAGGATGG + Intronic
946375089 2:219302986-219303008 GGGCTGGGTGGGAATGGGGAGGG + Intronic
946527984 2:220540908-220540930 GAGTTGAATGGGAATGTGGTGGG + Intergenic
946637055 2:221741157-221741179 GTGCTGCATGTGAGTGAGGTGGG - Intergenic
946790807 2:223298820-223298842 GAGCTGAATGGGGATGTGGTGGG - Intergenic
947085216 2:226443632-226443654 GTGCAAAATGGCAGTGAGGAGGG - Intergenic
947517049 2:230815136-230815158 GTGCTGATTGAAAATGTGGACGG - Intronic
948938278 2:241182549-241182571 CTTCTGAGTGGGAAGGAGGAGGG + Intronic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1171312009 20:24152097-24152119 GAGCACAATGGGAATGAGGCTGG + Intergenic
1174231819 20:49051559-49051581 GTCCTGAATGAGAATGAAGTGGG + Intronic
1174287031 20:49481100-49481122 GGGCTGTAGGGGACTGAGGAAGG - Intronic
1175089759 20:56492717-56492739 TTGCAAAATGGGAATGATGATGG - Intronic
1175460190 20:59146588-59146610 GTGCTGAAAGGTGAGGAGGAGGG - Intergenic
1175604176 20:60298870-60298892 GTGCTGATGGGGGATGAGGCTGG - Intergenic
1175671516 20:60907245-60907267 TTGCTGAATGGACATGAGGAAGG + Intergenic
1177471806 21:21569588-21569610 GTGCTTAGTGGGGAAGAGGAGGG - Intergenic
1178607752 21:34054526-34054548 GATCTGAAGGGGGATGAGGAAGG + Intergenic
1178699400 21:34820288-34820310 TTGCTGAGTGGGGCTGAGGAGGG + Intronic
1179233460 21:39525709-39525731 CTGCTGAATAGGCATGAGGATGG + Intergenic
1179948560 21:44697038-44697060 GTGCTGGATGGGCAGGAGGGAGG - Intronic
1179948570 21:44697079-44697101 GTGCTGGATGGGCAGGAGGGAGG - Intronic
1180682454 22:17638026-17638048 GTACTGAATTGGAACAAGGAGGG - Intronic
1180855334 22:19041616-19041638 TGGCTCAATGGGAATAAGGAGGG + Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1182003886 22:26943142-26943164 GTGGTGAAAGGGGATGAAGAGGG + Intergenic
1183086596 22:35490761-35490783 GGGCTGAATGAGCATGAGGCAGG - Intergenic
1183766389 22:39879929-39879951 GTGCTAAAAGGAAATGAGGCTGG + Intronic
1183987487 22:41577514-41577536 GTTCTGAAGGGGCAGGAGGAGGG - Intronic
1184128157 22:42501835-42501857 GGTCTGCAGGGGAATGAGGAGGG + Intergenic
1184136947 22:42555148-42555170 GGTCTGCAGGGGAATGAGGAGGG + Intronic
1184409702 22:44319419-44319441 GGGATGAAGGGGAAAGAGGAGGG + Intergenic
1184908902 22:47512463-47512485 GTGCAGAATGAGAATTTGGAGGG + Intergenic
1184966458 22:47976063-47976085 GTCATGACTGGGAATGAGCATGG - Intergenic
1185116038 22:48938872-48938894 GGGCTGCATGGGAAGGAGGTTGG - Intergenic
1185182670 22:49372241-49372263 GTGCTGCAGGGAAATCAGGACGG + Intergenic
949602087 3:5611099-5611121 GTGATGGATGAGAAAGAGGAAGG - Intergenic
950007015 3:9697934-9697956 GTGCTGGGTAGGAATGAGGCTGG + Intronic
950182229 3:10922595-10922617 GGGAGGAATGGGAATGAGGGAGG + Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
951485558 3:23204667-23204689 GTGCTGCAGGGGAAAGAGAATGG - Intronic
951689424 3:25380283-25380305 GTACGGAGTGGGAAAGAGGATGG - Intronic
952740024 3:36725850-36725872 GTTTTGAATGGGAAAAAGGAAGG - Intronic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
954862805 3:53704315-53704337 GTGCTGACTGGGAGTGGGCAGGG + Intronic
955035471 3:55263149-55263171 GAGCTGAATGGGGATGTGGTGGG - Intergenic
955516353 3:59730187-59730209 GTTCTGAATGGAAATGAGCAGGG - Intergenic
955651239 3:61196540-61196562 TTGCTGAATTGGGCTGAGGATGG + Intronic
956118918 3:65946200-65946222 GTGATGACTGGGAATTAGAAAGG + Intronic
957434428 3:80155048-80155070 GTGCTGCCTGGGGTTGAGGAAGG + Intergenic
958605932 3:96358471-96358493 ATGTTGAATAGGAATGAGGTGGG + Intergenic
959273306 3:104242140-104242162 GTGATGTATGGGATTGAGGAAGG + Intergenic
960009827 3:112821544-112821566 GCGCTGGAGGGGAAAGAGGAAGG - Intronic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961867902 3:129967383-129967405 GTGCTTAAAGGCCATGAGGAGGG - Intergenic
962386420 3:134936144-134936166 GGGAGGAGTGGGAATGAGGAGGG + Intronic
964618037 3:158690859-158690881 GAGCGGAGTGGGGATGAGGAGGG + Intronic
966850349 3:184161018-184161040 GAGCTGGATGGGAGTGGGGAGGG + Intronic
967112377 3:186305420-186305442 ATGCTGAAAAGGAATGAAGATGG + Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969479592 4:7440886-7440908 GGGCTCAATGGGGATGAAGACGG + Intronic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970323265 4:14896779-14896801 GTGCTGAGAGAGAAGGAGGAGGG + Intergenic
970466942 4:16333623-16333645 TTCCTGAATGGGCAAGAGGAAGG - Intergenic
970709423 4:18844283-18844305 GTGCTGAGTGGGAATGCCCATGG - Intergenic
970979715 4:22082078-22082100 GTGGTGAGAGGCAATGAGGAGGG + Intergenic
971102526 4:23483706-23483728 GAGCTGAAAGGGAATGAAGTAGG - Intergenic
972195087 4:36644814-36644836 TTGCTCAATGGGAATAAGGAGGG - Intergenic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
975707255 4:77123261-77123283 GTCCAGAAAGGTAATGAGGATGG + Intergenic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
979307008 4:119158034-119158056 ATGCAGAATGGGAAAGTGGATGG + Exonic
979442588 4:120769226-120769248 GTGCTGAATGGTAAAAAGTAAGG + Intronic
981350731 4:143726512-143726534 GTGCTGAGTGGGAATACGAAAGG + Intergenic
981488846 4:145318416-145318438 GTGCTGGCTTGGAATAAGGAGGG - Intergenic
981811806 4:148783964-148783986 GTGCTGAAAGGAAATGAAAAGGG + Intergenic
982918266 4:161242100-161242122 GTGCTGCAGGAGAATGATGATGG - Intergenic
983377222 4:166945631-166945653 GTGGTCAATTGGAGTGAGGAGGG - Intronic
983856089 4:172647174-172647196 TGGGTGAAAGGGAATGAGGATGG - Intronic
986516211 5:8566719-8566741 GTTCTGAATGGGGATGTGGTGGG - Intergenic
986920077 5:12669484-12669506 GATCTGAATGGGAATGTGGGTGG + Intergenic
987097201 5:14560581-14560603 GAGCAGATTGTGAATGAGGAGGG - Intergenic
988092493 5:26561670-26561692 GAGCTGAATGGGGATGTGGTGGG - Intergenic
988160935 5:27517813-27517835 GAGTTGAATGGGAATGTGGTGGG + Intergenic
990073810 5:51817652-51817674 GTGCTGAGGGGGAAAGAGAAGGG + Intergenic
991018815 5:61958967-61958989 CTGCTGAGTGGGAGCGAGGAGGG + Intergenic
992446871 5:76842240-76842262 GGGCTTTATGGGAATGAGTAAGG + Intergenic
992466078 5:77006357-77006379 TAGGTGAAAGGGAATGAGGAGGG - Intergenic
996542546 5:124645773-124645795 GTGCTGAATGTTTGTGAGGAGGG - Intronic
998219234 5:140262713-140262735 CTGGTGAATGGGAATGAGACTGG + Intronic
998984481 5:147740549-147740571 GTGCTGAGTAGCAATGGGGAAGG - Intronic
1001111977 5:168904116-168904138 GAGCGGAGTGAGAATGAGGAGGG - Intronic
1001308032 5:170589988-170590010 CTGCAAAATGGGAATGGGGATGG + Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002736549 5:181393214-181393236 GTATTGAATAGGAATGATGAAGG - Intergenic
1002748149 6:81610-81632 GTATTGAATAGGAATGAAGAAGG + Intergenic
1002796034 6:471585-471607 TTGCTGCATGGGACCGAGGACGG - Intergenic
1003378668 6:5602805-5602827 GTGCCAAAAGGGACTGAGGAGGG - Intronic
1004408227 6:15355115-15355137 GGGCAGAATGGGAATGTGTAAGG - Intronic
1006453379 6:34118291-34118313 GTGCTTAATGGGATAGAGCAAGG + Intronic
1006556507 6:34871653-34871675 GTGCTGAAGAGGAGTGATGATGG + Exonic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007180455 6:39925854-39925876 AGGATGAATGGGAATGTGGAGGG + Intronic
1007486561 6:42184668-42184690 GGGCTGAGTGGGGATGGGGAAGG - Exonic
1007501012 6:42296845-42296867 TTGCAGAATGGGAATGAAGCAGG + Intronic
1008400171 6:51054548-51054570 GAGTTGAATGGGAATGTGGTGGG - Intergenic
1009570031 6:65373336-65373358 ATGCTAAATGAGAATGGGGATGG + Intronic
1010829120 6:80509281-80509303 GTGCTGAATGGGTCTCAGGAGGG + Intergenic
1010981504 6:82375156-82375178 GTGTGGCATGGGACTGAGGAGGG + Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1013594920 6:111651808-111651830 GTGCTGCATGGGAAGGAGGGAGG + Intergenic
1014472737 6:121836182-121836204 GTGCTGAATGGGACTTAGAGAGG + Intergenic
1015914478 6:138202035-138202057 GTGCTGCATATGCATGAGGAAGG - Intronic
1017325618 6:153138337-153138359 TTGCTGAATGGGAATATGCAGGG - Intergenic
1018037315 6:159892536-159892558 CAACTGAATGGGAATGTGGAAGG + Intergenic
1019241647 6:170668743-170668765 GTATTGAATAGGAATGATGAAGG - Intergenic
1019600188 7:1878736-1878758 GTGCTGAATAAGAATGGGGGGGG - Intronic
1023085759 7:36568676-36568698 TTTCTGAAGGGGATTGAGGAGGG - Intronic
1023336235 7:39173819-39173841 GTGGTGGATGGGAATGTAGAGGG + Intronic
1023530107 7:41144197-41144219 GTGATGAAAGGGAAGGAGTATGG - Intergenic
1023577550 7:41645367-41645389 GTGATGAATGGCAGTGTGGATGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024641829 7:51335328-51335350 GAGGTGAATGGGGATGAGGTGGG + Intergenic
1026456850 7:70580293-70580315 CTGCTGAATGGGAATGGGGTAGG + Intronic
1027601954 7:80250270-80250292 ATACTGGCTGGGAATGAGGAGGG - Intergenic
1028500521 7:91514355-91514377 GTGCTGAACGGAAATGATCATGG + Intergenic
1029554099 7:101255889-101255911 ATGCCGAATGGAAAGGAGGAAGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029737470 7:102472703-102472725 GTGCTCTGTGGGGATGAGGAGGG + Exonic
1029869155 7:103670599-103670621 GTGAAGAATGGGAATTAGCATGG + Intronic
1030293901 7:107899768-107899790 GGGCTGTATGGCAATGTGGATGG + Intronic
1030318504 7:108140702-108140724 GAGCAGAGTGGGAAGGAGGAAGG + Intergenic
1030322142 7:108180264-108180286 GTGGTCAATGGGAAAGGGGAGGG - Exonic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1032386446 7:131528879-131528901 GGGCTGACAGGCAATGAGGAAGG + Intronic
1032489973 7:132317305-132317327 GTGCTGAATTGGATTGAGTTGGG + Intronic
1032520431 7:132539648-132539670 GTGTTAAGTGGGAATGATGATGG + Intronic
1033285162 7:140035220-140035242 GCTCTGAATGAGAATGTGGATGG - Intronic
1033477757 7:141707021-141707043 GTTCTGGCTGGGAATGGGGAAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033662979 7:143415760-143415782 GTGCGGAATGGGGGTAAGGAAGG - Intergenic
1034143405 7:148845264-148845286 GTTCTTAAAGGGAATAAGGATGG - Intronic
1035394363 7:158525699-158525721 GGGCTGCTTGGGAATGAGGAGGG - Intronic
1035405775 7:158596255-158596277 GTGTGGAATGTGAATGAGAATGG - Intergenic
1035421166 7:158729833-158729855 GTGTTGAGTGGGAATGTGTAGGG + Intergenic
1035506469 8:139353-139375 GTATTGAATAGGAATGATGAAGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035835214 8:2743059-2743081 GTGCTGCCTGGGATTGAGGGAGG - Intergenic
1036750074 8:11438130-11438152 GTGCTGAATGGACATGGGGCTGG + Exonic
1037438103 8:18886044-18886066 GTGCTGGATGGGAATAGGGGAGG - Intronic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1038212650 8:25533858-25533880 ATGCAGAATGGGACTGAGGGAGG - Intergenic
1038413618 8:27377041-27377063 GTGCAAAGTGGGAGTGAGGAGGG + Intronic
1038949367 8:32397735-32397757 GTGCTGGCTGGGGAAGAGGAGGG - Intronic
1039392095 8:37189518-37189540 GTGCTGCATGGGAAGATGGAAGG + Intergenic
1039672000 8:39612290-39612312 GTGCTGAATGGGGAGGAAGCTGG + Intronic
1040875728 8:52149844-52149866 GTTTTGAATGGGGAAGAGGAAGG + Exonic
1041508645 8:58630093-58630115 GTGCTGTGTGGGACAGAGGATGG + Intronic
1044062506 8:87655689-87655711 CTGATGAATGGGAATGGGAAGGG - Intergenic
1045743498 8:105388668-105388690 GTCTTGAAAGGGAGTGAGGATGG + Intronic
1049316690 8:141972975-141972997 GCTCTGGATGGGAAAGAGGAGGG + Intergenic
1050143093 9:2537263-2537285 GTGCTAAAGGAGCATGAGGATGG + Intergenic
1050478451 9:6064880-6064902 TTGCTGAAGGGGCATGAGGAAGG + Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1055053701 9:72004413-72004435 GGGCTCAAGGGGAAAGAGGAGGG + Intergenic
1055492629 9:76821351-76821373 GAGGTTAATGGGAATGAGAAAGG + Intronic
1057775198 9:98002174-98002196 GTGGTTAATGAGGATGAGGATGG - Intronic
1058752154 9:108050226-108050248 TTACTGAAGGGGAAAGAGGAAGG + Intergenic
1059168298 9:112099753-112099775 GTGATTGATGGGAATAAGGAGGG - Intronic
1059298954 9:113297738-113297760 GTGGTGGCTGGGGATGAGGATGG + Exonic
1059718681 9:116937301-116937323 GTGGTGACAGGGAATAAGGAAGG - Intronic
1062635123 9:137486658-137486680 GTGCTGAGTTGGACTGAGGGCGG - Intronic
1203601839 Un_KI270748v1:17977-17999 GTATTGAATAGGAATGATGAAGG - Intergenic
1186279378 X:7976186-7976208 GAGCTGAATGGGGATGTGGTGGG - Intergenic
1187487355 X:19717037-19717059 ATGCAGAATGGCAATGGGGAGGG + Intronic
1189950985 X:46230655-46230677 GTCCTGTATGGGATTCAGGAAGG + Intergenic
1192110845 X:68362619-68362641 GAGCTCAAAGGGAAAGAGGAAGG + Intronic
1192590470 X:72355420-72355442 GTGCTGAGGGGGAAAGGGGAAGG - Intronic
1192677492 X:73213921-73213943 GAGATGTATGGTAATGAGGAGGG - Exonic
1194990594 X:100543180-100543202 GTGCAGCCTGGGAATGGGGAGGG - Intergenic
1196111555 X:111952181-111952203 GTTCTCAATGGCAATGAGCAGGG + Exonic
1196831020 X:119775640-119775662 GTAGTGAATAGGAATGAGGCTGG - Intergenic
1197240171 X:124114661-124114683 CTGCTGACTGGGATTGAGGAAGG + Intronic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1199381355 X:147176322-147176344 ATGCTGGAGGGGAAAGAGGAAGG + Intergenic
1199580259 X:149353286-149353308 GAGCTGAATGGGGATGTGGTGGG - Intergenic
1199778778 X:151038974-151038996 GTTCTGAATGGGAGTGAGATGGG + Intergenic
1200017830 X:153179680-153179702 GTGGGGAATGGGAATGCGAATGG - Intronic