ID: 1162054009

View in Genome Browser
Species Human (GRCh38)
Location 19:8052162-8052184
Sequence CTCTATGAATATAGTCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162054009_1162054011 17 Left 1162054009 19:8052162-8052184 CCGTGCTGACTATATTCATAGAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1162054011 19:8052202-8052224 TCATCTAATTTCAGAACAAAAGG 0: 1
1: 0
2: 4
3: 31
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162054009 Original CRISPR CTCTATGAATATAGTCAGCA CGG (reversed) Intronic
902948662 1:19863191-19863213 CTCCTTGAATGTAGTAAGCATGG - Intergenic
909019464 1:70414771-70414793 CTGGATGAATATAGCTAGCAGGG + Intronic
910115058 1:83722816-83722838 CTCTAAAAATCTAGTAAGCAAGG + Intergenic
911782288 1:101897025-101897047 CTCTATGAATACATTCTGGAAGG - Intronic
917753289 1:178074128-178074150 TTCTATGAAGAAAGTCAACATGG - Intergenic
919026461 1:192177679-192177701 CTCAATGAATATAGGCTGTATGG + Intronic
1063311558 10:4957249-4957271 CTCTATGAAAAAACTGAGCAAGG + Intronic
1063915676 10:10879597-10879619 CTCTAGGAAAATAGTCTACAGGG + Intergenic
1064904120 10:20326963-20326985 CTCTATGCATGGACTCAGCATGG + Intergenic
1068426040 10:56865379-56865401 CTCTTTGAATATATTAAGTAGGG - Intergenic
1068683361 10:59843495-59843517 TTCTCTGAGTATAGTAAGCATGG + Intronic
1069344069 10:67446711-67446733 CTCTTTGAATATAGACATCAAGG + Intronic
1070223960 10:74481060-74481082 CTTTATTAATGTATTCAGCATGG + Intronic
1073171389 10:101511815-101511837 CTCTATTAATACAGCCAGCACGG - Intronic
1074967962 10:118509084-118509106 ATCTTTGAATCTAGTCAGCTGGG - Intergenic
1076431190 10:130403608-130403630 CTCTAAGAATCCAGGCAGCAGGG + Intergenic
1078526842 11:12107960-12107982 CTCCAGGAAGATGGTCAGCAAGG + Intronic
1083871976 11:65494095-65494117 CTCCAAGCATACAGTCAGCAAGG - Intergenic
1084026606 11:66454325-66454347 CTTTGTGAATAAGGTCAGCACGG - Intronic
1085172351 11:74460093-74460115 CTCTATGAACACAATCAGCCAGG + Intronic
1085413169 11:76303619-76303641 CTCTAGGAATCTAGTCAGTGTGG - Intergenic
1085413333 11:76304851-76304873 CTCTAGGAATCTAGTCAATATGG - Intergenic
1086643658 11:89191811-89191833 ATATATGAATATATTCATCATGG + Intronic
1090932064 11:131306741-131306763 ATCTATGAATACAGTCATGAGGG - Intergenic
1092837555 12:12505260-12505282 CCCCATGAATATCATCAGCAAGG - Intronic
1096019407 12:48310185-48310207 ATCTTTTAATATAATCAGCAAGG - Intergenic
1098485235 12:71013467-71013489 CTATATAAATGTAGTCAACAAGG - Intergenic
1098701555 12:73634746-73634768 CTCTATAAATAGAGGCAGTATGG - Intergenic
1099675909 12:85759873-85759895 CTCTTTGAATATTGTCCGAATGG - Intergenic
1105793618 13:23828957-23828979 CTCTAGTAATACAGACAGCATGG + Intronic
1107324567 13:39227219-39227241 CTCTATGCATATATTCAGAGAGG - Intergenic
1107484171 13:40810658-40810680 CCCTAGCAATATAGTCAGCGTGG - Intergenic
1109345347 13:61109148-61109170 CTCTGTGTATATAGTCACCCAGG - Intergenic
1110016314 13:70409757-70409779 CTATATATATATAGTCAGAAAGG - Intergenic
1116183391 14:41565001-41565023 CCCTAGGAATCTAGTCAGCAAGG + Intergenic
1116947053 14:50845465-50845487 CTCTATGACTATGATAAGCAGGG + Intergenic
1119224651 14:72935576-72935598 CTCAAGTAATATAGTTAGCAAGG - Intronic
1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG + Intergenic
1126695781 15:51324055-51324077 TTCTGTGAATATTGTCAGAAGGG - Intronic
1127717785 15:61666650-61666672 GTCTATGAAAATAGTCAGGCTGG + Intergenic
1129357674 15:75002473-75002495 CTCTCTGTATATTGTCAGCCAGG + Intronic
1129954876 15:79627274-79627296 CACTATGCATATAGTGAGCTGGG - Intergenic
1130730931 15:86491415-86491437 CTCTCTGGATAGAGTCAGAAAGG - Intronic
1137311010 16:47258490-47258512 GTCTATGTATATAGACAGGATGG + Intronic
1137404011 16:48176044-48176066 CTGAATGAATATAGGCAGTAGGG + Intronic
1143843432 17:9753395-9753417 CTCTATGTTTAAAGTCAGGAGGG - Intergenic
1149010349 17:51850205-51850227 TTCTATGAAAATATGCAGCATGG + Intronic
1153369456 18:4297640-4297662 CTCCATTAAGATAGACAGCACGG + Intronic
1155396248 18:25389610-25389632 CTATATGAATATACTCTTCAAGG - Intergenic
1158379263 18:56911012-56911034 CTCTATGAAAATCTGCAGCAGGG - Intronic
1158690521 18:59656007-59656029 CTCTGTGAATGTAGTGACCAGGG + Intronic
1161125094 19:2551273-2551295 CTCCATGAATATATTCTCCATGG - Intronic
1161600809 19:5181484-5181506 CTCTATTAAAAAAATCAGCAAGG - Intronic
1162054009 19:8052162-8052184 CTCTATGAATATAGTCAGCACGG - Intronic
1162624045 19:11869312-11869334 CTCTATGAATGTAAGCAGTATGG + Exonic
1162633836 19:11950610-11950632 CTCTATGAATGTAAGCAGTATGG + Exonic
1162653743 19:12112547-12112569 CTCTGTGAATGTAAACAGCATGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1168701902 19:58445385-58445407 CTCTATGAGTGCAGCCAGCATGG + Intergenic
926445532 2:12937049-12937071 CTTTATGAATACAGTCAGTAAGG - Intergenic
926682465 2:15674391-15674413 CTCTGTGACTATAGTAACCATGG + Intergenic
931098185 2:58965876-58965898 CTGTAAGAATATTGTCAGGAGGG - Intergenic
932842895 2:75100115-75100137 CTCTCTGAAAAAACTCAGCATGG - Intronic
937504477 2:122521252-122521274 CAGTATGAAGAAAGTCAGCAGGG + Intergenic
941799474 2:169641561-169641583 CTTTAAGAATTTAGCCAGCAGGG + Intergenic
942827693 2:180199796-180199818 CTCTAAGAATAAAGTCAGATTGG - Intergenic
945134762 2:206615367-206615389 CGTTATGAAGAAAGTCAGCAAGG + Intronic
945491629 2:210462630-210462652 TTGTATTAATATATTCAGCATGG - Intronic
945709704 2:213280095-213280117 ATCTAAGAATTGAGTCAGCATGG - Intergenic
1169653719 20:7898237-7898259 CTGTAGGTATATAGTCTGCAAGG - Intronic
1169962784 20:11180489-11180511 CTCTAGCAATGTGGTCAGCAAGG - Intergenic
1170101557 20:12705761-12705783 CTCTTTGAAAATAGTGAGTAAGG - Intergenic
1172393443 20:34582121-34582143 CTCTAACAACATGGTCAGCAGGG + Intronic
1173596455 20:44261683-44261705 CTCTTTTCATATAGACAGCAAGG + Intronic
1175411775 20:58775024-58775046 CTCTATCAATCTAGTCTTCATGG - Intergenic
1176939087 21:14902114-14902136 CTCTATGCGTATATTAAGCAAGG - Intergenic
1180618669 22:17145534-17145556 CTCTACAAATAAAGTCAGCTAGG + Intronic
956218053 3:66870820-66870842 CTGTCTGAATTTAGCCAGCAAGG - Intergenic
959568239 3:107854653-107854675 CTCCATGGAGATGGTCAGCAAGG - Intergenic
966080958 3:175999849-175999871 CTATATGAAGATAGTCACCTGGG - Intergenic
966202492 3:177371951-177371973 CACTATGAATCTAGTGTGCAAGG - Intergenic
966904446 3:184511669-184511691 CTCCATGAACACAGTAAGCACGG - Intronic
970848928 4:20578350-20578372 CTCTTTGAATTAACTCAGCAAGG - Intronic
971240954 4:24888255-24888277 ATCTATGTATATATTCAGCTTGG - Intronic
975855729 4:78622341-78622363 GTCTATGATTCTAGTAAGCAAGG + Intergenic
980745742 4:137012226-137012248 ATCTATGAATTTAATCATCATGG + Intergenic
981980942 4:150790182-150790204 ATCTAGTTATATAGTCAGCATGG + Intronic
983127391 4:163971040-163971062 TTCTATGAATATTTACAGCAGGG + Intronic
985981004 5:3463311-3463333 CTCTATAAATATAATGGGCAAGG + Intergenic
986114427 5:4757560-4757582 CTTTTTTAATATAGTGAGCACGG + Intergenic
986222820 5:5785245-5785267 CTCTATCAATATATCCATCAAGG - Intergenic
990879403 5:60522538-60522560 CTCTAAGAAAATAGTCTGAATGG - Intergenic
993521052 5:88901068-88901090 CTCTATAGATATGGACAGCAAGG + Intronic
998308623 5:141103501-141103523 TTATATGAATATATTCAACAAGG - Exonic
999973086 5:156884310-156884332 CTCTATGAAAACAGTCACCTTGG - Intergenic
1000139148 5:158384452-158384474 CTATATGTATTTAGTCAGAATGG + Intergenic
1002336292 5:178480736-178480758 CTCTAGGTATCTAGTCAACAAGG + Intronic
1004215028 6:13694333-13694355 TTCTATGAATATATACAACAGGG + Intronic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1010408818 6:75537340-75537362 CTCTGTGAAGAAAGTCAGCACGG - Intergenic
1016882357 6:148923452-148923474 CTTTTTGATTATAGTCAGCCAGG + Intronic
1019067997 6:169318775-169318797 CTCTAACAATATAGTCTGGAGGG - Intergenic
1022210716 7:28206358-28206380 CTCTATGAAGGTAGCCAGCCAGG - Intergenic
1025075518 7:55939374-55939396 CCCTATGAATATAGTGAGTGTGG + Exonic
1028651910 7:93159585-93159607 GTCTGTTAATATAGTCTGCAAGG + Intergenic
1030441038 7:109590022-109590044 CTCTCTGAATGTAGATAGCAAGG - Intergenic
1031023992 7:116660750-116660772 CTCTATGAGTATAATAAACATGG + Intergenic
1032323631 7:130906168-130906190 CTTTATGAATATGGCTAGCAAGG - Intergenic
1033360822 7:140637860-140637882 CTCTGTGAATGTAGAGAGCAAGG - Intronic
1033389657 7:140914742-140914764 CTCTATAAAAATAATCAGCCAGG + Intronic
1035117865 7:156539936-156539958 CTCTGTGAATTTAGTTGGCACGG + Intergenic
1035736948 8:1895778-1895800 CTCTTTGAATATTGATAGCAAGG + Intronic
1036468057 8:9021295-9021317 CTCCAGGAAGATAGTCTGCAAGG - Intronic
1039820887 8:41134189-41134211 ACCTAGGAATATAGTCAACAAGG + Intergenic
1040568904 8:48591194-48591216 CTCTGTGAATGTAGGCAGGAAGG + Intergenic
1040823905 8:51596589-51596611 CTCTATAATAATAGTCAGAATGG - Intronic
1044558952 8:93593881-93593903 CTCTATGAACAAAGTGAGCCTGG - Intergenic
1044559203 8:93596083-93596105 CTCTCTGAAAATAGACAGCGTGG + Intergenic
1045809156 8:106201294-106201316 CACTATGAATATATTATGCAAGG - Intergenic
1045970061 8:108069979-108070001 CAATATGACTATAATCAGCATGG - Intronic
1048790741 8:138101048-138101070 CTGTATGTATAGCGTCAGCAGGG - Intergenic
1049630356 8:143651328-143651350 CTCTATGAATGTAGTCAGTATGG + Exonic
1050834129 9:10054476-10054498 CTCTAAGAAAATGGACAGCAGGG - Intronic
1051373466 9:16379473-16379495 ATCTAGGAATACAGTTAGCAAGG - Intergenic
1055136108 9:72831025-72831047 ATGTATGAAAATAGTCAACATGG - Intronic
1188545128 X:31297047-31297069 GTGTATGTATATAGTAAGCATGG + Intronic
1189399641 X:40655336-40655358 CTCAATGAATATAGAGAGGAGGG - Intronic
1190579385 X:51876198-51876220 CTCTATGAATGTAGTGATCATGG + Intronic
1190579544 X:51878441-51878463 CTCTATGAATGTAGTAATCATGG + Intronic
1193151529 X:78129409-78129431 ATATAGGAATATAGCCAGCATGG - Intergenic
1194702013 X:97125994-97126016 CTCTATGAAAACAGTCTTCATGG - Intronic
1197160388 X:123316566-123316588 CTGTATGAGTGTTGTCAGCACGG + Intronic
1197400923 X:125989961-125989983 CTCTATAAAAGTAGTCATCAAGG + Intergenic
1200223603 X:154404524-154404546 CTCTATGAAAGTGGCCAGCAAGG - Intronic
1200268183 X:154657878-154657900 CTCTTTGAATATAGACATCCTGG - Intergenic