ID: 1162066929

View in Genome Browser
Species Human (GRCh38)
Location 19:8131534-8131556
Sequence CCGGGCAGCCGGATGCTCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162066913_1162066929 30 Left 1162066913 19:8131481-8131503 CCCACCAGAAGCGAGAACCGATG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG 0: 1
1: 1
2: 0
3: 3
4: 87
1162066916_1162066929 26 Left 1162066916 19:8131485-8131507 CCAGAAGCGAGAACCGATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG 0: 1
1: 1
2: 0
3: 3
4: 87
1162066925_1162066929 -5 Left 1162066925 19:8131516-8131538 CCAAGGAGGCGATGGGGACCGGG 0: 1
1: 0
2: 3
3: 23
4: 180
Right 1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG 0: 1
1: 1
2: 0
3: 3
4: 87
1162066914_1162066929 29 Left 1162066914 19:8131482-8131504 CCACCAGAAGCGAGAACCGATGG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG 0: 1
1: 1
2: 0
3: 3
4: 87
1162066918_1162066929 13 Left 1162066918 19:8131498-8131520 CCGATGGAGGCATTCAGACCAAG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG 0: 1
1: 1
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162066929 Original CRISPR CCGGGCAGCCGGATGCTCAC CGG Exonic
900243719 1:1628430-1628452 CCGGGGAGCGGGAGGCCCACTGG + Intronic
900440438 1:2652408-2652430 CCAGGCTGTCAGATGCTCACTGG - Intronic
900441154 1:2656018-2656040 CCAGGCTGTCGGATGCTCGCCGG - Intronic
900447192 1:2687208-2687230 CCAGGCTGTCGGATGCTCGCCGG - Intronic
900448220 1:2692307-2692329 CCAGGCTGTCAGATGCTCACTGG - Intronic
900449134 1:2696844-2696866 CCAGGCTGTCGGATGCTCGCCGG - Intronic
900450331 1:2746354-2746376 CCAGGCTGTCGGATGCTCGCCGG - Intronic
900451073 1:2750087-2750109 CCAGGCTGTCAGATGCTCACTGG - Intronic
900451305 1:2751250-2751272 CCAGGCTGTCGGATGCTCACTGG - Intronic
900452159 1:2755586-2755608 CCAGGCTGTCGGATGCTCGCCGG - Intronic
900452601 1:2757795-2757817 CCAGGCTGTCGGATGCTCGCCGG - Intronic
900524888 1:3123741-3123763 CCGAGAAGCAGGGTGCTCACGGG + Intronic
901527887 1:9835624-9835646 CCTGGCAGCGGGGTGCACACAGG - Intergenic
901668269 1:10838682-10838704 CCAGGCAGGCGGCTGCTCCCAGG - Intergenic
904467919 1:30718983-30719005 CCGGGCTCCCGGAAGCCCACGGG + Intronic
917222650 1:172748410-172748432 CCGGGCGGCTGCATGCTTACAGG + Intergenic
1070768479 10:79069464-79069486 CCGCGCAGCCGGGAGCTCGCCGG - Intronic
1074164050 10:110859291-110859313 CAGGGCAGCTGGATGTTCAGGGG - Intergenic
1083803187 11:65058354-65058376 TGGGGCAGCTGGATGCCCACAGG - Exonic
1085520893 11:77138337-77138359 CCGGGCTGCGGGATGCGCGCGGG - Intronic
1089807045 11:121099689-121099711 CCTTGCAGCCGGATTCTCAAAGG + Intergenic
1089981910 11:122779693-122779715 CCTGGCAGCTGTTTGCTCACCGG - Exonic
1090179192 11:124679628-124679650 CCTGGAAGCTGGGTGCTCACTGG - Intronic
1091845359 12:3651980-3652002 CCGGGCCCCAGCATGCTCACCGG + Intronic
1097021950 12:56026939-56026961 TTGGGCAGCCGGATGCCCCCAGG - Exonic
1112300973 13:98230019-98230041 GCAGGCAGCCTGATGGTCACTGG + Intronic
1122271036 14:100568556-100568578 CCGGCGAGCCGGGCGCTCACGGG - Intronic
1122602606 14:102929096-102929118 GCGGGCAGCCGGGTCCCCACCGG - Intronic
1129483243 15:75843931-75843953 CCGGGGAGCCGGAGCCTCTCCGG - Intronic
1130015098 15:80180223-80180245 CAGTGCAGCCAGATACTCACCGG - Exonic
1132798549 16:1739867-1739889 ACGGTCACACGGATGCTCACAGG - Intronic
1133229176 16:4358374-4358396 CGGGGCAGCCGGAAGGCCACAGG + Exonic
1142267574 16:89071525-89071547 CAGGGCAGCCGGGTGAGCACTGG + Intergenic
1144515637 17:15916052-15916074 CAGGGCAGCCGACTGCTGACTGG - Intergenic
1144638189 17:16924143-16924165 CAGGGCAGCAGGCTGCTCTCTGG - Intergenic
1146592677 17:34141748-34141770 CAGGGCAGACAGATGCTCTCTGG - Intronic
1147875048 17:43615109-43615131 CCAGGCAGCAGGATGTACACAGG + Intergenic
1150437902 17:65168279-65168301 CCAGGCAGGAGGATACTCACAGG - Exonic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1162066929 19:8131534-8131556 CCGGGCAGCCGGATGCTCACCGG + Exonic
1163747927 19:19059104-19059126 CCGGGCAGCCTCATGACCACTGG + Intronic
1163862586 19:19749966-19749988 CAGGGCAGCAGGTTGCTCTCTGG + Intergenic
1166054889 19:40282525-40282547 CAGGGCAGCCTGAGGCTCAGGGG + Intronic
928327996 2:30335237-30335259 TGGGGCAGCAGGATGCTCAGTGG + Intergenic
935230339 2:101090392-101090414 CTGGCCAGCCCCATGCTCACAGG - Intronic
946366159 2:219250415-219250437 CAGGGCAGCCATATCCTCACGGG + Exonic
947854604 2:233314597-233314619 CCGGTCAGCCCGCTGCTCACAGG + Intronic
1172936089 20:38621435-38621457 CTGAGGAGCTGGATGCTCACAGG - Intronic
1173340459 20:42148499-42148521 CCTGGCATCCAGATGGTCACTGG - Intronic
1175898769 20:62351816-62351838 CCTGGCCGCCTGGTGCTCACGGG - Intronic
1180614700 22:17119936-17119958 CCGCGCGGCCGGATGCTTCCTGG - Exonic
1183474368 22:38027715-38027737 ACAGGGAGCCGGCTGCTCACAGG - Intronic
1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG + Exonic
1184241500 22:43213313-43213335 CCAGGCTGCCGGCTGCTCTCTGG - Intronic
1185284982 22:49996093-49996115 CAGGGCAGCCTGCTGCCCACAGG - Exonic
951909166 3:27731238-27731260 CGGGACAGCCGGCTGCTGACCGG - Intergenic
954573657 3:51662855-51662877 CCGTGCAGCCGTATGAACACGGG + Exonic
956733683 3:72219307-72219329 CAATGCAGCCGGATGCTCAGGGG + Intergenic
958141910 3:89572009-89572031 CCGGGCATCCCTATGCTCTCAGG - Intergenic
961009058 3:123424010-123424032 CCTGGCACCGGGATGCTCAAAGG - Intronic
966745498 3:183271663-183271685 ACGGGCAGCTGGTTGCTCATAGG + Exonic
967347752 3:188477247-188477269 CCTGGGAGCCAGATGCTCAGAGG + Intronic
968741802 4:2334918-2334940 CCTGCCAGGCGGATGGTCACGGG - Intronic
969680217 4:8639301-8639323 CTGGCCACCCTGATGCTCACCGG + Intergenic
985882424 5:2648812-2648834 CCGGGCAGTGGGAGGCTCAAGGG - Intergenic
986106162 5:4661506-4661528 CCGGGCTGCCGGATGCTGCTGGG + Intergenic
997589152 5:135062396-135062418 CCGGGCAGCCAGATGCTCCAAGG - Intronic
999710324 5:154312796-154312818 CCTGGCAGCTGGCAGCTCACTGG + Intronic
1006386407 6:33733477-33733499 CCGGGCAGCCGCAGGCTAAGTGG - Intronic
1007929517 6:45677776-45677798 ACCCGCAGCTGGATGCTCACTGG - Intergenic
1008545239 6:52577464-52577486 CCGGGCAGCCGGATGCTCCCGGG + Intergenic
1012475152 6:99608809-99608831 CCGGGCAGCCAGAAACTCCCAGG + Exonic
1012625447 6:101399433-101399455 CCAGGCAGCCGGATGTAAACAGG + Intronic
1017819541 6:158039404-158039426 CCACGCAGCCCGATCCTCACGGG - Intronic
1020233744 7:6339807-6339829 CCGGTCCCCTGGATGCTCACAGG + Intronic
1022260037 7:28695347-28695369 CCTGGCACCAGGAAGCTCACTGG - Intronic
1024253187 7:47521534-47521556 CCAGCCATCCGGATGTTCACTGG - Intronic
1035291941 7:157844856-157844878 ACGAGCACCCGGAGGCTCACAGG - Intronic
1042291676 8:67175539-67175561 ACTGGCAGCCCCATGCTCACAGG + Intronic
1049780357 8:144425971-144425993 CAGGGCAGCCAGATGCGCATGGG + Intronic
1055815346 9:80198789-80198811 AAGAGCAGGCGGATGCTCACAGG - Intergenic
1057804158 9:98208814-98208836 GCGGGCAGCAGGGTGCTCGCGGG + Exonic
1058652450 9:107189297-107189319 AAGGGCAGCTGGATCCTCACTGG + Intergenic
1060123062 9:121013979-121014001 CCGTGCAGCTCGCTGCTCACAGG + Exonic
1061667605 9:132169472-132169494 CCGGGCAGTAGGATGCTCTGAGG + Intronic
1062378911 9:136277389-136277411 CAGGGCAGGTGGGTGCTCACAGG + Intergenic
1190641272 X:52483781-52483803 CCGGGCAGCAGGACACTCTCTGG + Intergenic
1190646400 X:52529084-52529106 CCGGGCAGCAGGACACTCTCTGG - Intergenic
1200017727 X:153179229-153179251 CCGGGCACCCGGATGTTTCCTGG - Intergenic
1200256291 X:154584922-154584944 GCGGACAGCCGGCTGCTCAGGGG + Intergenic
1200261478 X:154619481-154619503 GCGGACAGCCGGCTGCTCAGGGG - Intergenic
1200267461 X:154653778-154653800 GCGGACAGCCGGCTGCTCAGGGG - Intergenic