ID: 1162065621

View in Genome Browser
Species Human (GRCh38)
Location 19:8123698-8123720
Sequence CTGGAGATGGGAAGTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 391}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162065621_1162065628 15 Left 1162065621 19:8123698-8123720 CCAAACACACTTCCCATCTCCAG 0: 1
1: 0
2: 5
3: 34
4: 391
Right 1162065628 19:8123736-8123758 GTGCCCCTCCCCATCCTTCCAGG 0: 1
1: 0
2: 5
3: 32
4: 379
1162065621_1162065630 17 Left 1162065621 19:8123698-8123720 CCAAACACACTTCCCATCTCCAG 0: 1
1: 0
2: 5
3: 34
4: 391
Right 1162065630 19:8123738-8123760 GCCCCTCCCCATCCTTCCAGGGG 0: 1
1: 0
2: 5
3: 27
4: 397
1162065621_1162065629 16 Left 1162065621 19:8123698-8123720 CCAAACACACTTCCCATCTCCAG 0: 1
1: 0
2: 5
3: 34
4: 391
Right 1162065629 19:8123737-8123759 TGCCCCTCCCCATCCTTCCAGGG 0: 1
1: 0
2: 2
3: 34
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162065621 Original CRISPR CTGGAGATGGGAAGTGTGTT TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900393376 1:2443430-2443452 CTGGAGATGGGAAGCGCTCTCGG + Intronic
900798926 1:4725994-4726016 CTGGAGGTGGGAGGTGTTATGGG - Intronic
901919109 1:12523606-12523628 CTGGAGATGGGAGAGGAGTTGGG + Intergenic
902955471 1:19922038-19922060 CTGGAGCTGGGAGGTGTCTGTGG + Intronic
903572145 1:24313870-24313892 CTGGAAATGGGAAGTGGCTGAGG + Intergenic
904029471 1:27525254-27525276 CAGGGTGTGGGAAGTGTGTTAGG + Intergenic
904610186 1:31721531-31721553 CTGGAGGTGGGAATGGGGTTGGG - Intergenic
905011704 1:34751550-34751572 CTGGAGGTGGGAAGGGTGGAAGG - Intronic
905698828 1:39996384-39996406 CTGGAGATGGGGAGAGTCCTGGG - Intergenic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
907011712 1:50969213-50969235 CTGGAGATGGGGAGAGTCCTGGG - Exonic
907802144 1:57779831-57779853 CTGGAGAGGTAAAGTGTGATGGG - Intronic
908512331 1:64859425-64859447 CTGGTGATGGGCAATGTGTGAGG - Intronic
909258016 1:73449024-73449046 CTGAAAATGTGAAGTGAGTTTGG - Intergenic
909546251 1:76851475-76851497 CTGGGGAGGGAAAGTGTGATTGG + Intergenic
909554979 1:76943574-76943596 CAGGAGATGGGAGGCTTGTTTGG - Intronic
911968118 1:104393925-104393947 CAGGAGTTGGGAAGGGTATTTGG + Intergenic
912156605 1:106928743-106928765 CTGGGGATGGGGAGTGAGTGGGG + Intergenic
912405590 1:109434953-109434975 ATGGAGATGGGAAACTTGTTGGG - Intergenic
912839730 1:113028435-113028457 TTAGAGCTAGGAAGTGTGTTAGG - Intergenic
913214655 1:116610343-116610365 CTTGAGATGAGAAGAGTCTTTGG - Intronic
914320575 1:146555548-146555570 CTGGAGGTGGGAAGGGTAGTGGG + Intergenic
914351710 1:146845559-146845581 CTGGAGATGAGAAACTTGTTGGG - Intergenic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
916514116 1:165499327-165499349 CTGGAGTGGAGAAGTGTGTGGGG - Intergenic
917076183 1:171207467-171207489 CTGGAAAAGGGAAGTGTGTCTGG - Intronic
918380625 1:183950997-183951019 CTGTGGATGGAAAGTGAGTTGGG - Exonic
919948081 1:202336892-202336914 CTAGAGTTGAGAAGAGTGTTGGG - Intronic
920225435 1:204435085-204435107 CTGGAAATGGGAATTTTATTTGG - Intronic
920950166 1:210565057-210565079 CTGGAGATGGGAGGTGGGAAGGG + Intronic
921630103 1:217423083-217423105 CTGGAGCTGGGCACTGGGTTCGG + Intergenic
922063437 1:222113373-222113395 TGTAAGATGGGAAGTGTGTTTGG - Intergenic
922914141 1:229241651-229241673 CTTGAGATGGGATGTGGGTGGGG - Intergenic
923262768 1:232283221-232283243 CTGGAGGTGGGAAGAGAGGTAGG - Intergenic
923463202 1:234225077-234225099 CTGGAAAGGGCAAGTGGGTTGGG + Intronic
924575497 1:245277254-245277276 AGGGACATGGGAAGTGAGTTTGG + Intronic
1062917439 10:1252058-1252080 CTAGAGATGGGTAATGTGCTGGG - Intronic
1064037653 10:11927940-11927962 GTGTAGATGGGGAGTGTGCTGGG - Intronic
1064620904 10:17216430-17216452 AAGGATATGGGCAGTGTGTTGGG + Intergenic
1066046407 10:31599267-31599289 CTGATGATCGTAAGTGTGTTAGG - Intergenic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1068736982 10:60424961-60424983 CTAGAGATGGGAAATGAGTACGG + Intronic
1068964031 10:62894056-62894078 GTGAAGAGGGTAAGTGTGTTGGG - Intronic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074124056 10:110514269-110514291 CTGGAGAAGGGGATTGTGTGGGG - Intergenic
1074410671 10:113225769-113225791 CTGGAGATGGGAGATGTGTTAGG + Intergenic
1075623987 10:123948561-123948583 CTGGAGATGAGCAGTGTGGTGGG - Intergenic
1075659231 10:124181926-124181948 CTGGAGCTGGGAACTGTGCTAGG - Intergenic
1075981471 10:126743971-126743993 CTGAGAATGGGAATTGTGTTTGG - Intergenic
1075990952 10:126838198-126838220 CTGGAGAAGGGAGGTGGATTCGG - Intergenic
1076478862 10:130770588-130770610 CTGGAGAGGGGTATTGTGGTTGG - Intergenic
1076904037 10:133353460-133353482 CTGGAGCTGGCAAATGTGTGTGG - Intergenic
1077441007 11:2569199-2569221 CTGGAGATGGCAGGGGTGTAAGG - Intronic
1078135109 11:8645410-8645432 CTGGACATGAGCAGTGTGCTGGG - Intronic
1078906667 11:15693999-15694021 CTGGAGGTGAGGACTGTGTTGGG + Intergenic
1079366993 11:19818015-19818037 CTGGAGCTGGGAAGCCTGTGGGG - Intronic
1079380784 11:19935194-19935216 CTGGAGATGAGCAGTGCATTTGG + Intronic
1079925514 11:26487678-26487700 ATGGAGATGAGGAGTTTGTTGGG + Intronic
1080944615 11:36957609-36957631 CCTGGGAAGGGAAGTGTGTTGGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1083033054 11:59612073-59612095 CTGGATATGCCAGGTGTGTTTGG - Intronic
1083767489 11:64848837-64848859 CTGCAGAGGGCAGGTGTGTTGGG + Intergenic
1084107296 11:66988440-66988462 CCTGAGGTGGGATGTGTGTTGGG - Intergenic
1084408417 11:68992123-68992145 TTGGAGGTGGGGCGTGTGTTAGG + Intergenic
1085439153 11:76542234-76542256 CTGGGGCTGGGAAGGCTGTTGGG - Exonic
1086849544 11:91793160-91793182 CTGGAGCTGGGAAGTTGGTGAGG - Intergenic
1087908359 11:103725136-103725158 ATGGAGATGGGAAATTTGTTGGG - Intergenic
1088902930 11:114132392-114132414 CTTGAGAGATGAAGTGTGTTTGG - Intronic
1089154892 11:116394151-116394173 CTTGAGATGAGAAGCGTGTCTGG + Intergenic
1089602001 11:119622128-119622150 CTTGAGAAGAGAAGTGTGTATGG + Intergenic
1091317344 11:134623917-134623939 CTGGGGCTGGGACTTGTGTTGGG - Intergenic
1091665123 12:2413414-2413436 CTGAGGAGGGGAAGAGTGTTGGG - Intronic
1091883587 12:3999794-3999816 CTGGAAACAGGAAGTTTGTTTGG - Intergenic
1092172461 12:6382711-6382733 CAGGTGATGGGAAGTGTGCATGG - Intronic
1092928677 12:13294981-13295003 CTGGAGTGGAGACGTGTGTTAGG + Intergenic
1093089104 12:14901788-14901810 CTGTAGATGGGAAATGTGGCAGG + Intronic
1093316845 12:17662846-17662868 CTGGAGATGGGTAGTGCCTCCGG + Intergenic
1093688504 12:22083608-22083630 CTTGAGTGGGGAAGTGTGGTGGG + Intronic
1094043486 12:26142290-26142312 CTGGAGATGGGAAACCAGTTGGG + Intronic
1095361311 12:41343574-41343596 CTGGAGAGGGGAAGTGGGGGAGG + Intronic
1096120814 12:49088553-49088575 CTCCAGAAGGGAAGTGTCTTGGG - Intergenic
1098836282 12:75428209-75428231 ATGGAGATGGGAAACTTGTTGGG + Intronic
1099079833 12:78163274-78163296 CTGGAAATAGGAAAAGTGTTAGG - Intronic
1100219911 12:92493646-92493668 CAGGAGATGGCCAGTGTGGTGGG - Intergenic
1100730491 12:97462220-97462242 CTGGGGGTGGGAGGTGTTTTGGG + Intergenic
1101529973 12:105564828-105564850 CAGGAGATGGGAATTGGGTGAGG - Intergenic
1102397499 12:112599741-112599763 TTAGAGATGGGAAGGGTGGTGGG - Intronic
1103191656 12:119006832-119006854 CTGGAGATGGGCATGGTGGTGGG + Intronic
1103489979 12:121309896-121309918 CTGGTGAAGGGCAGTGGGTTTGG - Intronic
1103517147 12:121515095-121515117 TGGGGGATGGGAAGTGTGATTGG - Intronic
1103517153 12:121515115-121515137 CAGGGGATGGGGAGTGTGATTGG - Intronic
1103517220 12:121515315-121515337 CAGGGGATGGGGAGTGTGATTGG - Intronic
1103544664 12:121691341-121691363 TTGGAGATTGGAATTGTTTTAGG + Intergenic
1103927117 12:124429292-124429314 CAGGAGATGGGAAGAGTGAGAGG + Intronic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104120333 12:125792903-125792925 CTGGAGTTAGTAATTGTGTTAGG + Intergenic
1105205701 13:18221713-18221735 CCTGAGATGGGAAATGTATTTGG - Intergenic
1106819046 13:33443012-33443034 CTGGAGATGGACAGTGGGGTTGG + Intergenic
1106913706 13:34489406-34489428 CTGGAGATGGGTAGTGATGTCGG - Intergenic
1107408292 13:40135736-40135758 CTTGAGAAGGGGTGTGTGTTGGG - Intergenic
1108083905 13:46764550-46764572 ATGGAGCTGGGAAGTGGGTGAGG - Intergenic
1108258248 13:48631120-48631142 ATGGAAGAGGGAAGTGTGTTTGG - Intergenic
1109272711 13:60272331-60272353 GTAGAAATGGGAAGTGTGTGGGG - Intergenic
1109481684 13:62963758-62963780 GTGGAGATGAGGAATGTGTTGGG + Intergenic
1110038329 13:70717574-70717596 ATGGAGATGAGAAACGTGTTGGG + Intergenic
1110728103 13:78849610-78849632 GTGGAAATCGGAAGTGTGTGAGG + Intergenic
1110819644 13:79899838-79899860 CTTGTGATGGGAAGTGCATTGGG - Intergenic
1111170787 13:84523788-84523810 CTGAAGTTGGGCAGTGTTTTTGG - Intergenic
1113320733 13:109229665-109229687 CTGGAGATGAGGAATGTATTGGG - Intergenic
1114481594 14:23038909-23038931 AGGGAGGTGGGAGGTGTGTTAGG + Intergenic
1114798396 14:25742551-25742573 CTGGAAAGGGTGAGTGTGTTGGG + Intergenic
1118164404 14:63321789-63321811 CTGGAGCTGGGAAGGGCCTTAGG - Intergenic
1118306145 14:64657316-64657338 CTGGAGATAGAAAATCTGTTAGG - Intergenic
1118981927 14:70724189-70724211 CTGGAGAAGGGAAGTGATTATGG - Intronic
1120739553 14:88092540-88092562 CTGGACAAGGGAAGTGTGTGAGG + Intergenic
1120758886 14:88268740-88268762 TTGGAGCTGTGAAGTGTGATAGG - Intronic
1121266866 14:92609521-92609543 CTGGAGCTGGCAATTTTGTTGGG + Intronic
1121629478 14:95412063-95412085 CAGGAGGTCAGAAGTGTGTTGGG - Intronic
1123160455 14:106273926-106273948 CTGGAGATAGGAAGTGTATTTGG + Intergenic
1123208215 14:106734554-106734576 CCGGAGATATGAAGTGTATTGGG + Intergenic
1123481532 15:20637258-20637280 CCGGAGATATGAAGTGTATTTGG + Intergenic
1123636480 15:22363107-22363129 CCGGAGATATGAAGTGTATTTGG - Intergenic
1123881692 15:24682578-24682600 CTGGAGGAGGGAACTGTGGTAGG - Exonic
1126252321 15:46582820-46582842 CTGGAGATGGGGAGATTGCTGGG + Intergenic
1127078988 15:55357164-55357186 TTGGAGATGAGAATTGTGTTTGG - Intronic
1127622034 15:60743668-60743690 CTGGAGATGGGCAGAGAGATTGG - Intronic
1127953991 15:63836483-63836505 TTGGAGATGGGAAGAGTGGATGG + Intergenic
1128988293 15:72237145-72237167 GTGGAGAGTGGAAGTGTGTCAGG - Intergenic
1129178298 15:73855694-73855716 ATGGGGAAGGGAAGTGTTTTGGG + Intergenic
1130145010 15:81267314-81267336 CAGGAGATTGGCAGTGTTTTGGG + Intronic
1131175962 15:90210004-90210026 CTGGAGATGGGAGGCTGGTTGGG + Intronic
1134111122 16:11516112-11516134 CAGGAGATGGGAAGGGGGTAGGG - Intronic
1135955956 16:26956345-26956367 CTGCAGATGAAAAGTGTTTTAGG + Intergenic
1137584668 16:49657300-49657322 CTGGAGACAGGGAGTGTTTTTGG - Intronic
1137713970 16:50586403-50586425 CTGGAGATGGGAGGGGAGGTAGG - Intronic
1137722937 16:50638448-50638470 CTGGAGAAGGGGTGCGTGTTGGG - Exonic
1137993629 16:53185298-53185320 ATGGAGATGGGCAGATTGTTGGG + Intronic
1138187936 16:54990679-54990701 CTGGAGCTTGGAAGTCTCTTTGG + Intergenic
1138860057 16:60744912-60744934 ATGGAGATGGGGAATTTGTTGGG - Intergenic
1139344435 16:66293461-66293483 CTGGAGATGGGAGAGGTCTTAGG + Intergenic
1139982325 16:70869977-70869999 CTGGAGATGAGAAACTTGTTGGG + Intronic
1140012958 16:71154558-71154580 CTGGAGGTGGGAAGGGTAGTGGG - Intronic
1141072893 16:80974090-80974112 CTGGGGAGGTGAAGTGTGTGTGG - Exonic
1141110779 16:81269183-81269205 CAGGAGGGGGGAAGTGAGTTGGG - Intronic
1141532415 16:84655774-84655796 CTGAAGAGGGGAAATGTGGTTGG - Intronic
1142673636 17:1499734-1499756 CTGGAGGTGGGGTGTGTGTGTGG + Intronic
1143128843 17:4663384-4663406 CTGGACAAGGGTTGTGTGTTAGG - Intergenic
1143868357 17:9940217-9940239 CTGGAGAGCTGATGTGTGTTGGG - Intronic
1144574997 17:16423781-16423803 CTGGAGAGGGGAAGTGGGAAGGG - Intronic
1145357117 17:22169020-22169042 GTGGAGATGAGGAATGTGTTGGG - Intergenic
1146121725 17:30201527-30201549 TTGGAGGTGGGAACTGTGTTAGG - Intronic
1146722381 17:35132452-35132474 GTGGAGAAGGGAAGGGTGTCAGG + Intronic
1147877237 17:43630282-43630304 CTTGAGATGGGAAATGGATTAGG - Intergenic
1149334400 17:55620676-55620698 CTGGAGTAGGCAAGTCTGTTAGG + Intergenic
1149427467 17:56569151-56569173 TTGGAAATGGGCATTGTGTTGGG + Intergenic
1151316079 17:73323516-73323538 CTCTTGATGGGAAGTGTGTCTGG + Intergenic
1152183346 17:78839315-78839337 CTGGGGATGGGAAGTGACTCAGG - Intronic
1152433633 17:80262414-80262436 CTGGAGAGGGGAGGTGTGCAGGG + Intronic
1155157592 18:23170473-23170495 CTGGAGATGGCTAGGGTGTGTGG - Intronic
1155191738 18:23436816-23436838 CTGGAGAAGGAAAGGGGGTTGGG + Intronic
1155703750 18:28781861-28781883 TTGGGGATGGGAAGTGGGTTAGG + Intergenic
1156519290 18:37708077-37708099 CAGGAGATGGGAAGTATGACTGG - Intergenic
1159880876 18:73857440-73857462 GTGGAGGTGGTAAGTGTGTGAGG - Intergenic
1160811784 19:1016001-1016023 CTGGGGCTGGGGAGTGTGATGGG - Intronic
1161427328 19:4210703-4210725 GTGGGCATGGGAAGTGTCTTTGG - Intronic
1161548237 19:4895528-4895550 CTGGAGATGTGAAGTGACTTTGG + Intronic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1163041937 19:14609174-14609196 GTGGAGTTGGGTAGTGTCTTAGG - Intronic
1165944589 19:39434239-39434261 CTGGAGCTGGGAAGGGTCTAGGG - Intronic
1167696078 19:51016232-51016254 CTGGAGATAGGAAGAGTCTGAGG + Intronic
1167853312 19:52218172-52218194 CAAAAGATGGGAAGTGTGTGAGG + Intronic
1168125978 19:54283128-54283150 CTGGACTTGGGAATGGTGTTGGG + Intergenic
925287761 2:2727086-2727108 GTGGAGATGGGAAGCAGGTTGGG - Intergenic
925343610 2:3154022-3154044 CTGGAGGTGGGAGGGCTGTTTGG - Intergenic
925923633 2:8654888-8654910 TAGGAGATGGTAGGTGTGTTGGG - Intergenic
926075848 2:9942161-9942183 CGGGGGATGGGAAAAGTGTTGGG - Intergenic
926845486 2:17133110-17133132 CTTGAGATGGTTAGTGAGTTGGG - Intergenic
927415071 2:22870994-22871016 CTGGATATGGGTAGAGTTTTAGG + Intergenic
927966357 2:27272124-27272146 CTGAACACAGGAAGTGTGTTAGG + Intronic
928089005 2:28362905-28362927 CTGGAGATGGGGAGTGGGATGGG - Intergenic
928710498 2:33999965-33999987 ATGGAAATGGCAAATGTGTTTGG + Intergenic
929377185 2:41302118-41302140 CTGGACATGGGAAGGGGCTTGGG - Intergenic
929382620 2:41370016-41370038 CTGGAGATGAGAAACTTGTTGGG - Intergenic
930081365 2:47451631-47451653 CTGGAGATGGCACTTGTTTTGGG - Intronic
930651331 2:53967736-53967758 CTGGACATCAGAGGTGTGTTTGG - Intronic
930724746 2:54672091-54672113 GTGGAGGTGGGAAGTGGGTGTGG - Intergenic
931257591 2:60586726-60586748 CTGGAGATTGGAAGTCTCATTGG - Intergenic
931619476 2:64195311-64195333 CTGGAGATGGGATGTGGGAAGGG + Intergenic
931959446 2:67466002-67466024 CTGAACATGGGAAGTGCATTTGG + Intergenic
932262795 2:70341414-70341436 GGAGTGATGGGAAGTGTGTTGGG + Intergenic
932454157 2:71835578-71835600 ATGGGAATGGGAAGTGTGTTAGG - Intergenic
932692902 2:73928568-73928590 CCTGAGGTGGAAAGTGTGTTCGG + Intronic
933609844 2:84422420-84422442 CTGGGGAGGGGATGTGAGTTGGG - Intergenic
933703091 2:85269998-85270020 CGGGAGATGGGAAATGTCTGAGG - Intronic
934017051 2:87899156-87899178 ATGGAGATGGGAAACTTGTTGGG + Intergenic
935959011 2:108405406-108405428 ATGGAGATGGGAAGGGTTCTAGG + Intergenic
936932046 2:117799794-117799816 CTGGAGCTGGAAAGAGGGTTGGG - Intergenic
936992461 2:118380713-118380735 CTTGAGATGGGAAGAGCCTTAGG + Intergenic
937150516 2:119682844-119682866 GTGGAGGTGGGCAGTGGGTTAGG + Intronic
938564421 2:132505555-132505577 CAGGAGCTGGGAAGGGTGTGTGG - Intronic
939155967 2:138524738-138524760 ATGGAGATGAGGAATGTGTTAGG - Intronic
939955454 2:148524249-148524271 CTGTATATGGTAAGTGTGATAGG - Intergenic
943282443 2:185953831-185953853 TGGGAGATGGGGAGTGTATTTGG + Intergenic
943563931 2:189495570-189495592 ATGGAGATGGGAAACTTGTTGGG + Intergenic
943667831 2:190628655-190628677 CTGGGGATGGGCAGTGTTTGGGG + Intergenic
944047070 2:195424605-195424627 CTGGAAATTGAAAGGGTGTTAGG + Intergenic
944110249 2:196124230-196124252 CTGGAGAGGGGAATTGTGTGGGG + Intergenic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
947757022 2:232573918-232573940 CTGTAAATTGGAAGTGTTTTTGG + Intronic
947860006 2:233352189-233352211 CTGGAGCTGGCAAGGGGGTTTGG - Intergenic
948658444 2:239491590-239491612 CTGGTGATGGGCAGAGAGTTTGG + Intergenic
1170113769 20:12834677-12834699 CTGGAGATGGGAAATCTGTATGG + Intergenic
1170113812 20:12835567-12835589 CTGGAGATGGGAAGTCTGTATGG - Intergenic
1170148383 20:13202084-13202106 CTGGAGATGGGTAGTGCGTATGG - Intergenic
1170428531 20:16258237-16258259 TTGGGGATGGGGTGTGTGTTTGG - Intergenic
1172129394 20:32645650-32645672 TTGAAGATGGGCAGTGTGGTGGG - Intergenic
1172581083 20:36049317-36049339 ATGGAGATGGGAAGGGTTCTAGG - Intergenic
1172708584 20:36902113-36902135 CTGGAGGTGGGAAGCATGGTTGG + Intronic
1172881179 20:38200944-38200966 CTGGGGTTGGGAAGTCTGTGGGG - Intergenic
1174458739 20:50668028-50668050 CAGGGGGTGGGAAGGGTGTTTGG + Intronic
1175295170 20:57903324-57903346 CAGGAGATGGGGTGTGTGCTAGG + Intergenic
1175529241 20:59662774-59662796 CTGGAAATGGGGAGTGGGTGAGG + Intronic
1175625670 20:60486638-60486660 CTGGGGAAGGGAAGTGTTTAGGG + Intergenic
1177067862 21:16463459-16463481 ATGGAGATGAGGAATGTGTTGGG + Intergenic
1177504436 21:22001690-22001712 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1177728221 21:24995000-24995022 CTGGAGAGGGGTATTGTGTGGGG - Intergenic
1177763513 21:25430277-25430299 CTGGAGAAGGTAATTGTGGTGGG - Intergenic
1177865907 21:26513207-26513229 CAGAATATGGTAAGTGTGTTAGG - Intronic
1178469105 21:32875813-32875835 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1179030704 21:37717416-37717438 CTGGAGATGGGGTGGGTGTATGG + Intronic
1179333434 21:40427525-40427547 CTGCAGGTGGGCATTGTGTTTGG - Intronic
1179340678 21:40505811-40505833 CTGGATATGGGGAGTGTAGTGGG - Intronic
1180760267 22:18197003-18197025 CCTGAGATGGGAAATGTATTTGG + Intergenic
1180770579 22:18381301-18381323 CCTGAGATGGGAAATGTATTTGG + Intergenic
1180775402 22:18427693-18427715 CCTGAGATGGGAAATGTATTTGG - Intergenic
1180808471 22:18738748-18738770 CCTGAGATGGGAAATGTATTTGG - Intergenic
1180828522 22:18884259-18884281 CCTGAGATGGGAAATGTATTTGG + Intergenic
1181027369 22:20133804-20133826 CAGGAGATGGGGGGTGTGTGGGG - Intronic
1181071401 22:20343712-20343734 CCTGAGATGGGAAATGTATTTGG - Intergenic
1181194473 22:21172662-21172684 CCTGAGATGGGAAATGTATTTGG - Intergenic
1181214969 22:21320116-21320138 CCTGAGATGGGAAATGTATTTGG + Intergenic
1181919017 22:26305441-26305463 CTGGAGATGGTAAGGGTGATGGG - Intronic
1182471885 22:30553869-30553891 CTGGAGATGGGAAGGCTTTGGGG + Intergenic
1184103154 22:42352171-42352193 ATGGACATGGGAAGTGTCATGGG - Intergenic
1203232414 22_KI270731v1_random:122473-122495 CCTGAGATGGGAAATGTATTTGG + Intergenic
1203278616 22_KI270734v1_random:110248-110270 CCTGAGATGGGAAATGTATTTGG + Intergenic
949325663 3:2860850-2860872 CAGGAGAAGGCAAGAGTGTTTGG - Intronic
949355149 3:3172547-3172569 CTGGAGATGGGAGATGAGGTTGG + Intronic
950128016 3:10522538-10522560 CTGGAGAAAGGAGATGTGTTTGG + Intronic
950325872 3:12109613-12109635 TTGGAGGTGGAAGGTGTGTTGGG - Intronic
950578609 3:13847875-13847897 CTGGAGATGGAAAGTGGGGATGG + Intronic
952701430 3:36332320-36332342 CTGGAGATGGGATGTGGTTGAGG - Intergenic
953046868 3:39301344-39301366 CAGTGGGTGGGAAGTGTGTTGGG + Intergenic
953647634 3:44769699-44769721 CTGAAGTTGGGAATTGAGTTTGG + Intronic
953688688 3:45098643-45098665 ATGGGAATGGGAAGTGTGTGTGG - Intronic
955774648 3:62420456-62420478 CAGGAGCTGGGAGGGGTGTTGGG + Intronic
956772295 3:72536864-72536886 CTGGAGGTGGGAAGGCTGTATGG + Intergenic
956794960 3:72709471-72709493 CTGGAGGTGGGCACTGGGTTGGG + Intergenic
956824794 3:72987906-72987928 CAGGAGTGGGGAAGTGTGATGGG - Intronic
957309966 3:78507057-78507079 CAGGAGATGGGAAGTGAGGGAGG - Intergenic
957558331 3:81788668-81788690 TTGGAGAAGGGAAGTGGGTAGGG - Intergenic
958943012 3:100335201-100335223 CTGGAGCTGGAAAGTGAGTGGGG - Intronic
959355110 3:105317005-105317027 TTGGAGCTGGGAGCTGTGTTAGG + Intergenic
959473518 3:106782499-106782521 ATGGAGATGGGGAGGGTGTTGGG - Intergenic
960060081 3:113311846-113311868 ATGGAGATGAGAAGCTTGTTGGG + Intronic
960881794 3:122353004-122353026 CTGCTGATGGAAAGAGTGTTTGG + Intergenic
962143019 3:132810471-132810493 CTGGAGATGGGGTGTGGGTGAGG - Intergenic
962949798 3:140207127-140207149 CTGGAAATGGGACATGTGATAGG - Intronic
964693671 3:159482687-159482709 TAGGAGATGGGAGGGGTGTTTGG - Intronic
964784461 3:160379922-160379944 CTGAAGATGGAAAGGATGTTAGG - Intronic
965607990 3:170515605-170515627 CTGGGGTTAGGATGTGTGTTGGG + Intronic
966267998 3:178069954-178069976 CAGGGGCTGGGAAGGGTGTTGGG + Intergenic
966687979 3:182716488-182716510 CTGGAGAGGGGCATTGTGTGGGG + Intergenic
967248122 3:187509314-187509336 GTGGAGCTGGGAATTGTGTGGGG - Intergenic
968883445 4:3313806-3313828 CTAGAGATGGGGAGAGTGTGGGG - Intronic
969904463 4:10381446-10381468 GTGGAGATGGGCAGAGCGTTGGG + Intergenic
971823853 4:31595775-31595797 CTGGAGTTGGGAAATGTTTGTGG + Intergenic
973046755 4:45543012-45543034 CTGTAGTTTGGGAGTGTGTTTGG - Intergenic
975686998 4:76926723-76926745 TTGGAGCTGGGAAGTGCATTAGG - Intergenic
978281767 4:107025216-107025238 TTGGAGATCGGCAGTGTTTTAGG - Intronic
979683465 4:123485809-123485831 CTGAAGATGGGAAATCTGTTTGG + Intergenic
979717480 4:123858616-123858638 CTTGGGATAGGAAGTGTGGTGGG + Intergenic
979858577 4:125665005-125665027 CTGGTGATGGGGAGTGGGGTGGG + Intergenic
980013529 4:127623021-127623043 CCGGAGACGGGCTGTGTGTTGGG + Intergenic
980646035 4:135643533-135643555 ATGGAGATGGGAAATTTGTTGGG + Intergenic
982305367 4:153924820-153924842 CTGAAGCAGGGAAATGTGTTGGG - Intergenic
982868252 4:160544309-160544331 CTGGAGATGGGATTTGGGTGGGG + Intergenic
984026247 4:174547040-174547062 ATGGAGATGGGAAACTTGTTGGG + Intergenic
984131350 4:175879087-175879109 ATGGAGATGAGAAATTTGTTGGG - Intronic
984512348 4:180693965-180693987 ATGGAGATGGGGAATTTGTTGGG - Intergenic
984713642 4:182905994-182906016 CTGGAGATGGGGTGTATTTTAGG - Intronic
984900438 4:184581439-184581461 ATGGAGATGGGGAATTTGTTGGG - Intergenic
985972855 5:3392061-3392083 CTGGAGCTGAGCAGTATGTTGGG + Intergenic
986038102 5:3960174-3960196 CAGGTGCTGGGAAATGTGTTTGG + Intergenic
987216651 5:15744397-15744419 ATGGAGATGGGAAACTTGTTGGG - Intronic
987427937 5:17794982-17795004 CTGGAGATGGCAAGGGTTTTAGG - Intergenic
988497603 5:31758333-31758355 CTGGAGATGGAATGAGGGTTGGG + Intronic
988724068 5:33908286-33908308 ATGGAGGTGGGAAGAGTGTAGGG + Intergenic
988730101 5:33963944-33963966 CTGGAGCTGGGAAGACTGTTGGG - Exonic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
991158531 5:63467323-63467345 CTGGGGAATGGAAGTGGGTTTGG - Intergenic
991946854 5:71906478-71906500 CTGGAGATGGGCAGTGAGGCTGG + Intergenic
993413279 5:87597233-87597255 ATGGAGATGAGAAGCTTGTTGGG - Intergenic
994707538 5:103224107-103224129 CCGGAAATGGGCAGTGAGTTTGG + Intergenic
994749698 5:103722328-103722350 ATGGAGATGAGAAATGTGTTGGG - Intergenic
994808168 5:104478800-104478822 ATGGAGATGGGAAACTTGTTGGG + Intergenic
995305010 5:110635321-110635343 CTGGCCTTGGGAAATGTGTTAGG - Intronic
995353546 5:111210745-111210767 CTGGAGATGGGAAGGACCTTAGG + Intergenic
996122983 5:119692039-119692061 ATGGAGGTGGGAAATGTGTTGGG - Intergenic
996980189 5:129482298-129482320 TTTGAGATGGAAAGTTTGTTGGG - Intronic
997618072 5:135266293-135266315 CTGGAGATGGGGAGGGAGCTGGG + Intronic
998393218 5:141801169-141801191 TTGGAGATGGAGATTGTGTTGGG + Intergenic
998800502 5:145864272-145864294 GGGGAGATGGGCAGTGTGTCTGG + Intronic
999009095 5:148015410-148015432 CTTGGGACGGGAAGTGTTTTGGG - Intergenic
999435602 5:151561101-151561123 GTGGTGCTGGAAAGTGTGTTAGG + Intronic
1000209698 5:159098043-159098065 GTGGGGATGGGAACAGTGTTGGG + Intronic
1000648524 5:163786390-163786412 ATGGAGATGAGGAGTTTGTTGGG - Intergenic
1001233899 5:170013406-170013428 TTGAAGATGGGGAGTGTCTTGGG + Intronic
1001415385 5:171541800-171541822 CTGGAGCTGGGAAGAGAGATAGG + Intergenic
1001473470 5:172032457-172032479 ATGAAGATGAGAAATGTGTTGGG - Intergenic
1003044874 6:2724482-2724504 CTGGAGAAAGGAAGTGTGAAGGG + Intronic
1003354385 6:5353056-5353078 CTGTAGAAGGGAAGTGTGATTGG - Intronic
1005512527 6:26523330-26523352 ATGGAGATGGGAAGGGTTCTAGG + Intergenic
1005986877 6:30881220-30881242 CTGGAGGCTGGAGGTGTGTTGGG + Intronic
1005990744 6:30900222-30900244 AGGAAGATGGGAAGTGGGTTGGG - Intergenic
1006284397 6:33081613-33081635 CAGAAGATGGAAAGTGGGTTTGG + Intronic
1006360438 6:33584307-33584329 CTGGAGATGGGGATTTGGTTTGG + Intergenic
1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG + Intergenic
1007161166 6:39792729-39792751 CTGGACATAGGAAATGTCTTTGG + Intronic
1007737737 6:43992241-43992263 GTGGAGATGGGATGTGTGGCAGG + Intergenic
1008541008 6:52546435-52546457 CTGGAGACGGGAGGTGAGCTAGG + Intronic
1009825331 6:68859203-68859225 ATGGAGATGGGGAATTTGTTGGG - Intronic
1010530887 6:76966178-76966200 CTGGAGATGAGAAACTTGTTGGG + Intergenic
1010929859 6:81788728-81788750 TTGGAGATGGCAATTGGGTTAGG - Intergenic
1011656363 6:89555538-89555560 CTGGAGGTTGGAAGAGTATTAGG + Intronic
1012788253 6:103658985-103659007 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1013366702 6:109442641-109442663 CTTGAAATGGGAAGTGGGATGGG + Intronic
1014115967 6:117669431-117669453 ATGGAGATGAGGAGTTTGTTGGG + Intergenic
1015239518 6:131007674-131007696 ATGGAGATGAGGAATGTGTTGGG + Intronic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1017123835 6:151048383-151048405 CTGGAGGTGGGAAGTGGGGGAGG - Intronic
1017250147 6:152271569-152271591 CTAGAGATGGGAAGTTTGGGTGG + Intronic
1017664792 6:156709198-156709220 GTGGAGATGGGAAGTGTATTAGG + Intergenic
1017903014 6:158734525-158734547 CTGGAGGTGGGATGTGTCTGGGG - Intronic
1018442476 6:163825720-163825742 TTGGAGGTAGGAATTGTGTTTGG + Intergenic
1021688183 7:23207512-23207534 ATGGAGATGGGAAGGGTTCTAGG + Intergenic
1021885428 7:25132876-25132898 ATGGAGATGGGAAGGGTTTTAGG + Intergenic
1021942878 7:25696635-25696657 CTAGAGATGGGCAGTGTGGCGGG - Intergenic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1022610644 7:31867844-31867866 CTGGAGATGGGATGCCAGTTGGG - Intronic
1023852887 7:44159940-44159962 CTGGAGCTGGCAAGTGGGTCAGG + Intronic
1024995475 7:55270698-55270720 ATGGAGGTGTGGAGTGTGTTGGG - Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026605271 7:71810530-71810552 GTGGAGATGGGAAGTTGGCTCGG + Intronic
1027977516 7:85178445-85178467 ATGGAGATGAGAAATGTGTTGGG + Intronic
1028318862 7:89436378-89436400 TTGGAGATGGAAAGTGTTATGGG - Intergenic
1028721072 7:94032266-94032288 CAGGATATGGGAAATGTGTGTGG + Intergenic
1031659489 7:124403330-124403352 CTGGAGTTTGGCAGTGTTTTGGG + Intergenic
1033429080 7:141272190-141272212 CAGGAGATGGGAAATGCATTAGG - Intronic
1034974365 7:155439360-155439382 CTGGGCATGGGTAGTGTTTTGGG - Intergenic
1035011446 7:155720145-155720167 TTTGAGATGGGAAGTATGTGTGG + Intronic
1037237873 8:16741889-16741911 CTGGAGATATGAAGCATGTTTGG - Intergenic
1038054168 8:23842668-23842690 CTGGGGGTGGGAAGTGTGGGAGG + Exonic
1038127810 8:24693753-24693775 CAGGTGAGGGGAAGTGTGATCGG + Intergenic
1039050106 8:33484952-33484974 CTGGAGCTGGGAACCCTGTTGGG - Exonic
1039502006 8:38025366-38025388 CTGGAGATTCTAAGTGTTTTAGG - Intergenic
1039657355 8:39424079-39424101 ATGGAGATGAGAAATGTGTTGGG - Intergenic
1041726066 8:61018457-61018479 GTGGAGATGGGAGATGGGTTGGG + Intergenic
1042515403 8:69653813-69653835 CTGGAGATTGCAAGGGCGTTAGG + Intronic
1042667776 8:71225306-71225328 CTGGAGATGGGGAGGGTATGTGG + Intronic
1044985564 8:97753646-97753668 CTGGGGATGGAAAGTGTGCAAGG + Intergenic
1045406454 8:101871468-101871490 CTGTTGAGGGGAACTGTGTTGGG - Intronic
1046607514 8:116388215-116388237 ATGGAGATGGGAAACTTGTTGGG + Intergenic
1047042124 8:121007716-121007738 GTGGGCATGGGAAGTGGGTTGGG + Intergenic
1047349095 8:124056214-124056236 TAGGAATTGGGAAGTGTGTTGGG - Intronic
1047577738 8:126176436-126176458 CTTGAGATGGGAAGTGAGGCAGG + Intergenic
1047750449 8:127876602-127876624 CAGGAGATGGGAAGAGTGTACGG - Intergenic
1048535906 8:135294302-135294324 TAGGAGAAGGAAAGTGTGTTGGG - Intergenic
1048635252 8:136288371-136288393 CTAGAGATGGGAATTGAGCTTGG - Intergenic
1048658500 8:136570832-136570854 ATGGAGATGGGAAATCTGTTGGG + Intergenic
1049200222 8:141336456-141336478 CTGGTGCTGGGAAGTGGGGTTGG + Intergenic
1049291494 8:141805298-141805320 GTGCAGAAGGGAAGTGTGGTTGG + Intergenic
1049308242 8:141919518-141919540 CTGGAGATGGTCAGTGTGGGGGG + Intergenic
1049526458 8:143129124-143129146 TTGGAGATGGGAAGTTCCTTGGG + Intergenic
1049608969 8:143543849-143543871 TAGGAAATGAGAAGTGTGTTAGG + Intergenic
1050537871 9:6645740-6645762 CTGGAGGCGGGAGGTGGGTTGGG + Intergenic
1051009618 9:12395571-12395593 CTAGAGATGGGGAATGTGCTGGG + Intergenic
1051250017 9:15150149-15150171 CTGGAGATGGGAAATTGATTTGG + Intergenic
1051285674 9:15493305-15493327 ATGGAGATGAGGAGCGTGTTGGG - Intronic
1051524044 9:18022444-18022466 CTGGCTATGGGAAGTGGGTGAGG + Intergenic
1052194045 9:25690598-25690620 CTTGAGATGGGTTGAGTGTTAGG - Intergenic
1054152819 9:61619029-61619051 CTGGAGAGGTCAAGTGTGTGTGG - Intergenic
1054859388 9:69933319-69933341 CTGGAGGTTGAAAGTGTGTGTGG - Intergenic
1055889526 9:81108064-81108086 CTGGAGAAGGGATTTGTGGTAGG + Intergenic
1056424973 9:86466816-86466838 TGGAAGATGGGAAGTGGGTTGGG + Intergenic
1057017260 9:91663508-91663530 CTGGAGATGGGAAACGTCTGTGG - Intronic
1057371611 9:94479503-94479525 CTGGCGATGGGGAGCGGGTTGGG + Intergenic
1057822634 9:98344215-98344237 CTGGAGATGGGAACTCAGATGGG - Intronic
1059505881 9:114799595-114799617 CTGGGGATGTGAAGTGGGTGGGG - Intronic
1059628234 9:116091092-116091114 ATGGAGATGGGGAATGTTTTGGG + Intergenic
1059805811 9:117799056-117799078 CTGGGCAAGGGAAGTATGTTGGG + Intergenic
1060179179 9:121520662-121520684 CTGGAGAGGGGGATTGTGTGGGG + Intergenic
1060877259 9:127092324-127092346 CTGGAGATGAGCTGTGTGTGAGG + Intronic
1061527479 9:131178803-131178825 CTGGAGAAGGGAAGTGAGGGAGG - Intronic
1062201190 9:135303657-135303679 TGGGAGGTGGGAGGTGTGTTAGG + Intergenic
1062221804 9:135420193-135420215 TTGAAGCTGGGAAGTGTCTTGGG + Intergenic
1062289270 9:135787250-135787272 CTTGTGGTGGGAAGTGTGCTTGG + Intronic
1186168177 X:6849090-6849112 CTGGAGCTGGGAAGTATGTGGGG + Intergenic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1187293387 X:17976505-17976527 CTGGAGATGGGAGGGGTGCCAGG - Intergenic
1189862777 X:45290604-45290626 CTTGAGATGGAAAGTGCCTTGGG + Intergenic
1190641953 X:52488444-52488466 CTGGCCATGGGAAGTGAGTCTGG - Intergenic
1190645719 X:52524422-52524444 CTGGCCATGGGAAGTGAGTCTGG + Intergenic
1191682905 X:63859446-63859468 CTGGAGATGGGAAGAAAGTGGGG - Intergenic
1191879057 X:65826403-65826425 CTGGAGATGGGAGGTTGGGTAGG + Intergenic
1193347794 X:80424108-80424130 CTGGAGATGGGTGTTGTGTGGGG + Intronic
1193397436 X:81002562-81002584 ATGGAGATGGGAAGGGTTCTAGG - Intergenic
1193848287 X:86502305-86502327 CTGGAGCTGGAAAGGGTGTTAGG + Intronic
1194841619 X:98751432-98751454 CTGGAGATGAGATTTGTGTGGGG + Intergenic
1195525997 X:105890220-105890242 ATGGAGATGAGAAATTTGTTGGG - Intronic
1195834416 X:109096684-109096706 CAGAAGATGGGAAGTGTAATGGG - Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196439045 X:115701944-115701966 CTGGAGATTTGAAGGGTTTTAGG - Intergenic
1196816155 X:119666947-119666969 CTCGAGAGGGGAGGTGAGTTAGG - Intronic
1196871414 X:120116238-120116260 GTGGAGATGGGAGGTGTGGGTGG + Intergenic
1197384101 X:125782363-125782385 CTGGAGAGGGGCATTGTGTGGGG + Intergenic
1197869602 X:131052440-131052462 CTGGATATGGGTAGTGTGAGAGG + Intergenic
1199127432 X:144139389-144139411 ATGGAGATGGGAAACTTGTTGGG - Intergenic
1199141097 X:144313407-144313429 CTGGAGCTGGGAAGAGTGGTAGG + Intergenic
1201337735 Y:12898345-12898367 CTGGAGAGGGGCATTGTGTGGGG - Intergenic