ID: 1162065632

View in Genome Browser
Species Human (GRCh38)
Location 19:8123740-8123762
Sequence GGCCCCTGGAAGGATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 565}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162065632_1162065650 24 Left 1162065632 19:8123740-8123762 CCCTCCCCATCCTTCCAGGGGCC 0: 1
1: 0
2: 3
3: 54
4: 565
Right 1162065650 19:8123787-8123809 TATAGAATGGTCGGCCAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1162065632_1162065646 11 Left 1162065632 19:8123740-8123762 CCCTCCCCATCCTTCCAGGGGCC 0: 1
1: 0
2: 3
3: 54
4: 565
Right 1162065646 19:8123774-8123796 CCAACCGCACCTTTATAGAATGG 0: 1
1: 0
2: 0
3: 4
4: 53
1162065632_1162065648 15 Left 1162065632 19:8123740-8123762 CCCTCCCCATCCTTCCAGGGGCC 0: 1
1: 0
2: 3
3: 54
4: 565
Right 1162065648 19:8123778-8123800 CCGCACCTTTATAGAATGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162065632 Original CRISPR GGCCCCTGGAAGGATGGGGA GGG (reversed) Intronic
900044052 1:492633-492655 GGCCCCTGGGAGGCAAGGGAGGG + Intergenic
900065462 1:727539-727561 GGCCCCTGGGAGGCAAGGGAGGG + Intergenic
900397277 1:2458243-2458265 GGCCCCTGTGAGGCTGAGGATGG + Intronic
901018221 1:6243504-6243526 GGCCCCAGCAAGGATGAGGCTGG + Intergenic
901126695 1:6934445-6934467 GTGCCCTGGGAGGATGGGTAAGG + Intronic
901430538 1:9211390-9211412 GGTCCCTGGGAGGAAGGGGTGGG - Intergenic
901627058 1:10630429-10630451 GGCCCAGGGAGGGAGGGGGATGG - Exonic
901627759 1:10633369-10633391 GACCCCAGGAGGGAAGGGGAGGG + Intergenic
902108130 1:14055078-14055100 TGCCCATGGAAGGGTGAGGAAGG + Intergenic
902694823 1:18133224-18133246 GGCCTCAGGAAGGTTGGGGCTGG - Intronic
902706382 1:18208159-18208181 GGCCCCTGGGAGGAAGGGAAGGG + Intronic
902782928 1:18716238-18716260 GGCCTTTGGAAGGATGGGCCTGG + Intronic
903337538 1:22635124-22635146 GGCTCCTGGGTGGAAGGGGATGG - Intergenic
903387109 1:22934426-22934448 TGCTCTTGGAAGGATGGGGCAGG + Intergenic
903407934 1:23114401-23114423 GGCCGATGGCAGGATGGGGTGGG + Intronic
904356928 1:29946351-29946373 GGCAGCTGGGAGGATGGGCAGGG + Intergenic
905028236 1:34865624-34865646 AGCCCCTGGGAGGGTGGGGCGGG + Exonic
905179442 1:36156966-36156988 GGCAGCTGGACGGATGGGGTGGG - Intronic
905253308 1:36664170-36664192 GGGCCCTGGGACCATGGGGAGGG + Intergenic
905316561 1:37085280-37085302 GGCAACTCGAAGAATGGGGAAGG - Intergenic
905371509 1:37484921-37484943 GGGCCCTGCAGGGATGGGGGAGG + Intergenic
906107040 1:43300850-43300872 GGCCCCCACAAGGCTGGGGATGG - Intergenic
906157268 1:43621002-43621024 GCCCCCTGGAGGGCTGGGGTGGG + Intronic
906633112 1:47389077-47389099 GGATCCTGGAAGGTTGGGGCTGG - Intergenic
907073580 1:51559116-51559138 GGACCAAGGAGGGATGGGGAGGG + Intergenic
907291209 1:53414075-53414097 TGGATCTGGAAGGATGGGGAGGG - Intergenic
907885852 1:58591793-58591815 GGGCCCAGAAAGGTTGGGGAGGG + Intergenic
907915977 1:58870470-58870492 GGCCCCCGGGAGGAAGGGGGTGG + Intergenic
908019630 1:59886595-59886617 GGGCCCTGGTAGGATGGGGTGGG + Intergenic
908523324 1:64965863-64965885 GGCCCCAGGAAGGAGGCTGAGGG - Intronic
909388689 1:75092071-75092093 GACACGTGGAAGGATGAGGAGGG + Intergenic
909607585 1:77522424-77522446 GGACCAAGGAAGGATGGGAAGGG + Intronic
910205893 1:84748299-84748321 GGCACCTGGACCTATGGGGAAGG + Intergenic
910438311 1:87227778-87227800 TGGCCCTGGAAGGATATGGAGGG + Intergenic
911561027 1:99405533-99405555 GGCGGCAGGAAGGCTGGGGAGGG - Intergenic
912793270 1:112674398-112674420 CGTCCCTGGAAGGCTGGGGGAGG + Intronic
914918858 1:151834242-151834264 GGGCCCTCCAAGGATGGGGCTGG - Intergenic
915073735 1:153292806-153292828 GAGCCCAGGAAGCATGGGGAAGG + Intergenic
915131549 1:153698516-153698538 CGCCCCTGGAAGAGTGGGGCGGG + Intergenic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916240154 1:162631619-162631641 GGAGCCTGGATGGATGGAGAGGG + Intronic
916433384 1:164754023-164754045 GGCCACTGGAAGGGTGGGCTTGG + Intronic
916696494 1:167242930-167242952 GGCAGGTGGAAGGAGGGGGAGGG - Intronic
917472365 1:175336735-175336757 GACCCCAGGAAGAATGGGGAAGG + Intronic
918067265 1:181109799-181109821 GGACCAGGGAATGATGGGGATGG + Intergenic
918243529 1:182640398-182640420 GCCCCCTGGAAGGACGGGCAGGG + Intergenic
919818284 1:201455858-201455880 GGTGCCTGGAAGGATGTGGGAGG - Intergenic
919913906 1:202128557-202128579 GGCCCCAGTAGGGGTGGGGAGGG + Exonic
919980784 1:202642040-202642062 GCCCACTGAAAGGATGGGGGTGG - Intronic
920099104 1:203505790-203505812 GCCCCAGGGAAGGACGGGGAAGG + Intronic
920313997 1:205065048-205065070 GGCCCTTGGGTGGATGGGGGAGG - Intronic
920402025 1:205681899-205681921 GGCCCCTGGAAAGAAGTGGTGGG - Intergenic
920854298 1:209650886-209650908 AGGGCCTGGAAGGATGGGAAGGG + Intronic
922759743 1:228120219-228120241 TACCCATGGCAGGATGGGGAAGG + Intergenic
922783219 1:228269672-228269694 GGCCCTGGGAAGCGTGGGGAAGG + Intronic
923145225 1:231193009-231193031 GGCTCCTGGAAGGCTGGCGCTGG + Intronic
923251172 1:232180674-232180696 GGCCCGTGGGAGGGTGGGGGAGG + Intergenic
923547315 1:234932215-234932237 GAGCCCTGGAGGGAGGGGGATGG - Intergenic
923645350 1:235814987-235815009 GGCAGATGGGAGGATGGGGATGG - Intronic
1062902065 10:1154001-1154023 GGCACCTGGAGACATGGGGAGGG - Intergenic
1063112492 10:3048806-3048828 GGCCCCAGGCAGGAGAGGGAGGG + Intergenic
1063383028 10:5597945-5597967 AGCCCCTGGGAGAAAGGGGAAGG + Intergenic
1063771369 10:9205930-9205952 GGAACCAGGAAGGCTGGGGAAGG + Intergenic
1064261130 10:13787407-13787429 GCCTCCTGGGAAGATGGGGAGGG + Intronic
1064285808 10:13990396-13990418 GGACCCTGGAAAGAAGAGGAAGG - Intronic
1065458673 10:25934056-25934078 GGGCCCTGCGAGGATGTGGATGG + Intergenic
1065655283 10:27941987-27942009 GGCCCCAGGAAAGACGGGGATGG + Intronic
1065875644 10:29995207-29995229 GTCACATGGAAGGCTGGGGAGGG + Intergenic
1067029333 10:42869907-42869929 GAGCCCTTGAAGGATGGGCAAGG - Intergenic
1067173242 10:43924480-43924502 GGGGCCTGGAAGCCTGGGGATGG + Intergenic
1068492018 10:57736584-57736606 GGCTCCTGGAAGGAGGGAGAAGG - Intergenic
1069595319 10:69666410-69666432 GACCCCGAGAAGGGTGGGGAAGG - Intergenic
1069713540 10:70506402-70506424 GACCCCTGGAAGGAAGGCGCTGG + Intronic
1069825464 10:71252752-71252774 GGCACCTGCAAGGAGAGGGAAGG + Intronic
1069882641 10:71603287-71603309 GTCCCAGGGAAGGAGGGGGAGGG - Intronic
1069959308 10:72070277-72070299 GGCCCCAGGTAGGGTGGGGGTGG - Intronic
1069960137 10:72074702-72074724 GGAGTCGGGAAGGATGGGGAGGG + Intronic
1070758091 10:79005901-79005923 GGCCCCTGAAGGGATGGACAGGG - Intergenic
1070846186 10:79524141-79524163 GGCCCCAGGAAGGCCGGGGCAGG - Intergenic
1070927612 10:80236169-80236191 GGCCCCAGGAAGGCCGGGGCAGG + Intergenic
1072010391 10:91298352-91298374 AGCCCCTGGAAAGTGGGGGAGGG + Intergenic
1072100724 10:92226854-92226876 GGGGCCTGGAAGGAGGGGAAGGG + Intronic
1072283838 10:93894315-93894337 AGCCCCGGGCAGGGTGGGGACGG - Intronic
1073453947 10:103625461-103625483 CACAGCTGGAAGGATGGGGATGG + Intronic
1074960176 10:118437499-118437521 GGAGGCTGGAAGGATGGGAAGGG - Intergenic
1075007776 10:118842793-118842815 GGTTCCTGGGTGGATGGGGATGG + Intergenic
1075388510 10:122075326-122075348 GGTGCCATGAAGGATGGGGAAGG + Intronic
1075617245 10:123899639-123899661 AGACCCTGGGAGGAAGGGGAAGG + Intronic
1075961544 10:126571505-126571527 GCACCCTGGAAGGATGCAGAGGG + Intronic
1076095933 10:127735493-127735515 CGCCCCTGCAACGACGGGGATGG + Intergenic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1076556142 10:131322688-131322710 GGCACCTGCACGGATGGGGTGGG - Intergenic
1076556170 10:131322788-131322810 GGCACCTGCACGGATGGGGTGGG - Intergenic
1076556196 10:131322888-131322910 GGCACCTGCACGGATGGGGTGGG - Intergenic
1076734144 10:132451231-132451253 GGCCCCTGGCTGAATGGGGGAGG + Intergenic
1076760956 10:132605464-132605486 ATCCCTTGGAGGGATGGGGAAGG + Intronic
1076803627 10:132844342-132844364 GGCCCCAGGATGGACGGTGAGGG + Intronic
1076999198 11:314214-314236 GGACCTTGGAAGGATGGTGCTGG - Exonic
1077217358 11:1400526-1400548 GTGCCCAGGAAGGATGTGGACGG - Intronic
1077492593 11:2868978-2869000 GGGCCCTGGAGGGAGGCGGAGGG + Intergenic
1078250011 11:9609153-9609175 TGGCCCTGGGAGGATGGGGCAGG + Intergenic
1078394977 11:10973033-10973055 GGCACCAGGAAGGAGGGTGAGGG + Intergenic
1078545926 11:12246968-12246990 GGGACCTGGAATGCTGGGGAGGG + Intronic
1079281895 11:19095157-19095179 GGCCCATGGAAGGCTCTGGAGGG - Intergenic
1081398350 11:42613808-42613830 AGCCACTGGAAGGATAGGGTTGG - Intergenic
1081685757 11:45041944-45041966 GGCCCTGGGCAGGCTGGGGAAGG + Intergenic
1081795131 11:45813485-45813507 GGCCCCAGGAAGGAAGAGGCAGG + Intergenic
1081808980 11:45904850-45904872 GGGCCATGGAAGGAAGGGGCTGG - Intronic
1082779077 11:57272079-57272101 GTCCACTGAAATGATGGGGATGG + Intergenic
1082819980 11:57538196-57538218 GGCCCCTGGCTGAGTGGGGAAGG + Intergenic
1082828466 11:57598113-57598135 GGCCCCAGGAGGGAGGAGGAGGG + Intronic
1083095680 11:60248604-60248626 GGCCTTTGGATGGATGGGGCTGG - Intergenic
1083220565 11:61249562-61249584 GGCCAATGGATGGGTGGGGAAGG + Intronic
1083259728 11:61516464-61516486 GGCGCCTGGAAGGTGGGGGCTGG + Intronic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1083630952 11:64095123-64095145 GGCGTCTGCAAAGATGGGGAAGG + Intronic
1083702152 11:64486636-64486658 GGGCCAGGGCAGGATGGGGAGGG + Intergenic
1083959179 11:66004515-66004537 GGCCTCTGTAAGGGTGGGCAGGG + Intergenic
1084008408 11:66334980-66335002 TGCCCCTGGCAGCACGGGGACGG + Exonic
1084203420 11:67577133-67577155 GGCCCCTGGTAGGTGTGGGAAGG + Intergenic
1084544717 11:69809186-69809208 GGCACTTGGCAGGATGGGCAGGG - Intergenic
1084672652 11:70616358-70616380 GGCCCCTCCCAGGCTGGGGAGGG - Intronic
1084704294 11:70806868-70806890 GGCCCCTGGAAGGGCAGGAATGG - Intronic
1084741932 11:71145771-71145793 GGCCCCAGCCACGATGGGGAAGG - Intronic
1084783934 11:71430658-71430680 GGACACTTGAAGGATGGTGAAGG + Intronic
1084963863 11:72733260-72733282 AGCCCCAGGAAGGGTGAGGAAGG + Intronic
1085010970 11:73141759-73141781 GGCCCCTTGCGGGAGGGGGAAGG + Intronic
1085273579 11:75284198-75284220 GGCCCTTGACAGGCTGGGGATGG + Intronic
1085805215 11:79629691-79629713 GGCCCCTGAAAGCATAGGGGAGG + Intergenic
1087609934 11:100422317-100422339 GGCCCTTTGAAGGAGGTGGATGG + Intergenic
1088753208 11:112863476-112863498 AGCCACTGGAGGGATGGGGATGG - Intergenic
1088913804 11:114211873-114211895 GGCCCCTGGAATGCTGAGGGGGG + Intronic
1089315809 11:117590549-117590571 GACCCCTGGAAGGACGGTGTGGG - Intronic
1089617944 11:119705792-119705814 GGCCCCTGCAGAGCTGGGGAGGG + Intronic
1089650575 11:119910244-119910266 GGCACCTGGATAGATGGAGAAGG + Intergenic
1089849775 11:121486231-121486253 TGCTCCTGGAAGAATGAGGAAGG - Intronic
1090332571 11:125943212-125943234 GGGCCCAGGCAGGCTGGGGATGG + Intergenic
1090416353 11:126543267-126543289 GCCCCTTGAAAGGATGGAGAGGG + Intronic
1090733483 11:129591486-129591508 GGCTAATGGAAGGAAGGGGATGG - Intergenic
1090919820 11:131197866-131197888 TGTCCCTGGAAGGATGGGCTGGG + Intergenic
1090941581 11:131392442-131392464 AGCCCCTGAAGGGATGGGGTTGG + Intronic
1091270908 11:134311202-134311224 GGCCATTGGAGGGATGGGGGAGG + Intronic
1091399969 12:175641-175663 AGGCCCTGGGAGGAGGGGGAAGG - Exonic
1092007214 12:5079699-5079721 GATATCTGGAAGGATGGGGAGGG + Intergenic
1092284516 12:7121128-7121150 AGCCGCTGGAGGGGTGGGGAGGG + Intergenic
1092294860 12:7189794-7189816 GGCCACCGCAAGGGTGGGGAGGG - Intronic
1094018067 12:25884940-25884962 GGCTCCTGGATGGAAGGGCATGG + Intergenic
1094594137 12:31848500-31848522 TGCCTGTGGCAGGATGGGGAAGG - Intergenic
1094715355 12:33008714-33008736 GGCACTTGCAGGGATGGGGAAGG - Intergenic
1095777406 12:46024892-46024914 GAACCCTGGAGGGGTGGGGACGG - Intergenic
1095949491 12:47773952-47773974 GCCCTCTGGAAGGAGGGAGATGG - Intronic
1097114648 12:56688410-56688432 GGCGCCAGGAAGGATCGCGAAGG - Intergenic
1098826764 12:75306403-75306425 GGCCTGTGGAAGGGTGGGGGTGG + Intronic
1101832481 12:108270071-108270093 CACCTGTGGAAGGATGGGGAAGG - Intergenic
1102079910 12:110089602-110089624 GGCCCCAGGAAGAAGGGGTAGGG + Intergenic
1102543442 12:113638332-113638354 GGGCACTGGAGGGATGGAGAGGG + Intergenic
1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG + Intronic
1103244622 12:119445913-119445935 GGGACTTGGAGGGATGGGGACGG + Intronic
1103292263 12:119856189-119856211 GGCCTCTGGAAGGAGGAGGTTGG - Intronic
1103956875 12:124582295-124582317 GGGCCCTGGCAGGGTGAGGAAGG - Intergenic
1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG + Intronic
1104527625 12:129539142-129539164 TGTCCCAGGAAGGATGGGGCTGG + Intronic
1105458972 13:20566742-20566764 GGCCTCTGTGAGGAAGGGGAAGG - Intergenic
1113417408 13:110138849-110138871 GGCCTCTGGAGGGATGGAGAGGG - Intergenic
1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG + Intergenic
1113713614 13:112488430-112488452 AGACCCCGGAAGGCTGGGGACGG - Intronic
1113887165 13:113667055-113667077 GGCCCCTTGGAGGAAGGGGCCGG + Intergenic
1113896935 13:113770500-113770522 GGTCCCTGGAGGGTTGGGGGTGG + Intronic
1116941742 14:50797852-50797874 GGCCTATGGAGGGGTGGGGAAGG + Intronic
1118467149 14:66041333-66041355 GGGCCTTGGAAGGAAGGGGGTGG + Intergenic
1118607369 14:67514265-67514287 GTCCCCGGGAAGGAAGGGAAAGG + Intronic
1119060325 14:71467767-71467789 GCCCTCTGGAAGGATGAGGTGGG + Intronic
1119183068 14:72617423-72617445 GGCCCAGGGAGGGATAGGGAGGG - Intergenic
1119189379 14:72670008-72670030 GGCCCCTGGGGCGATGGAGAAGG - Exonic
1119456983 14:74764075-74764097 GGCGCCAGGTAGGATTGGGAAGG - Exonic
1120823064 14:88930796-88930818 GGCCACAGTAAGGATGGAGAGGG + Intergenic
1120892066 14:89500240-89500262 GGCTCATGGAAGGAGTGGGAAGG - Intronic
1121439851 14:93941712-93941734 GGCCGCTGGACAGATGGGGCTGG + Intronic
1121951529 14:98175123-98175145 GGCCCCTGGGAGCTTGGGGCTGG + Intergenic
1122298315 14:100717839-100717861 TGACACTGGCAGGATGGGGAAGG - Intergenic
1122302315 14:100738290-100738312 GGCCCCGGGCAGGGTGGGCAGGG + Intergenic
1122599039 14:102912265-102912287 AGTGCCTTGAAGGATGGGGAGGG - Intergenic
1122647573 14:103205680-103205702 GGCCCATGGGAGGAAGGGGGTGG + Intergenic
1123573610 15:21642581-21642603 TGTCCCTGGAAGGATGGAGAAGG + Intergenic
1123610231 15:22085170-22085192 TGTCCCTGGAAGGATGGAGAAGG + Intergenic
1123935275 15:25191057-25191079 GAACCCTGGAAGGACGGGGCAGG - Intergenic
1124496479 15:30190784-30190806 GCCCACTGAAAGGTTGGGGATGG - Intergenic
1124747096 15:32347864-32347886 GCCCACTGAAAGGTTGGGGATGG + Intergenic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1126156899 15:45574249-45574271 GGCTCCTGGGAGGAAGGGGGTGG - Intergenic
1126215321 15:46147065-46147087 GGCCCCTGGGAGGCTGCAGATGG - Intergenic
1126418410 15:48443784-48443806 GGCCCTTGGGAGGCTGAGGAAGG + Intronic
1126778260 15:52118002-52118024 GACGCCTGGAAGCCTGGGGAAGG - Exonic
1127966061 15:63923728-63923750 AGCTCATTGAAGGATGGGGAAGG - Intronic
1128251549 15:66167349-66167371 GGCCCATGGATGGCTGGGCACGG + Intronic
1129450891 15:75650623-75650645 GGGCCCTGGGGAGATGGGGATGG + Intronic
1129455152 15:75672866-75672888 GGCTCCTTAAAGGAGGGGGATGG + Intergenic
1129662007 15:77558147-77558169 GGGTCCTTGAAGGATGGAGATGG + Intergenic
1129748086 15:78038885-78038907 GGCCCCTGGGAGCATGTGAATGG + Intronic
1130316353 15:82800179-82800201 GTCCCCAGGAAGGAAGGGGGAGG - Intronic
1131132284 15:89908070-89908092 GGCCCCTGGAATGGAGGGGAGGG + Intronic
1131682397 15:94737615-94737637 GGGCCTTGGAAGGATTGTGAAGG - Intergenic
1202982476 15_KI270727v1_random:376935-376957 TGTCCCTGGAAGGATGGAGAAGG + Intergenic
1132698706 16:1213169-1213191 GGCCCCTTGGAGGATGGGGAGGG + Intronic
1132702877 16:1229532-1229554 GGGGCCTGGAAGGGTGGGGAAGG - Intronic
1132705449 16:1241336-1241358 GGGGCCTGGAGGGGTGGGGAAGG + Intronic
1132982546 16:2745841-2745863 GGCACCTGGAGGGATGGGCGTGG + Intergenic
1132989245 16:2784698-2784720 GACCCCTGGACGGTTGGGCAGGG + Exonic
1133231118 16:4367062-4367084 GGCTCCTGGAAGTGTGGGGAGGG - Intronic
1133973239 16:10581463-10581485 GGCTCTTGGGAGGATGGGGGAGG + Intergenic
1134079582 16:11315765-11315787 GGCCCCCAGCAGGAGGGGGAAGG + Intronic
1135886179 16:26310299-26310321 GGGCCCTGGAATGATTGGGAAGG - Intergenic
1136088963 16:27904660-27904682 AGCCTCAGGAAGGAAGGGGAGGG - Intronic
1136227169 16:28866806-28866828 GGCGCCTTGAAGGATGGAGCAGG + Exonic
1136289366 16:29262187-29262209 GGCCCCTCCAGGGATGGAGAGGG + Intergenic
1136777296 16:32878776-32878798 GCCCCCTGGAGGGGTGGGGTGGG + Intergenic
1136893329 16:33982737-33982759 GCCCCCTGGAGGGGTGGGGTGGG - Intergenic
1138375191 16:56558533-56558555 GCCCCCAGGAAGGATGAGTAAGG - Intergenic
1138526053 16:57607876-57607898 GGCCCCTGAGAGGATGCGGGTGG + Intergenic
1139477063 16:67208086-67208108 AGCACCTACAAGGATGGGGAGGG + Exonic
1139573490 16:67827461-67827483 GGCCCCTCCCAGGATGAGGAGGG + Exonic
1139594617 16:67950482-67950504 GGCCCCTGCAGGTATGGCGATGG - Exonic
1139664672 16:68447635-68447657 GACTCCGAGAAGGATGGGGAGGG + Intronic
1139897044 16:70295936-70295958 GGCCTCTAGAAGGGTGGGGGTGG - Intronic
1139949878 16:70663646-70663668 GGGGCCTGAGAGGATGGGGAGGG + Exonic
1141647120 16:85373527-85373549 GGCCCCTGGGAGAATGGGCTGGG + Intergenic
1141840708 16:86572439-86572461 GGCCTCTGGAAGGCTGGGCTTGG + Intergenic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142249499 16:88984609-88984631 GGCACCCGGAAGGATCCGGAAGG + Intergenic
1142284334 16:89165614-89165636 GGCCCATGGTAGGGTGGGCATGG - Intergenic
1142299273 16:89247271-89247293 GGCGCCAGGGAGGATGGAGAAGG + Intergenic
1142423217 16:89986241-89986263 AGCACCTGGAAGGATGGGTCAGG - Intergenic
1203079710 16_KI270728v1_random:1140885-1140907 GCCCCCTGGAGGGGTGGGGTGGG + Intergenic
1143116754 17:4585470-4585492 GGCCCCTGGATGGGTGGGGAGGG + Intronic
1143175092 17:4950749-4950771 GAGCCCTGCAAGGCTGGGGAGGG - Intronic
1143523980 17:7462081-7462103 GACCCCTGGTAGGAAGGGAAGGG + Exonic
1143539175 17:7559247-7559269 GGCCCCTCCCAGAATGGGGAAGG + Exonic
1143651964 17:8268861-8268883 GGCCCAAGGAAGGCTGGGGGAGG + Intronic
1144185426 17:12791024-12791046 GGCATCTGGTAGGATGGGGGTGG + Intronic
1146644307 17:34566957-34566979 GGCACCTGCAAGGAAGGGGCTGG - Intergenic
1147150786 17:38512459-38512481 GGCCCAGGGAAGGAGGGCGATGG + Intergenic
1147191071 17:38738554-38738576 GGCCCCCTGGAGAATGGGGATGG - Exonic
1147265489 17:39231950-39231972 GGCCCCACGCAGGCTGGGGAGGG + Intergenic
1148124314 17:45229089-45229111 GGCCCTTGGAGGGCTGGGGGAGG + Intronic
1148217298 17:45840157-45840179 GGTCTCAGGAAGGGTGGGGAAGG - Intergenic
1148451843 17:47783644-47783666 TGCCCCTGGAAAGCTGGGGCAGG - Intergenic
1148700001 17:49581546-49581568 GGCCCCTGGAAGCATGATGTGGG - Intronic
1149224509 17:54453772-54453794 TGCCTATGGCAGGATGGGGAAGG - Intergenic
1149313437 17:55418184-55418206 GGGCTCTGGTTGGATGGGGAGGG - Intronic
1149595320 17:57861805-57861827 GGGCCCTGGAGGGAGGGGGGGGG - Exonic
1149683031 17:58518709-58518731 GTCCCCGGGAAGGAAAGGGAGGG - Intergenic
1151154417 17:72114835-72114857 GGACCCTGGAGGCGTGGGGATGG + Intergenic
1151186619 17:72369479-72369501 TGCCCCTGGAAGTATGGAGCAGG + Intergenic
1151364877 17:73610721-73610743 GTGCCCAGGAAGGATGGAGAGGG + Intronic
1151818045 17:76481213-76481235 GGGCCCAGGAAGGAGGGGGTAGG + Intronic
1152442562 17:80317910-80317932 GGACACTTGAAGGATGGTGAAGG + Intronic
1152612743 17:81323553-81323575 GGCCCCAGGAGGGGTGGGGGCGG + Intronic
1152716671 17:81903609-81903631 GGGGCCTGGCAGGATGAGGATGG + Intronic
1152906816 17:82974874-82974896 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1152906881 17:82975059-82975081 GGTCCCTGGGAGGATGGAGTCGG - Intronic
1152907144 17:82975856-82975878 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1152907228 17:82976103-82976125 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1152907370 17:82976534-82976556 GGCCCCTGGGAGGATGGAGTCGG - Intronic
1153354947 18:4124264-4124286 GGACCCTAGAAGGATGGAGGTGG + Intronic
1155017861 18:21863404-21863426 GGACACTTGAAGGATGGTGAAGG + Intronic
1155503117 18:26506385-26506407 GGGGCTGGGAAGGATGGGGAAGG + Intronic
1155830123 18:30505573-30505595 TGCCGCAGGAAGGGTGGGGAGGG + Intergenic
1155850741 18:30770490-30770512 TGCCTGTGGAATGATGGGGAAGG - Intergenic
1156350004 18:36295836-36295858 GGCCCCTGAGAGGATGGGCTGGG + Intergenic
1156905612 18:42348713-42348735 GGACACTTGAAGGATGGTGAAGG - Intergenic
1157145395 18:45157415-45157437 GGCACCTGGAAGGCTTAGGAGGG + Intergenic
1157500833 18:48189619-48189641 GGCACCTGGAAGGATGGGTGGGG - Intronic
1158139493 18:54241824-54241846 GGCTCCTGGATGGAAGGGGGTGG - Intergenic
1159775619 18:72600576-72600598 GGGGCCTGGAAGGATATGGAAGG + Intronic
1160380971 18:78455413-78455435 GGCCCCAGGAAGGGTTGTGAGGG + Intergenic
1160586288 18:79915291-79915313 GGGCCCTGGGGGGATGCGGAGGG - Intronic
1160587955 18:79923078-79923100 GGCCAGAGGAAGGATGGGCATGG + Intronic
1160870243 19:1274631-1274653 GCCTCCTGGAAGGAGGAGGAAGG - Intronic
1160899203 19:1418715-1418737 GGCCGAAGGAAGGATGGGTAAGG + Exonic
1161056132 19:2191466-2191488 GGCACCTGGGAGGATGGGCCTGG - Intronic
1161364550 19:3870730-3870752 GCAGCCTGGAAGGAGGGGGAGGG + Intergenic
1161780153 19:6286427-6286449 GGTTCCTGGATGGAAGGGGATGG + Intergenic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162150284 19:8640151-8640173 GGCCCCAGGAAGGTGGGTGAGGG - Intergenic
1162302115 19:9850001-9850023 GGCTCCTGCAGGGAGGGGGATGG + Intergenic
1162472627 19:10881600-10881622 GTCCCCTGGAGGGCTGGGGTGGG + Intronic
1162534109 19:11253151-11253173 AGCCCCTGGAGGGAGGGGCAGGG - Intronic
1162586013 19:11559024-11559046 CGCGCTTGGAAGGATGGGGTCGG + Intronic
1162934974 19:13977784-13977806 GGACCCTTGAAGGTTGGGAAAGG - Intronic
1163018270 19:14469973-14469995 GGCCTCTGCAAGGAGGGTGAGGG + Exonic
1163102700 19:15107674-15107696 GGGTCCTGGAAGGAAGGGGCTGG + Intronic
1163112938 19:15172374-15172396 GGGACCTGGAAGTATTGGGAAGG - Intronic
1163118027 19:15200059-15200081 GGCCCCTGGCCGGCTGGGGAGGG + Intronic
1163297916 19:16424324-16424346 GGCCCCTGGTGGGGTGGGGTGGG - Intronic
1163820688 19:19494826-19494848 GGCCCACGGCAGGATGGGCATGG - Intronic
1164261374 19:23570920-23570942 GGGCCGTGCAGGGATGGGGAAGG - Intronic
1164927304 19:32140339-32140361 TGCCCCTGGGAGGGTGAGGATGG + Intergenic
1165112255 19:33509275-33509297 GGCCCCTGGGAAGAAGGGCACGG - Intronic
1165633102 19:37318096-37318118 GTCCGGTGGACGGATGGGGAAGG - Intronic
1165810307 19:38607961-38607983 GACCCCAGGGAGGATGGGGAGGG - Intronic
1165986786 19:39776534-39776556 GGCCTCTGAAAGTAAGGGGAGGG + Intergenic
1166266748 19:41689012-41689034 GGCCCCAGGAAGGAAGAGGTGGG + Intronic
1166316075 19:41991086-41991108 GGAGCCTGGGCGGATGGGGAGGG + Intronic
1166328003 19:42062907-42062929 GGCTCCCTGAGGGATGGGGAAGG - Intronic
1166524850 19:43504510-43504532 GGCTCCGGGAAGGATGGGGCGGG - Intronic
1166765893 19:45251909-45251931 GGCTCCTGGAAGCAGGGGAAGGG - Intronic
1166766161 19:45252830-45252852 GGGGCCTGGAAGTATGGGGTAGG - Intronic
1166792173 19:45404925-45404947 CGTCCCTGGGAGGATTGGGAGGG - Intronic
1167034501 19:46986295-46986317 TGCCCACGGTAGGATGGGGAGGG + Intronic
1167134780 19:47609789-47609811 GGGCCCTGGAAAGCTGGGGAGGG + Intronic
1167752739 19:51390569-51390591 GGGCCCGGGAAGGTTGGGGAGGG + Exonic
1168277221 19:55284725-55284747 GGTCCCTGGATGGAGGGGGTGGG + Intronic
1168315710 19:55483906-55483928 GGCCCCGGGGAGGCGGGGGATGG + Exonic
1168663348 19:58184036-58184058 TGCACCTGGGAGGATGCGGATGG + Intronic
925008882 2:467418-467440 GGCCCCTGCATGGGTGGGGGTGG + Intergenic
925134029 2:1514229-1514251 GGGCCCTGGAAGGATGGGACAGG + Intronic
925274818 2:2641280-2641302 GTCCACTGGAGGGATGGTGAGGG - Intergenic
926285351 2:11483093-11483115 GGTCCCGGGAAGGAGGTGGAAGG + Intergenic
926416297 2:12652855-12652877 GCTCCGTGGAAGGATGGGAATGG - Intergenic
926625414 2:15085987-15086009 GGCTCCTGGAGGGAAGGGGTGGG + Intergenic
926750849 2:16197480-16197502 GGGCCCTGGCAGCATGGGAAGGG - Intergenic
926777964 2:16440700-16440722 GGCCCCGGGAAAGAGGGGAAGGG + Intergenic
927592758 2:24371051-24371073 GCCACCTGGAAGGATGAGGTAGG + Intergenic
928075615 2:28261789-28261811 GGCCACTGGAAGGGAGGGAAGGG - Intronic
928085173 2:28341664-28341686 GGCCCCGAGAAGGAGGGGCAAGG + Intergenic
929201681 2:39243701-39243723 GGCCCCTGGAAGGGAAGGGGCGG - Intergenic
929583195 2:43097435-43097457 GGACCCGGGAAGGTTGGGGTGGG + Intergenic
929654412 2:43716204-43716226 GGCCCCTGGAAGAAGGGAGGAGG + Intronic
929968747 2:46555028-46555050 TGGCCCTGGAGGAATGGGGAAGG + Intronic
931263498 2:60640133-60640155 GGAGCCTGGAAGGAGGGAGAGGG - Intergenic
931785994 2:65619982-65620004 GTCCCAGGGAAGGATGAGGATGG + Intergenic
933694651 2:85208686-85208708 GGCCTCTGGAAGGATGGAAATGG + Intronic
934033492 2:88068197-88068219 GGCTCCTAGAAGGGTGGTGAAGG + Intronic
934152099 2:89156652-89156674 TGTCCCTGGAAGGTGGGGGAGGG + Intergenic
934215152 2:90025254-90025276 TGTCCCTGGAAGGTGGGGGAGGG - Intergenic
934474914 2:94587418-94587440 GGCTCCAGGCAGGGTGGGGATGG + Intergenic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
934857860 2:97739967-97739989 GACCCCTGGGAAGATGGGGCTGG + Intergenic
935249955 2:101252706-101252728 GGGCCCGGGAAGGGAGGGGAGGG - Intronic
935787649 2:106563448-106563470 GGGGTCTGGGAGGATGGGGAAGG + Intergenic
935808337 2:106771052-106771074 GGACCTTGGATGGATGGGGCAGG - Intergenic
936069104 2:109353526-109353548 GGCGCCTGGAGGGACGTGGAGGG + Intronic
936076222 2:109403476-109403498 GGGCCCTGGAAGGCCAGGGAGGG - Intronic
936095780 2:109529237-109529259 GGCCTCTGAAGGGATGGGGTGGG + Intergenic
936428288 2:112437086-112437108 GGCCACAGGGAGGGTGGGGAGGG + Intergenic
936613292 2:114022970-114022992 GGCTCCTAGGAGGATGTGGATGG - Intergenic
937023560 2:118679696-118679718 GGTCCCTAGAAGGATGGGTTTGG + Intergenic
937295298 2:120806543-120806565 GCCCCCTGGGAGTGTGGGGAGGG + Intronic
937770993 2:125720942-125720964 GGGCACTTGAAGGATGGTGAAGG - Intergenic
938094749 2:128454174-128454196 GGCCCCTGCAAGAGAGGGGAGGG + Intergenic
938096443 2:128467196-128467218 GGCTCCTGGGTGGATGGGGAAGG - Intergenic
938653371 2:133406860-133406882 GTCCCCTGGAAGGAAGGGCAAGG - Intronic
938769781 2:134491344-134491366 GGCCACTGGGAAGATGGGGGTGG + Intronic
940224857 2:151390497-151390519 GGCTGCTGGAGAGATGGGGAAGG - Intergenic
941096585 2:161244856-161244878 GGCCCTGGGAAGCGTGGGGAAGG + Intergenic
942426206 2:175863404-175863426 GGCCCCTGGGATGAGGGAGAGGG - Intergenic
946236218 2:218326044-218326066 GCCTCCAGGAAGGATGGGGAGGG + Intronic
946301720 2:218828131-218828153 GGACACTGGCAGGGTGGGGAGGG - Intronic
947670037 2:231930073-231930095 GGCTGCTGGGAGGCTGGGGAAGG + Intergenic
947747569 2:232516864-232516886 TGCCTGTGGAAGGATGGAGATGG + Intergenic
947811183 2:233004787-233004809 GGCCCCCAGCAGGATGAGGAAGG - Intronic
948001016 2:234567563-234567585 GGCCACTGCAAGGATTGGCAGGG - Intergenic
948460483 2:238127785-238127807 GGCCCCTAAGAGGATGGGAATGG - Intronic
948646451 2:239407993-239408015 GGCCTCTGAAAGAAAGGGGAGGG + Intergenic
948653652 2:239464066-239464088 GGCCCCTGGAGGGGTGGAGCTGG + Intergenic
948727866 2:239945820-239945842 GGGCCCTTGAAGCCTGGGGACGG - Intronic
948800969 2:240433466-240433488 GGACTCTGGGAGGATGGGCAAGG - Intergenic
948816228 2:240511722-240511744 GGAGCTTGGAAGGATGGGGAGGG - Intronic
948846591 2:240685734-240685756 GGCACCTGGAAGGAGGGGGTTGG + Intergenic
948847270 2:240689000-240689022 GGCACCTGGAAGGAGGGGGTTGG - Intergenic
949047180 2:241877515-241877537 GCCCCCTGGCAGGGTGCGGAAGG - Intergenic
1168794752 20:604133-604155 GAGCCCTGGAAGGGTGGGGGTGG - Exonic
1172432789 20:34906411-34906433 GGCCCCTGGCTGGTTGGGAAAGG - Intronic
1173120234 20:40282381-40282403 GGCCCCTGGAAGGAGGCAGCTGG - Intergenic
1173331261 20:42078040-42078062 GGCTCCTTGCAGGCTGGGGAAGG + Exonic
1173537168 20:43824396-43824418 CGCACCAGGAAGGATGGTGAGGG - Intergenic
1173575765 20:44112251-44112273 GGCCCCTCCAAGCCTGGGGAAGG - Exonic
1173991916 20:47310136-47310158 GGCCATTGGAAGAATGTGGAGGG + Exonic
1174388377 20:50200685-50200707 GGCCCCAGGAAGGCTGGCAAAGG - Intergenic
1175033745 20:55980207-55980229 GGACTCAGGAAGGTTGGGGAGGG - Intergenic
1175228550 20:57459635-57459657 GGCCCCTGGATGGTGTGGGATGG - Intergenic
1175732397 20:61362708-61362730 TGCCCCTGGCTGGATGGGGTGGG + Intronic
1175900993 20:62359884-62359906 TGCTCCTGGAAGGCTGAGGAGGG - Intronic
1175904988 20:62375301-62375323 GTCCCCTGCCAGGAGGGGGAGGG + Intergenic
1175994480 20:62805929-62805951 GGCGCCTGGCAGGATGGTCAGGG - Intronic
1176237880 20:64062760-64062782 GGGCTCTGGGAGGCTGGGGACGG + Intronic
1176373964 21:6078125-6078147 GGCCACAGGGAGGGTGGGGAGGG - Intergenic
1176407858 21:6431223-6431245 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1178426780 21:32484984-32485006 GGGCTCTGGAAGGATTTGGAAGG - Intronic
1178934833 21:36852410-36852432 GGCCCCTGGGAAGCTGGGTATGG - Intronic
1178953832 21:37006429-37006451 GGCCCGGGCAAGGGTGGGGACGG - Intronic
1179494030 21:41760481-41760503 GGCCCCTGAGAGAATCGGGAAGG + Intronic
1179564157 21:42235902-42235924 GGCCCCCTGAACCATGGGGATGG - Intronic
1179586173 21:42375409-42375431 AGCCCCTGCTGGGATGGGGATGG - Intronic
1179683349 21:43039554-43039576 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1179749513 21:43460118-43460140 GGCCACAGGGAGGGTGGGGAGGG + Intergenic
1180844393 22:18973347-18973369 GGGCCCTGGAAGGTGGGGGAAGG + Intergenic
1180993699 22:19953954-19953976 GGCCCATGGAAGGGAGGGGAGGG + Intronic
1181057079 22:20265364-20265386 GGGCCCTGGAAGGTGGGGGAAGG - Intronic
1181086625 22:20442552-20442574 GCCCCCTGGAAGGATGGCACAGG + Intronic
1181106254 22:20577452-20577474 GGGCCAGGGAAGGCTGGGGAGGG - Intronic
1181485190 22:23226058-23226080 GTCCCCTGGCAGGGTGGGGCAGG + Intronic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1181646641 22:24234874-24234896 TGCCCATGGACAGATGGGGAGGG - Intronic
1181675612 22:24449635-24449657 GGCCACAGGAAGTATGGGGTAGG - Intergenic
1181756261 22:25027223-25027245 GGCATCTGGAAGGGTGGGGGAGG + Intronic
1182492622 22:30683450-30683472 GGGCGATGGAAGGAAGGGGAGGG - Intergenic
1182736054 22:32532850-32532872 CGCCCATGGAAGGAGGGGGCTGG + Intronic
1182872652 22:33662334-33662356 GGCTCCTGAAAAGATGGGGCAGG - Intronic
1183585494 22:38750829-38750851 GGCCTCAGGAAGGCTGGGCAGGG - Intronic
1183597940 22:38823349-38823371 GGGCCCTGGAAGGATGGACATGG - Intronic
1184039569 22:41934977-41934999 TGTCCCTGGAAGGCGGGGGATGG - Intergenic
1184273566 22:43398175-43398197 GGCCCCTGGAAGGAGGGCCAAGG + Intergenic
1184359631 22:44007225-44007247 GTACCCAGGAAAGATGGGGAGGG + Intronic
1184399615 22:44266334-44266356 GCCACCTAGATGGATGGGGATGG + Intronic
1184650902 22:45919087-45919109 GCCCCCTGGGAGGATGTGCAGGG + Intergenic
1184820459 22:46905803-46905825 TGCCCCCAGAAGGATGGAGAAGG - Intronic
1184831690 22:46992830-46992852 GGCCCCCGAGAGGATGTGGAAGG + Intronic
1185037805 22:48489090-48489112 AGGGCCTGGAAGGCTGGGGAGGG - Intergenic
1185129121 22:49027627-49027649 GAGCCCTGGATGGATGGGGGAGG - Intergenic
1185158783 22:49210053-49210075 AGCCCCTGGAGGGGTGGGGGAGG + Intergenic
1185205508 22:49535779-49535801 AGCCCCCGGGAGGATGGGCAAGG + Intronic
1185230401 22:49677298-49677320 GGCACCTGGCAGGAAGGGGGAGG - Intergenic
1185376737 22:50486125-50486147 GGGCCCAGCGAGGATGGGGATGG - Exonic
949868298 3:8565414-8565436 CAGACCTGGAAGGATGGGGAAGG - Exonic
950018208 3:9768856-9768878 TGCCCCTGGATGGGTGGGCAGGG - Intronic
950537632 3:13589267-13589289 GCTCCCTGGAAGGCTGTGGAAGG + Intronic
950645545 3:14374552-14374574 TGCCCCTGCCAGGATGGGCAGGG + Intergenic
950767773 3:15286211-15286233 GGCCTGTGGAAGGATGGGAATGG + Intronic
952866995 3:37861441-37861463 GGGCACTGGAAGGATTCGGAAGG - Intergenic
953436649 3:42882500-42882522 GCCCCTTGGGAGGGTGGGGAGGG + Intronic
953454337 3:43029942-43029964 TGCCGTTGGAAGGAAGGGGAAGG + Intronic
954155664 3:48683692-48683714 GATCCCTGGAATGTTGGGGATGG - Intronic
954211210 3:49098476-49098498 GGGCCCTGGAAGTGGGGGGAGGG + Exonic
954440006 3:50516614-50516636 GGCCCCAAGAAGGAGAGGGAGGG - Intergenic
954682976 3:52355829-52355851 AACCCCTTGAAGGATGGTGAGGG - Intronic
954913250 3:54126731-54126753 GGCCCCTGGAGGGATGGTGCTGG + Intronic
954954736 3:54508989-54509011 GGCTGCTGGAGGGATGGGCAGGG + Intronic
955331866 3:58053981-58054003 GGCCCGTGGCAGGGTGGGGTTGG + Intronic
955353184 3:58209210-58209232 GCCTCTTGGTAGGATGGGGAGGG + Intronic
955534333 3:59907197-59907219 GGGCCATGGAAGTGTGGGGAAGG - Intronic
955658055 3:61265521-61265543 GGCCACTGGTTGGTTGGGGATGG + Intergenic
955994123 3:64660559-64660581 AGCCCCAGGCAGGATGGGGCAGG - Intronic
956301266 3:67775111-67775133 GGACACTTGAAGGATGGCGAAGG + Intergenic
960997282 3:123348534-123348556 GGAGACTGGAAGGATGGGGTGGG + Intronic
961202161 3:125053922-125053944 GGGCCCTGGCTGGATGGGGCAGG - Intronic
961441424 3:126955525-126955547 CTCCCCTGGCAGGAAGGGGAAGG + Intronic
962273614 3:133996164-133996186 GTGCCCTGGCAGGATGGGGAAGG + Intronic
962385116 3:134926667-134926689 GGAACCTGGAAGGGTGGCGATGG + Intronic
962929100 3:140021186-140021208 GGCACTTAGGAGGATGGGGATGG - Intronic
963350133 3:144141283-144141305 TGTCCCTGGCAGGATGGGGTAGG + Intergenic
965980635 3:174685821-174685843 GGCCTATGGAAGGGTGGGGGTGG - Intronic
966201027 3:177359700-177359722 GGCCCCTGCAGGGTGGGGGAGGG + Intergenic
966339944 3:178914533-178914555 GTGCCCTGGAAGCATGAGGAAGG - Intergenic
967045881 3:185736264-185736286 GGCCCTTGGAAGGAGCTGGAAGG - Intronic
967829425 3:193906113-193906135 GGGCCCTGGAAGGTTCCGGAAGG + Intergenic
968460764 4:723690-723712 GGCTGCTGGCTGGATGGGGATGG + Intronic
968875879 4:3267717-3267739 GGCCCCTGGAAGGAGGGGCTGGG - Intronic
968929902 4:3573341-3573363 GGGCCCTGGGAGGCTGAGGAAGG - Intergenic
969065170 4:4473727-4473749 GACCCCTGGTAGGCAGGGGAAGG - Intronic
969690558 4:8701857-8701879 TGCCCCTGGAAGGTTTGTGAGGG - Intergenic
971959818 4:33471296-33471318 GGACACTTGAAGGATGGTGAAGG + Intergenic
973022442 4:45220345-45220367 GGGCACTTGAAGGATGGTGAAGG + Intergenic
974260190 4:59517344-59517366 GGCACCTGGAAGTTTGGTGATGG + Intergenic
975529512 4:75386071-75386093 GGCCCCAGGGAGGCTGGAGAGGG - Intergenic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
978498572 4:109385248-109385270 GGCACCTGGAAGGTTGGGTGAGG - Intergenic
978842660 4:113232995-113233017 GGCCACTGGAAGGTTGGGAGTGG + Intronic
978882242 4:113719669-113719691 GCCCCCTTGGGGGATGGGGAAGG + Intronic
980744946 4:137001064-137001086 GGCTCCTGGCAGAAAGGGGAAGG + Intergenic
981437087 4:144737233-144737255 GCCCCCTGGAAGCAAGAGGAAGG + Intronic
981971541 4:150668117-150668139 GGCCTCTGGAAGTTTGGGTATGG + Intronic
982832896 4:160086125-160086147 AGCCCGTGAAAGCATGGGGAGGG - Intergenic
985069013 4:186150245-186150267 GACCCTTGGAGGGAGGGGGAGGG - Intronic
985562728 5:599335-599357 GCCTCCTGGAGGGTTGGGGATGG - Intergenic
985583450 5:712489-712511 GTTTTCTGGAAGGATGGGGAGGG - Intronic
985596965 5:796787-796809 GCTTTCTGGAAGGATGGGGAGGG - Intronic
985688650 5:1295074-1295096 GGCCGCGGAAAGGAAGGGGAGGG + Intergenic
985766010 5:1779929-1779951 GGCCCCTGGAAGGACAGGCTGGG - Intergenic
985874901 5:2587105-2587127 AGCCCCTGAAAGGACGGAGATGG - Intergenic
986086348 5:4454545-4454567 GGCCCCTGTTAGGAGGCGGATGG - Intergenic
986273896 5:6257052-6257074 GGACACTGGAAGGAAGGGGAGGG - Intergenic
986345043 5:6826982-6827004 GCACCCTGGTAGGATGGGCATGG - Intergenic
987322826 5:16786102-16786124 GGCCCCTGGTGGGTAGGGGAGGG - Intronic
991692085 5:69235047-69235069 GCTCTCTGGAAGGACGGGGAGGG + Intronic
993095072 5:83471903-83471925 GGCCCGGGGAAGGATGCGGAGGG - Exonic
993865609 5:93191066-93191088 TGACCCTGGAAGGCTGGGGTAGG - Intergenic
994899783 5:105757073-105757095 GGCACCTGGAAGGCTGAGGCAGG + Intergenic
995420635 5:111962929-111962951 GGACACTTGAAGGATGGTGAAGG - Intronic
996504260 5:124251894-124251916 AGCATCTGGCAGGATGGGGATGG + Intergenic
996852289 5:127966514-127966536 GGGAGCTGGAAGGGTGGGGATGG + Intergenic
998135408 5:139671679-139671701 GGCCCTGGAAAAGATGGGGAAGG - Intronic
998167549 5:139852823-139852845 GCCCCCTGCAAGGATGGGCCAGG - Intronic
999463451 5:151777458-151777480 GATCCCTGGAAGGAAGGGAATGG - Intronic
1001323113 5:170699024-170699046 GGCCCTGGGATGGATGTGGAAGG - Intronic
1001824130 5:174732362-174732384 GGCGTCTGGAGCGATGGGGATGG - Intergenic
1001894110 5:175363893-175363915 GGCCCCTGAGAGCATGGAGAAGG + Intergenic
1002043205 5:176528947-176528969 GGGCCCAGGGAGGATGGGGAGGG - Exonic
1002101890 5:176861879-176861901 GTCCCCTGAGAGGATGGGGTGGG - Intronic
1002260493 5:177990801-177990823 AGCCCCTGGAGGGAGGTGGATGG - Intergenic
1002701402 5:181127696-181127718 GACCCCTGGAGTGATGTGGAGGG + Intergenic
1002729791 5:181326296-181326318 GGCCCCTGGGAGGCAAGGGAGGG - Intergenic
1002814812 6:669659-669681 TGTACCTGGAAGGATGGAGAAGG + Intronic
1002891388 6:1335777-1335799 CTCCCCTGGAAGGATGTGAATGG + Intergenic
1002961895 6:1923210-1923232 GGACACTTGAAGGATGGTGAAGG - Intronic
1006364923 6:33609747-33609769 GGCCCTTGGGAGGCTGGGGAGGG + Intergenic
1006442471 6:34060927-34060949 GGTCCCTGGAGGGATGGAGGAGG - Intronic
1006797276 6:36739791-36739813 TGACCCTGCAAGGATGGGGGTGG + Intergenic
1007360701 6:41353277-41353299 GAGCCCTGGAGGGCTGGGGAAGG - Intergenic
1007376820 6:41462702-41462724 AGCCCCTGGAAGGAAAGTGAGGG + Intergenic
1007413517 6:41678814-41678836 GGCGCATGGAAGGAGAGGGAGGG - Intergenic
1007419907 6:41713133-41713155 GGGCCCTGGTAAGCTGGGGAGGG - Intronic
1007989416 6:46239659-46239681 GGTCCTTGGTAAGATGGGGAAGG + Intronic
1010724043 6:79313041-79313063 GTCCCCTGCAAGCATGGAGAAGG - Intergenic
1010929037 6:81777963-81777985 GTCCACTGGAAGGAGTGGGAAGG - Intergenic
1011636688 6:89381060-89381082 GGCCACTGGGCGGGTGGGGAAGG + Intronic
1013216539 6:108032573-108032595 GGACACTTGAAGGATGGTGAGGG + Intergenic
1013725592 6:113091659-113091681 TGCCTATGGAAAGATGGGGATGG + Intergenic
1014194083 6:118532363-118532385 GGCGGGTGGAAGGATGGTGAGGG + Intronic
1017404882 6:154108386-154108408 TGCCAGTGGAAGGGTGGGGAAGG + Intronic
1017544288 6:155434483-155434505 GTCCCTGGGAAGGATGGGGTTGG + Intronic
1017599962 6:156069701-156069723 GGCCTCTAGAAAGACGGGGATGG + Intergenic
1018577426 6:165274285-165274307 GGCCCCTGTGAATATGGGGACGG + Intergenic
1018966955 6:168496985-168497007 GCCCCCGGCAAGCATGGGGAAGG + Intronic
1019155269 6:170034284-170034306 GGCTCCTGGAGAGAAGGGGAGGG + Intergenic
1019278208 7:187076-187098 GGCCCCTGGGAGGAGGTGGGAGG + Intergenic
1019282079 7:205675-205697 GGCCCCAGGCAGGAGGGAGATGG - Intronic
1019387031 7:763121-763143 GGCCCCAAGAAGGAAGGGGAGGG - Intronic
1019415639 7:925484-925506 GGCCCCTGGAAGGCGGGTGGGGG - Intronic
1019463569 7:1174238-1174260 TGGCCCTGGATGGATGGGGCTGG - Intergenic
1019658801 7:2212164-2212186 GGTCCTGGGAAGGATGGGGCAGG + Intronic
1019659044 7:2213638-2213660 AGCCCCTGGAAGATGGGGGAGGG - Intronic
1019946400 7:4332869-4332891 GGACCATGGCAAGATGGGGACGG - Intergenic
1021500792 7:21330103-21330125 GGCTCCTGGACGGAAGGGGTTGG - Intergenic
1022443935 7:30454902-30454924 GGCCTTTGGAAGTATGGGAATGG - Intronic
1023248827 7:38235694-38235716 AGCCCCTGGTAGGATGGATAAGG + Intergenic
1025173117 7:56779552-56779574 GGCACCTGAAGGGAGGGGGAGGG - Intergenic
1025249451 7:57342238-57342260 GGCTCCGGGAAGGATGGGGGTGG - Intergenic
1025698990 7:63798624-63798646 GGCACCTGAAGGGAGGGGGAGGG + Intergenic
1025830696 7:65046586-65046608 GGCACATGGAGGGAGGGGGAGGG + Intergenic
1025917863 7:65880498-65880520 GGCACATGGAGGGAGGGGGAGGG + Intronic
1026943645 7:74302910-74302932 AGCCCCAGGAAGAATGGGGTGGG - Intronic
1027626505 7:80551462-80551484 GGCGCCTGGGAGGATGAGGCAGG + Intronic
1028111748 7:86949889-86949911 GTCTCCTGGATGGAAGGGGATGG + Intronic
1029582952 7:101449375-101449397 GGCCCCTGGCAGGATCTAGATGG - Intronic
1029688615 7:102165702-102165724 GGACCCTTGAGGGATGGGCAGGG + Intronic
1030600746 7:111589022-111589044 GGACTTTGGAAGGATGGGGGTGG + Intergenic
1031986258 7:128166541-128166563 GGCCTTTGGGAGGAAGGGGAAGG + Intergenic
1031989735 7:128189746-128189768 GGCCTCTGGGTGGCTGGGGAAGG + Intergenic
1032094205 7:128929531-128929553 GGCCCCTGGCAGGGCTGGGAAGG - Intergenic
1033597030 7:142865788-142865810 GGCCCAGGGAAGGATGGGTCAGG - Intronic
1034095624 7:148405193-148405215 GACCCCAGGAAGGAAGGGGCAGG + Intronic
1034262475 7:149765447-149765469 GGCCCGGGAAAGGATGGGGTCGG + Exonic
1034432778 7:151049432-151049454 GGTCCCTGGCAGGATAGGTAGGG - Intronic
1034433462 7:151052107-151052129 GGCCCCTAGGATGAGGGGGAAGG + Intronic
1035188098 7:157141313-157141335 AGCCTCTGGAATGCTGGGGATGG - Intronic
1035609075 8:948431-948453 GGCCTGAGGAAGGAAGGGGAAGG - Intergenic
1035701015 8:1639291-1639313 GGAGCCAGGAGGGATGGGGAGGG + Intronic
1036182326 8:6596270-6596292 CTCCCCTGGAAGGTAGGGGAGGG + Intronic
1037519288 8:19664054-19664076 GGCACCTGGCAGGGTGTGGAGGG - Intronic
1038284543 8:26195315-26195337 TTGCCCTGGAAGGATGAGGATGG + Intergenic
1040901285 8:52419556-52419578 GGCCTCTGAAAGGGTGGAGAGGG + Intronic
1041030125 8:53728258-53728280 GGCCCCTGTAAGGCTGAGGATGG - Intronic
1042673439 8:71289124-71289146 GGTCCCTGGAAGGAAGGGGAGGG + Intronic
1043998597 8:86849697-86849719 GGTCCCTGGGATGATGGGGGTGG - Intergenic
1044933875 8:97275714-97275736 GGTTCCTGGAAAGCTGGGGAGGG + Exonic
1045940620 8:107734448-107734470 GGCTCAAGGAAGGGTGGGGAGGG - Intergenic
1047448282 8:124939035-124939057 GGCCCTGGGAGGGGTGGGGAGGG - Intergenic
1048332480 8:133480093-133480115 GGAGCAGGGAAGGATGGGGAAGG + Intronic
1049009678 8:139879180-139879202 GGACTCTGGAAGAATGGTGAGGG + Intronic
1049107869 8:140624929-140624951 GGCCGTTGGAAGGAGCGGGATGG - Intronic
1049108509 8:140628324-140628346 GGCCCCAGGAATGAGGAGGACGG + Intronic
1049196812 8:141320366-141320388 GGCGGGTGGAAGGGTGGGGACGG + Intergenic
1049417271 8:142500806-142500828 GGTGCCTGGAAGCAGGGGGATGG + Intronic
1049498364 8:142947320-142947342 AGCCCATGGCAGGCTGGGGAGGG - Intergenic
1049542189 8:143213692-143213714 GGCCCCAGGGTGGCTGGGGAGGG - Intergenic
1049542203 8:143213711-143213733 GGCCCGAGGATGGCTGGGGAGGG + Intergenic
1049675647 8:143887709-143887731 AGCCCCTGGGAGGAAGGGGCTGG + Intergenic
1049788303 8:144461833-144461855 GGCTGCCGGAAGAATGGGGAAGG + Intronic
1050534760 9:6622272-6622294 GGCCCGTGGAAAGAGGGAGAGGG - Intronic
1051440770 9:17080289-17080311 GGACCCAGGAGGGTTGGGGAGGG + Intergenic
1052855140 9:33402342-33402364 GGCTCCAGGCAGGGTGGGGATGG - Intronic
1053364365 9:37512083-37512105 GGTCCCTGGAGGGATTGAGAGGG + Exonic
1053683159 9:40498683-40498705 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1053933136 9:43126999-43127021 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054280555 9:63126245-63126267 GGCTCCAGGCAGGGTGGGGATGG + Intergenic
1054296260 9:63334181-63334203 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054394276 9:64638686-64638708 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054428926 9:65143885-65143907 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054460377 9:65459130-65459152 GGGCCCTGGGAGGCTGCGGAAGG + Intergenic
1054501454 9:65877650-65877672 GGCTCCAGGCAGGGTGGGGATGG + Intronic
1055663809 9:78533231-78533253 GGATCCTGCAAGGATGGGAAGGG + Intergenic
1056059567 9:82870287-82870309 GGACACTTGAAGGATGGTGAAGG - Intergenic
1057172579 9:92971983-92972005 GGTGCCTGGAAGGAATGGGAGGG - Intronic
1057915687 9:99053469-99053491 CTCCCCTGGAAGGAGGGGGAGGG + Intronic
1058545814 9:106059607-106059629 GGCTCCTGGGTGGAAGGGGATGG - Intergenic
1059767840 9:117400668-117400690 GGCCCCAGAAAGGATAGAGAAGG + Intronic
1060990547 9:127846468-127846490 GGTTCCTGGAAGTCTGGGGAGGG - Intronic
1061079298 9:128360649-128360671 AGCCTCTGGAAGGGTTGGGAAGG - Exonic
1061248481 9:129413575-129413597 GGCACCGGGGAGGAGGGGGAAGG + Intergenic
1061284009 9:129612169-129612191 GGTTCCTGGAAGGAAGGGGATGG - Intronic
1061328802 9:129879706-129879728 GGCTCCTGGAAGGACGGGACTGG - Intronic
1061559428 9:131393700-131393722 GGCGCCCGGAAAGAGGGGGAAGG - Intergenic
1061757337 9:132824301-132824323 GGGCCTTGGCAGGAGGGGGAAGG - Intronic
1061802378 9:133119673-133119695 GACCCCTGGGAGGGTGGGGGTGG - Intronic
1061987985 9:134141325-134141347 GGACCCTGGGAGGGAGGGGAAGG + Intronic
1062037631 9:134389808-134389830 GGGCCTCGGAAGGAAGGGGAGGG - Intronic
1062103383 9:134739761-134739783 TACCCCTGGAAAGCTGGGGAGGG + Intronic
1062246003 9:135566475-135566497 GAGCCCTGGAAGGATGTGGTGGG - Intronic
1062467066 9:136686224-136686246 TGCCCCTGGAACCACGGGGAAGG + Intronic
1062558479 9:137128253-137128275 GGCACCGGGCAGGGTGGGGAGGG - Intergenic
1185641641 X:1591989-1592011 GGTCCCTGGAAGTAGGGGTAGGG + Intronic
1187449348 X:19382957-19382979 AGACCCTGGAAGGATGCGGGAGG + Intronic
1190725239 X:53185880-53185902 AGCCCCTTGAATGAAGGGGAGGG + Intergenic
1191016336 X:55813727-55813749 GGCTCCTGGGAGGAAAGGGATGG + Intergenic
1192191896 X:68996099-68996121 GGGCCCTGGAGGGGAGGGGAGGG + Intergenic
1193111127 X:77731859-77731881 GGACACTTGAAGGATGGTGAAGG - Intronic
1197768323 X:130073050-130073072 GGAGCCTGGTAGGATGGGCAAGG + Intronic
1198128888 X:133674532-133674554 GTCTCCTGGAAGGTTTGGGAGGG - Intronic
1198498192 X:137215045-137215067 TGCCCATGGCAGGGTGGGGAAGG - Intergenic
1199793990 X:151178002-151178024 GGGCTCTGGAAGGGAGGGGAAGG + Intronic
1200213397 X:154356813-154356835 GGCCCCTGGAAGGTGGGGATGGG + Intronic