ID: 1162060908

View in Genome Browser
Species Human (GRCh38)
Location 19:8094632-8094654
Sequence CACACAGTGATTGCAGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162060908_1162060912 -5 Left 1162060908 19:8094632-8094654 CCAACACCTGCAATCACTGTGTG 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1162060912 19:8094650-8094672 GTGTGATCACTGAGGGCCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 200
1162060908_1162060922 28 Left 1162060908 19:8094632-8094654 CCAACACCTGCAATCACTGTGTG 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1162060922 19:8094683-8094705 CCAGTGGCAATTCTGGCTCCAGG 0: 1
1: 0
2: 0
3: 21
4: 268
1162060908_1162060923 29 Left 1162060908 19:8094632-8094654 CCAACACCTGCAATCACTGTGTG 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1162060923 19:8094684-8094706 CAGTGGCAATTCTGGCTCCAGGG 0: 1
1: 0
2: 1
3: 35
4: 222
1162060908_1162060917 21 Left 1162060908 19:8094632-8094654 CCAACACCTGCAATCACTGTGTG 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1162060917 19:8094676-8094698 AGCCCTCCCAGTGGCAATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 118
1162060908_1162060915 12 Left 1162060908 19:8094632-8094654 CCAACACCTGCAATCACTGTGTG 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1162060915 19:8094667-8094689 CCCAGGACAAGCCCTCCCAGTGG 0: 1
1: 0
2: 1
3: 59
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162060908 Original CRISPR CACACAGTGATTGCAGGTGT TGG (reversed) Intronic
900955405 1:5883592-5883614 CCCACAGTGAATGGAGGTGCTGG - Intronic
901036575 1:6339473-6339495 CACAGAGTGCTTGGAGGTGTAGG + Exonic
906697605 1:47834014-47834036 TTCACTGGGATTGCAGGTGTTGG - Intronic
908445684 1:64197231-64197253 CACACGGAAAGTGCAGGTGTTGG + Intergenic
908662908 1:66456200-66456222 CCCCCAGTGATTGAAGGTGAGGG - Intergenic
909925687 1:81435384-81435406 CACAGAGAGATTGGAGGTGGGGG - Intronic
911062683 1:93761603-93761625 CACACAGTAACTGCAGGGCTAGG - Intronic
912197047 1:107410269-107410291 TACACAGTGATTAAAGGTTTTGG + Intronic
912306308 1:108571084-108571106 GCCAGAATGATTGCAGGTGTTGG + Intronic
912536060 1:110372466-110372488 AACTCAGTTCTTGCAGGTGTAGG - Intronic
915344961 1:155192779-155192801 CTCACAGTGCTTACAGGTGAGGG - Exonic
918068473 1:181117924-181117946 AACACAGTAATAGCAGGTCTGGG + Intergenic
918489057 1:185060852-185060874 AACACTGGGATTACAGGTGTGGG - Intronic
920492789 1:206430540-206430562 CTCACAGTCTTTGCAAGTGTGGG + Intronic
922173550 1:223177536-223177558 TACACAGTGGAGGCAGGTGTGGG - Intergenic
923476034 1:234332189-234332211 GGCACAGTGATTGCTAGTGTAGG - Intergenic
923743373 1:236676787-236676809 CACACTAGGATTACAGGTGTGGG + Intergenic
1063390313 10:5646061-5646083 CGCACAGTGACTGTTGGTGTTGG - Intronic
1064900396 10:20289689-20289711 CACACAATGACTGGAGCTGTCGG + Exonic
1069830294 10:71278781-71278803 GACACAGTGAATGAAGCTGTGGG - Intronic
1072215170 10:93281756-93281778 GCCACAGTGATTGCTGTTGTTGG + Intergenic
1072988675 10:100167889-100167911 TACCAAGTGATTGCAGGGGTTGG - Intronic
1076331388 10:129672766-129672788 ATCACAGGGATTCCAGGTGTTGG - Intronic
1080165465 11:29231205-29231227 CACACAGTCATTGCCCTTGTGGG + Intergenic
1080596860 11:33780792-33780814 CACACAGTGATTACAGGCTTTGG + Intergenic
1082792258 11:57354380-57354402 CACACTGAGATTGCAGTTGGTGG + Intronic
1084092157 11:66885850-66885872 CACCCTGTGATGGCAGCTGTAGG + Intronic
1084294173 11:68199847-68199869 GACAGATTGAATGCAGGTGTAGG + Intronic
1084656554 11:70523057-70523079 CACACCAGCATTGCAGGTGTGGG - Intronic
1086432258 11:86747305-86747327 CACCCTGAGATTGCAGTTGTGGG - Intergenic
1088337979 11:108729685-108729707 CTCAGAGGGATTACAGGTGTGGG - Intronic
1088840585 11:113624380-113624402 TACTCAGTGAGTGCAGGTGCTGG - Intergenic
1092834556 12:12475384-12475406 CATACAGTGATTGTAGGTTGAGG + Exonic
1093144039 12:15543208-15543230 TACACAGTGATCACAGGTGCAGG + Intronic
1094219504 12:27976360-27976382 CACTCAATGAAAGCAGGTGTTGG - Intergenic
1096334186 12:50740620-50740642 AACAAAGTGATTGAAGCTGTTGG - Intronic
1098090624 12:66896976-66896998 CACACAGTGGTTACACGTGCAGG + Intergenic
1098102027 12:67028039-67028061 GACACAGTGTTTGGAGGTGAGGG - Intergenic
1100420647 12:94429684-94429706 AGCACAGTGATGGCAGCTGTGGG - Intronic
1102057732 12:109909366-109909388 TAGACAGAGATTGCAGGTGCTGG - Intronic
1104548056 12:129730543-129730565 CACACACTGATTGCATATCTTGG + Intronic
1104611813 12:130235087-130235109 CACAGACTGGTTGCAGGTTTGGG + Intergenic
1110623550 13:77625996-77626018 CACACAATGACTACAGTTGTGGG - Intronic
1110692310 13:78444985-78445007 CACACAGTGATTGCATTGGAAGG + Intergenic
1111871495 13:93838658-93838680 GACACACTGATGGCAGGTGCTGG + Intronic
1112000477 13:95204899-95204921 CTCACCGTGATTGCAGGTGTTGG - Intronic
1113864341 13:113511442-113511464 CACACAGTGAGGGCACATGTGGG - Intronic
1115515320 14:34179480-34179502 CACACAGTGAGTACAAGTGCTGG - Intronic
1119324118 14:73749197-73749219 CACACAGATACTGCAGCTGTAGG + Intronic
1119580067 14:75770466-75770488 CATTCAGTGATTGCATTTGTGGG + Intronic
1123798655 15:23798693-23798715 CACATGGGGGTTGCAGGTGTGGG + Intergenic
1127360616 15:58241814-58241836 GACACACTGGTTGGAGGTGTTGG - Intronic
1129751800 15:78070520-78070542 CACACAGTGAGTGAATGAGTGGG + Intronic
1130890182 15:88127190-88127212 GTCACAGTGATAGGAGGTGTGGG + Exonic
1134310199 16:13069525-13069547 CACACAATGTGTGCATGTGTAGG + Intronic
1136533033 16:30882621-30882643 CAGAGAGTGACTGCAGGTGTGGG + Intronic
1137359415 16:47799494-47799516 CACACTGTGATTTAAGGGGTGGG - Intergenic
1138273138 16:55710337-55710359 CACCAAGTGACTGCAGATGTGGG - Intergenic
1141218699 16:82048917-82048939 CAAACAGTGAATGCTGCTGTAGG + Intronic
1144491550 17:15716533-15716555 CCCACATTCATTGCAGGTATAGG - Exonic
1144738011 17:17565635-17565657 CACACAGTGGCAGCTGGTGTTGG - Intronic
1144908934 17:18662672-18662694 CCCACATTCATTGCAGGTATAGG + Exonic
1144913962 17:18706758-18706780 CCCACAGTCTTTACAGGTGTAGG + Intronic
1146782894 17:35691569-35691591 CACACTCTGATTGCATTTGTGGG + Intronic
1152310008 17:79544358-79544380 AACACGGTGATTGCTGGTGTTGG + Intergenic
1157338798 18:46760181-46760203 TACACATTGATTTCAGCTGTTGG + Intergenic
1157453525 18:47805818-47805840 CACACAGATATTGCATATGTTGG - Intergenic
1159506838 18:69349127-69349149 CACACAGTGATTTTAGGGGTGGG + Intergenic
1159912809 18:74162357-74162379 CACACAGGGCTCACAGGTGTAGG + Intergenic
1162060908 19:8094632-8094654 CACACAGTGATTGCAGGTGTTGG - Intronic
1162552909 19:11367797-11367819 CCCACAGTGATAGGAGGTGGGGG - Intergenic
1163059915 19:14753170-14753192 AGCACAGAGATTCCAGGTGTGGG + Intronic
1163455871 19:17405291-17405313 CACAGTGTGGTTGCAGGTGGCGG + Exonic
1163702216 19:18791545-18791567 CACACAGTGAATGAAAGTGGGGG - Intergenic
1166088491 19:40492628-40492650 CACACTGTGGATGCAGGAGTGGG + Intronic
1166296387 19:41892144-41892166 CAAACAGGGATTGCAGGGTTGGG - Intronic
1167940903 19:52945137-52945159 CACACACGGTTTACAGGTGTCGG + Intronic
927833831 2:26375055-26375077 TACATAGTGACTGCAGTTGTGGG + Exonic
928879148 2:36077460-36077482 CAAACAGTGACTTAAGGTGTAGG + Intergenic
929110028 2:38398409-38398431 CACACTGGGATTGCAGGCGTAGG + Intergenic
929386567 2:41414827-41414849 CACTCAGAGAGTCCAGGTGTTGG - Intergenic
929549792 2:42882434-42882456 CACACATTGATTATAGGAGTTGG - Intergenic
930466973 2:51766736-51766758 CACAGAGTGATTTCATGTCTTGG - Intergenic
933619853 2:84526336-84526358 CACACACTGAGTGCTGGTTTGGG + Intronic
935210675 2:100937358-100937380 CTCAAAGTGATGGCAGGGGTAGG + Intronic
936828566 2:116611648-116611670 GACATTGGGATTGCAGGTGTGGG - Intergenic
940379053 2:152992968-152992990 CTCACAGTGATTGTTTGTGTTGG + Intergenic
943185869 2:184606780-184606802 GACTCAGTGATTGCAGGAGCTGG - Intronic
946070495 2:217030564-217030586 CACACAATGAATGAAGGTGGGGG + Intergenic
1169219802 20:3815417-3815439 CACCCAGTGGCTGCAGATGTGGG - Intergenic
1170247788 20:14243044-14243066 CACACAGTTATTGTATGTTTTGG + Intronic
1170610514 20:17908950-17908972 CATAAAGTCTTTGCAGGTGTTGG + Intergenic
1172480688 20:35269687-35269709 AACCCAGTGATTGCAGCTGTGGG - Intronic
1174391162 20:50219187-50219209 CACACAGTGTTGGCTGCTGTGGG + Intergenic
1174486606 20:50865404-50865426 CACACAGGGACAGCAGGTGGGGG - Intronic
1174514913 20:51084133-51084155 TACACAGTGGATGCAGATGTGGG + Intergenic
1181014418 22:20061060-20061082 CACACAGTGGGCACAGGTGTAGG - Intronic
1181313386 22:21957378-21957400 CTCACAGACACTGCAGGTGTCGG + Exonic
1181346492 22:22223450-22223472 CTCACAGACACTGCAGGTGTCGG + Intergenic
1182136369 22:27907619-27907641 CACACAAAGATGGCAGCTGTGGG - Intronic
1185312808 22:50165992-50166014 CACGCTGGGATTGCAGGCGTGGG - Intergenic
1185312842 22:50166160-50166182 CACGCTGGGATTGCAGGCGTGGG - Intergenic
1185312882 22:50166352-50166374 CACGCTGGGATTGCAGGCGTGGG - Intergenic
953568777 3:44055163-44055185 CAAAAAGTTATTGCAGGTTTGGG + Intergenic
953961747 3:47271415-47271437 CGCACAGTGATGGCATGTGTGGG + Exonic
954001257 3:47558894-47558916 CACACAGGGATTCCAGTTATTGG + Intergenic
954681224 3:52347103-52347125 CACACAGTCATTGCCGGTTTTGG + Intronic
957218927 3:77357290-77357312 AATACAGTTATTGCAGGAGTGGG + Intronic
958258115 3:91348272-91348294 CAGACAGTGTTTTCAGGTGAAGG + Intergenic
963059413 3:141212752-141212774 CAGACAGTGAAGGCAGGTGCTGG + Intergenic
963262190 3:143204211-143204233 CACACAGTGAGGGCGTGTGTGGG + Intergenic
965500199 3:169446684-169446706 CTCACAGTGGGTGCAGGTGTGGG - Intronic
969890969 4:10259819-10259841 CACACAATGTCTGCTGGTGTTGG - Intergenic
970806962 4:20048318-20048340 TACACAGTGCTTGGAGCTGTTGG - Intergenic
971268374 4:25114383-25114405 CACACAGAGGCAGCAGGTGTGGG - Intergenic
972541606 4:40043862-40043884 CACAGAGTGCTTGGAGGTGTAGG + Intergenic
975433320 4:74320783-74320805 CAGAGAGTGACTGAAGGTGTGGG - Intergenic
979467699 4:121059541-121059563 CATACAGTGATGGCATGTGCTGG + Intronic
979648855 4:123106962-123106984 CACACACTGATAACAGGTGCTGG + Intronic
983235736 4:165177443-165177465 TACACAGTGATTGCAGGTGAGGG + Intronic
984999341 4:185469345-185469367 AACACAGTGTTTACAGGTCTGGG - Intronic
985912629 5:2895853-2895875 CCCAGAGTGCCTGCAGGTGTGGG + Intergenic
987751183 5:22039700-22039722 CACAAAGTCATTGCTGATGTTGG + Intronic
988186482 5:27870868-27870890 CATACCTTGGTTGCAGGTGTAGG - Intergenic
989812524 5:45695662-45695684 CTTACAGTGATTTCAGGTGAGGG - Exonic
991420590 5:66437400-66437422 CACAAACTGATAGCAGGGGTTGG - Intergenic
991421947 5:66451234-66451256 CACACATTGATAGCAGGGATAGG - Intergenic
993376899 5:87159268-87159290 TACACAGTTATTGCAGTTTTGGG - Intergenic
994190441 5:96863152-96863174 CACACAGGGAGTGAAGGTGGGGG - Intronic
996624205 5:125550539-125550561 CTCACAATGGTTGCTGGTGTTGG - Intergenic
998354425 5:141522988-141523010 CTCACAGTGATGGCTGTTGTTGG + Intronic
1000350540 5:160349330-160349352 CACATCGTGGTTGCCGGTGTTGG + Exonic
1004806681 6:19210755-19210777 CACACAGAGCTGGCAGATGTGGG - Intergenic
1006403348 6:33830448-33830470 CACACGGTGCTGGCAGGAGTAGG - Intergenic
1008449629 6:51635658-51635680 GACACAGTGGCTGGAGGTGTGGG + Intronic
1009281172 6:61753694-61753716 CACACATTAATTGTAGATGTGGG - Intronic
1010277303 6:73984272-73984294 CAGACAGTGACTGAAGGTATGGG - Intergenic
1011470478 6:87702612-87702634 CCCACAGTGATTTCAGATCTGGG + Intergenic
1011675507 6:89729426-89729448 CATACAGTGATTCAGGGTGTAGG - Intronic
1011849799 6:91612056-91612078 CAAGCAGTGAATGCATGTGTAGG - Intergenic
1011941661 6:92850257-92850279 CACACAGGGATTGAAGCTGTGGG - Intergenic
1014931557 6:127342763-127342785 CATACAGGGATTACACGTGTAGG - Exonic
1015713714 6:136168698-136168720 CAGACACTGATTGCAGATGAGGG + Intronic
1016669984 6:146693378-146693400 CACACAGAGAAGGCAGCTGTTGG + Intronic
1023130120 7:36994625-36994647 CAGACTGAGATTGCAGGAGTGGG - Intronic
1023723372 7:43117714-43117736 CCCACAGTGTTTGGATGTGTGGG + Intronic
1025716923 7:63966624-63966646 CACACAGTACTTGTAGGTTTTGG - Intergenic
1029358595 7:100071530-100071552 CCCACATTCATTGCAGGCGTAGG + Exonic
1029985754 7:104921880-104921902 CACATAGTGAGGCCAGGTGTGGG - Intergenic
1030427724 7:109400666-109400688 CACACCTTGATTGCAGGTTTGGG + Intergenic
1033551998 7:142455811-142455833 AACACAGTGAGTGCAAATGTAGG + Intergenic
1033554270 7:142474744-142474766 AACACAGTGACTGCAAATGTAGG + Intergenic
1033556537 7:142492849-142492871 AACACAGTGACTGCAAATGTAGG + Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1035291723 7:157843636-157843658 CGCTCATTGAGTGCAGGTGTCGG + Intronic
1037454445 8:19049423-19049445 AGCACTGAGATTGCAGGTGTGGG - Intronic
1038679434 8:29653182-29653204 CACACAGAGATGGCAGGACTTGG - Intergenic
1038882912 8:31634486-31634508 GAGTCAGTGATTGCTGGTGTGGG - Intergenic
1038924479 8:32123123-32123145 TTCACAGTGATTCCATGTGTAGG + Intronic
1039745327 8:40420461-40420483 GACACACAGATGGCAGGTGTAGG - Intergenic
1041932644 8:63304153-63304175 CACTCAGTGTATGCATGTGTTGG + Intergenic
1043274439 8:78375729-78375751 CACACAGTTATTTCAGGAGGGGG - Intergenic
1044525125 8:93242398-93242420 GACACACTGATGGCAGCTGTGGG - Intergenic
1048479261 8:134772794-134772816 AACACTGAGATTACAGGTGTGGG - Intergenic
1051746774 9:20302341-20302363 CTCTCATTGATTGCTGGTGTGGG - Intergenic
1054804728 9:69386926-69386948 CCCACAGTGAAGGCAGGTCTTGG - Intronic
1057855218 9:98596335-98596357 CACTCAGTGTGTGCAGGTGCAGG - Intronic
1060839453 9:126782235-126782257 CACACAGTGAATGCAGGTGAGGG - Intergenic
1061101347 9:128494850-128494872 CACAAAGTGATTGTAGTTATAGG + Intronic
1185975590 X:4716024-4716046 CACACATTAATTGAATGTGTAGG + Intergenic
1186966690 X:14794735-14794757 CACACAGTCATTGCAGTAGGTGG + Intergenic
1188027491 X:25226042-25226064 CACACAGTTGCTGCAGGTGAGGG - Intergenic
1192216404 X:69162366-69162388 CACACAGTACTTCCAGGTGGAGG - Exonic
1195845944 X:109228966-109228988 CACCCAGGGAGTGCAAGTGTTGG + Intergenic
1200720943 Y:6605227-6605249 CACACAGTGATAGTTGGTGGGGG + Intergenic
1201691938 Y:16777029-16777051 CACACAGTGATGACAAATGTTGG - Intergenic
1201984816 Y:19954233-19954255 CCCATAGTGATTGTAGGAGTAGG + Intergenic