ID: 1162068234

View in Genome Browser
Species Human (GRCh38)
Location 19:8138363-8138385
Sequence CTGTGGGTGAGGAGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 958
Summary {0: 1, 1: 0, 2: 11, 3: 100, 4: 846}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162068234_1162068246 16 Left 1162068234 19:8138363-8138385 CCCTGTCCCCTCCTCACCCACAG 0: 1
1: 0
2: 11
3: 100
4: 846
Right 1162068246 19:8138402-8138424 TCTTACTCACTGGAGCCCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 90
1162068234_1162068247 19 Left 1162068234 19:8138363-8138385 CCCTGTCCCCTCCTCACCCACAG 0: 1
1: 0
2: 11
3: 100
4: 846
Right 1162068247 19:8138405-8138427 TACTCACTGGAGCCCCGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 127
1162068234_1162068245 6 Left 1162068234 19:8138363-8138385 CCCTGTCCCCTCCTCACCCACAG 0: 1
1: 0
2: 11
3: 100
4: 846
Right 1162068245 19:8138392-8138414 AGGCTGCAGCTCTTACTCACTGG 0: 1
1: 0
2: 3
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162068234 Original CRISPR CTGTGGGTGAGGAGGGGACA GGG (reversed) Intronic
900120498 1:1046730-1046752 CTGGGGGTGAGCAGGGATCAAGG + Exonic
900212351 1:1462345-1462367 CTGTGGGTGCTGAGTGGACAGGG + Intronic
900252906 1:1680677-1680699 CTGGGGGTGAGGACGGTTCATGG - Intronic
900277174 1:1838320-1838342 GTCTGGGTGAGGAGGGTACATGG - Intronic
900388141 1:2419957-2419979 CTGGGGGTGGGGGGGGGACTTGG - Intergenic
900397282 1:2458250-2458272 GTGAGGCTGAGGATGGGACAAGG + Intronic
900561114 1:3307274-3307296 CTGCTGGTGGGGAGGTGACATGG - Intronic
901234721 1:7661670-7661692 CCGTGGGTGCAGAGGGGACCTGG - Intronic
901337545 1:8464297-8464319 CTGTGGGTGAGGGTGGGCAAGGG - Intronic
901465190 1:9416901-9416923 CTGTGGCTGAGGGAGGCACAGGG - Intergenic
901635733 1:10669328-10669350 GCGAGGGTGAGGAGGGGACGGGG - Intronic
901644508 1:10709306-10709328 CTGTGCGTGAGGATGGGGCTGGG - Intronic
901656745 1:10773765-10773787 GTGTGTGTGAGCTGGGGACAGGG - Intronic
901664807 1:10820088-10820110 CTCAGGGTGAGGAGGAAACAAGG + Intergenic
901671057 1:10856628-10856650 CCCTGGGTGAGGACGGGGCAAGG - Intergenic
901949492 1:12730762-12730784 CTGTCGGGGAGTGGGGGACAAGG - Intergenic
902255422 1:15186070-15186092 CTGAGTGGGAGGAGGGGGCAGGG - Intronic
902402924 1:16167779-16167801 ATGGGGGTGAGGCTGGGACAGGG - Intergenic
902414590 1:16231399-16231421 CTGTGGGGGAGGCTGGGACATGG - Intergenic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902618313 1:17635855-17635877 CTGTGGGTGAGAAAGGCACTGGG + Intronic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903603144 1:24556425-24556447 GCTTGGGTGGGGAGGGGACAAGG - Intronic
903695187 1:25201192-25201214 CTGTGGGTGAAGGGTGAACATGG - Intergenic
903742385 1:25565762-25565784 CTGTGGCTGAGGAGAGGCCTGGG + Intronic
903758839 1:25683795-25683817 TGCTGGGTGAGCAGGGGACAGGG - Intronic
903849036 1:26295366-26295388 GTGTGGGTGAGGAGAGGACGGGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904369363 1:30038712-30038734 GAGTGGGAGAGAAGGGGACATGG - Intergenic
904613518 1:31737814-31737836 CTATGGTAGATGAGGGGACAGGG - Intronic
904663196 1:32100395-32100417 TTGTGGGTGAGCTGGGGATAAGG + Intronic
904823466 1:33259405-33259427 GTGTGGGTAAGGTGGGGACCGGG + Intronic
905244331 1:36602315-36602337 CTGTGGTGGGGGTGGGGACAGGG - Intergenic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905776186 1:40668824-40668846 CTGGCGGGCAGGAGGGGACAGGG - Intergenic
906290702 1:44617672-44617694 CTGATGGTGAGGAGTGGAGAGGG - Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
907651886 1:56303043-56303065 CTGTAGGCAATGAGGGGACACGG - Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909596710 1:77413864-77413886 CTCTGGGTGAGAAGGGGAAGTGG - Intronic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909939706 1:81596851-81596873 TTTTGGGTGATGAGTGGACACGG + Intronic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
911475525 1:98367683-98367705 CAGTGGGGGAGGAGTGGCCAGGG - Intergenic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912697557 1:111852887-111852909 CTGTGGGAGAGCAGGGGTCGGGG - Intronic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
912866545 1:113262856-113262878 CTGTGGCTGAAGAGGGGGAAAGG + Intergenic
912869657 1:113292345-113292367 CGGAGGGGGAGGAGGGGAAAAGG + Intergenic
915120954 1:153629279-153629301 CTGTGGCTGATGAGGGGATAAGG - Intronic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915433378 1:155884346-155884368 CAGTGGGTGCTGAGGTGACAGGG + Exonic
915460944 1:156070329-156070351 CTGGGGCTGAAGTGGGGACAAGG - Exonic
915526822 1:156481100-156481122 CTGTCAGTGGGGAGGGGCCAGGG - Intronic
915890866 1:159772637-159772659 CTGTGTGTAAGGGTGGGACATGG - Intergenic
916198229 1:162245039-162245061 ATGTAGAGGAGGAGGGGACAAGG + Intronic
916691769 1:167196700-167196722 ATGTGGATGATGAGAGGACAGGG + Intergenic
917133457 1:171765011-171765033 CAGAGGCTGAGGAGGGGAAAGGG + Intergenic
917956213 1:180101669-180101691 ATGTGTGTGTGGAGGGGGCAGGG - Intronic
918739153 1:188104794-188104816 CAGTGGGTAAGGGGAGGACAGGG + Intergenic
918740891 1:188128871-188128893 CTGTGGGAGAGCAGGCGGCAAGG - Intergenic
919786275 1:201260290-201260312 GTGTGGCTGAGGACGGGAAAGGG + Intergenic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
920771717 1:208892787-208892809 CTGGGGGTGGGGAAGAGACAGGG - Intergenic
921133655 1:212241198-212241220 CTGAAGAAGAGGAGGGGACATGG - Intergenic
921194991 1:212747189-212747211 CTGTGGGAGAGGACTGCACAAGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922562618 1:226580158-226580180 CTGTGTGGGAGGAGGAGCCATGG + Intronic
922565182 1:226597008-226597030 CTGGGGGTGGGGAGTGGCCAGGG + Intronic
922808396 1:228402233-228402255 TTGTCTTTGAGGAGGGGACAGGG - Intronic
922934230 1:229411357-229411379 GAGGGGGGGAGGAGGGGACAGGG - Intergenic
923048028 1:230369622-230369644 CTGTGTGTGTGCTGGGGACAGGG + Intronic
923094127 1:230761256-230761278 CTGTGGCTGAGGAGTGGAAGAGG - Intronic
923269897 1:232346322-232346344 ATGTGGCTGAGGTTGGGACATGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924010662 1:239661895-239661917 CTGTGTGTGAGAAGGGGGAAAGG + Intronic
1062822871 10:548124-548146 CTGGGGCAGAGGTGGGGACAGGG - Intronic
1063045861 10:2392241-2392263 CACTGGGTGAGGAGGGGACGGGG + Intergenic
1063219586 10:3954365-3954387 CTGTTGGTGGGTAGGGGGCAGGG + Intergenic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063955884 10:11266575-11266597 CTGTGGGAAACAAGGGGACAGGG - Intronic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064112099 10:12548469-12548491 TGCTGGGGGAGGAGGGGACAAGG + Intronic
1064194367 10:13233461-13233483 CTGTGGGAGAGGAGGAGCCGGGG + Intronic
1064777117 10:18791124-18791146 ATGTGGGAGAGGGAGGGACAAGG + Intergenic
1064876554 10:20001467-20001489 GTGTGCGTGTGGAGGGGGCAAGG + Intronic
1064891734 10:20182843-20182865 CTGTCAGGGAGTAGGGGACAAGG - Intronic
1065759287 10:28966896-28966918 TTGGGAGGGAGGAGGGGACAGGG - Intergenic
1065965420 10:30766630-30766652 CTGGCGCTGGGGAGGGGACAGGG - Intergenic
1066219006 10:33317234-33317256 ATGAGGGTGAGGTGGGGATAAGG + Intronic
1067013464 10:42736944-42736966 CTGTGGTAGAAGAGAGGACATGG + Intergenic
1067105131 10:43361459-43361481 CTGGGGGGGCGGGGGGGACAGGG + Intergenic
1067685588 10:48464608-48464630 GTGGGGCTGAGGTGGGGACACGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1069761780 10:70816180-70816202 CGCGGGGTGAGGAGAGGACAGGG + Intronic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1070286654 10:75088228-75088250 GTGTGAGTGAGGAAGCGACAGGG - Intergenic
1070313340 10:75289237-75289259 CTGGGGGAGAGGAAGGGCCAGGG + Intergenic
1070729146 10:78813413-78813435 AGGTAGGTGGGGAGGGGACAGGG - Intergenic
1070839826 10:79476823-79476845 CTGAAGGTGATGAGGGGAAAAGG + Intergenic
1071053555 10:81480780-81480802 CTGTGGGTGAAGGTGGGTCAAGG + Intergenic
1071102675 10:82057623-82057645 GTTTGGGTGGGGAGTGGACAAGG + Intronic
1071380949 10:85058988-85059010 CTGTTGTTGAGTAGGGGAGAAGG + Intergenic
1071945235 10:90636266-90636288 CTGGGGGTGAGGAGCTGAAAAGG + Intergenic
1072526152 10:96273270-96273292 CTATGGGAGAGGAGGAGGCAGGG - Intergenic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1073400040 10:103249938-103249960 CAGTGGGTGGGAAGGGGGCATGG + Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074188179 10:111114702-111114724 CTATGGGTGTGATGGGGACAGGG + Intergenic
1074447895 10:113535251-113535273 CTGTTGGTGAGTGAGGGACAAGG - Intergenic
1074713004 10:116193003-116193025 CTGTGTGTGTGGAGGGGCCTGGG - Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1075063639 10:119274178-119274200 ATGCCGCTGAGGAGGGGACATGG + Intronic
1075777704 10:124998973-124998995 CTCTGGCTGAGGAGGGTAAATGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076587740 10:131560849-131560871 CTGTGGGGGAGCGGGGGACAGGG + Intergenic
1076699805 10:132265503-132265525 CTGGGTGTGAGGAGAGGACACGG + Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076783542 10:132737608-132737630 CTGTGGCTGAGGAGCTGGCAGGG - Intronic
1077216055 11:1395588-1395610 CAGTGGGTGGGGACAGGACAAGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077560964 11:3260722-3260744 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077566861 11:3306552-3306574 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078142872 11:8704263-8704285 ATGTGGGTGGGGAGAGGTCAGGG + Intronic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1078452228 11:11448999-11449021 CTGTTTGTGAGGAAGGGAAAGGG - Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078930388 11:15907919-15907941 CTCTGGGTGAGGAGAAGCCATGG + Intergenic
1079075845 11:17385101-17385123 CAGTGGGTGAGATGGAGACAAGG + Intergenic
1079100427 11:17538266-17538288 GTGGGAGGGAGGAGGGGACAGGG + Intronic
1079943331 11:26710013-26710035 CTGTGGGTGGGTAGGGGGCTAGG - Intronic
1080208006 11:29753554-29753576 GTGTTGGTGATGAGGGGATAGGG - Intergenic
1080569621 11:33544046-33544068 CTGTAGCTGAGGATGAGACACGG - Exonic
1081577509 11:44328363-44328385 CTGGGGGAGAGGAGGGGAAGGGG - Intergenic
1081630795 11:44688332-44688354 ATGTGGGTGAGGAAGAGAGAGGG - Intergenic
1081692494 11:45087871-45087893 GTGGGGGTGGGCAGGGGACAAGG + Intergenic
1081962779 11:47150638-47150660 CGGTAGGTGAGGAGGAGGCATGG + Intronic
1081984692 11:47293050-47293072 TTGTGGGTGGGTGGGGGACAAGG + Intronic
1082101562 11:48177043-48177065 CTGGGGTTGTGGATGGGACATGG + Intergenic
1083171562 11:60926582-60926604 CTGGGGGTGGGGTGGGGACCAGG - Intronic
1084009354 11:66338995-66339017 GTGAGGGTGAGCAAGGGACAGGG - Intronic
1084124790 11:67092197-67092219 CTGTCGGGGAGTGGGGGACAAGG - Intergenic
1084171044 11:67401296-67401318 CTGTGGGCAAGGAGGGGCCGAGG - Intronic
1084177866 11:67432902-67432924 CTGTGGGTGGGGTGGGGCCCTGG + Intronic
1084370742 11:68741159-68741181 CTGGTGGGGAGGAGGGGTCAAGG - Intronic
1084394302 11:68898746-68898768 CTGAGGGTGGGGAGGGGAAGTGG - Intronic
1084403084 11:68956138-68956160 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084403101 11:68956168-68956190 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084538608 11:69773631-69773653 CACAGGGTGAGAAGGGGACATGG + Intronic
1084574175 11:69977950-69977972 CTGTGGCTGAGAGGGGGTCAAGG + Intergenic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084678182 11:70649114-70649136 ATATGGGTGAGAAGGGGAGATGG - Intronic
1084912729 11:72404218-72404240 ATGAGGGTGAGGAGAAGACATGG + Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085666432 11:78418464-78418486 GTGTGGGGGAGGAGGGGTCCCGG + Intergenic
1085879716 11:80451955-80451977 CTTTGGCTGAGCAGGAGACAAGG - Intergenic
1085899685 11:80684056-80684078 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1085987224 11:81801627-81801649 ATGAGGCTTAGGAGGGGACAGGG + Intergenic
1086739688 11:90352188-90352210 CTGATGGGGATGAGGGGACATGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1086942669 11:92814703-92814725 CTGTTGGAGTGTAGGGGACAAGG + Intronic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087318877 11:96636023-96636045 TTCTGGGTCAGGAGGGGACTTGG + Intergenic
1087428331 11:98018343-98018365 CTGTTGGGGAGTAGGGCACAAGG + Intergenic
1088339251 11:108744589-108744611 TTGAGGGTTAAGAGGGGACATGG - Intronic
1088426675 11:109712471-109712493 CTGTTGGGGAGTAGGGGACAGGG + Intergenic
1088736449 11:112731810-112731832 ATGTGGGACAGAAGGGGACATGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089151183 11:116365657-116365679 CTCAGGGTGAGGATGGGAGAGGG - Intergenic
1089298602 11:117484268-117484290 CCGTGGGTGAGGAGGCGTCTGGG + Intronic
1089479429 11:118792230-118792252 CTGGGGGTGAGGCGGGGGCAGGG + Intergenic
1089589612 11:119531997-119532019 CTGTGGGTGTGCAATGGACAAGG - Intergenic
1089614066 11:119685361-119685383 GCGTGGGAGAGGAGGGGGCACGG + Intronic
1089698900 11:120232342-120232364 CTCTGGTGGATGAGGGGACAAGG + Intergenic
1089706372 11:120280921-120280943 CTGTGCGTGAGAAGGGTCCAGGG + Intronic
1089771795 11:120808509-120808531 CTGTTGGTGAGGAGAGGCGATGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090039903 11:123281611-123281633 CTGTCGGGGGGTAGGGGACAAGG + Intergenic
1090096401 11:123746002-123746024 CTGGGGGTGAGGTTGGGAGATGG + Intergenic
1090260307 11:125314563-125314585 CAGTCAGTGGGGAGGGGACAAGG + Intronic
1090920592 11:131203232-131203254 CTGTGGGTGAGGGTGGTGCAGGG - Intergenic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1091395585 12:152439-152461 GTGAGGGAGAGGAGGGCACAGGG + Intronic
1091403703 12:196262-196284 CTGTGGGCCAGGAGGGGAACTGG + Intronic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1092090873 12:5802753-5802775 CAGTTGGTGAAGAGAGGACATGG - Intronic
1092128155 12:6089808-6089830 CAGTGGGTGAGGTGGGGTCAGGG - Intronic
1093244192 12:16715155-16715177 GTGTGGGAGAGGAGTGGAGAGGG + Intergenic
1093484863 12:19641677-19641699 CTGTGGGGGAGGAAGGGAAATGG - Intronic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1096232098 12:49902518-49902540 CTGTGCGTGAGCTGGGGACAAGG + Intronic
1096883654 12:54694894-54694916 CTGTTGGGGGGTAGGGGACAAGG + Intergenic
1097169585 12:57105340-57105362 CTGGGAGTGAGGAGGACACAAGG + Intronic
1097177065 12:57149407-57149429 CAGCGGGGGAGGAGAGGACAGGG - Intronic
1097182976 12:57181335-57181357 CTGTAGGGTAGGAGGGGTCAGGG - Intronic
1097655920 12:62363386-62363408 GTGAGGGTGAGGATGGAACAAGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098086797 12:66854212-66854234 GCGAGGGTGAGGAGGAGACAGGG + Intergenic
1098358846 12:69635696-69635718 GTGAGGCTGAGGAGGGGACCAGG + Intergenic
1099922675 12:88978584-88978606 CACTGGGTGAGGTGGGGACAGGG + Intergenic
1100671197 12:96814702-96814724 CTGTTGGTGGGTTGGGGACAAGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101903692 12:108810072-108810094 CTGTGGGACAGGAGGTGGCAGGG - Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102151514 12:110691583-110691605 CTCTGGTTGAGGAAGGGAAAAGG + Intronic
1102492453 12:113297462-113297484 CTGTGGCTGGGAAGAGGACAAGG - Exonic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103185620 12:118954656-118954678 GAGAGGATGAGGAGGGGACAAGG + Intergenic
1103602089 12:122060637-122060659 CTGGGGGTGGGGTGGGGTCATGG + Exonic
1103943919 12:124516031-124516053 CTGGGGGTGACAAGGGGACATGG + Intronic
1103958691 12:124593907-124593929 TTTTGGATGAGGAGGGAACATGG + Intergenic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104515155 12:129418554-129418576 CTGTTGGTGGGTGGGGGACAAGG + Intronic
1104837970 12:131804159-131804181 CTGTGAGTGAGAAGGGGGCTAGG + Intergenic
1104973640 12:132542456-132542478 CTGCTGGTGAGGAGGGGTCAGGG + Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105223707 13:18408378-18408400 CTCAGGTTGAGGAGGGGCCAGGG + Intergenic
1105580740 13:21693380-21693402 ATGGGGGTGCTGAGGGGACATGG + Intronic
1106075488 13:26457352-26457374 AAGTGGGAGAGGAGGGGACAAGG - Intergenic
1106140178 13:27005429-27005451 CTGTTTGTGAGGTGGGGACCTGG - Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106817486 13:33424714-33424736 CTGTGGGTAATGAGGAGCCATGG + Intergenic
1106882590 13:34148253-34148275 CTGTGGGAGAGGGTGGCACATGG - Intergenic
1107591602 13:41913281-41913303 CTGGGGGTAAGGAGTGGCCATGG + Intronic
1108270128 13:48751265-48751287 CTGAGGGTGAAGAGAGCACATGG - Intergenic
1108595142 13:51943031-51943053 CCCTGGAGGAGGAGGGGACAAGG + Intronic
1110258428 13:73457980-73458002 CTGTTGGGGAGTAGGGGGCAAGG - Intergenic
1110278012 13:73661280-73661302 TTGTGGGGCAGGAGGGGACGTGG - Intergenic
1110294935 13:73853405-73853427 GAGTGAGTGAGGAGGAGACAGGG + Intronic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1111234631 13:85392654-85392676 TTGTGGGGGAGAAGGAGACAGGG + Intergenic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113992015 14:16035396-16035418 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1114276364 14:21149081-21149103 CTGTGGGTCAGGAGGCTGCAAGG + Intergenic
1114664967 14:24372354-24372376 CTGTGAGGGAGGAGGGGGTATGG - Intronic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115475073 14:33805714-33805736 CTGGGGCTGAGGAGGTGGCAGGG - Intergenic
1116601764 14:46934858-46934880 CAGTGGGTGAGGAAAGCACAAGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1119328817 14:73778665-73778687 GGGAGGCTGAGGAGGGGACATGG + Intronic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1119748179 14:77059239-77059261 GAGTGTGGGAGGAGGGGACAGGG - Intergenic
1119851695 14:77870948-77870970 CTCTGGGTCACGAGGAGACAGGG - Intronic
1121120912 14:91375472-91375494 ATGTGGGTGAGGTGGGGAAGAGG + Intronic
1121310560 14:92933158-92933180 CTGGGGGCCAGGAGGGGACACGG - Intronic
1121323188 14:93004773-93004795 GTGTGGGTGCGGGGGGCACAGGG + Intronic
1121438828 14:93936111-93936133 CTGCTGGTGAGCAGAGGACACGG + Intronic
1121445167 14:93974042-93974064 CTGCAGGTGAGGAGGGGCTATGG - Intronic
1121504012 14:94462420-94462442 CTGAGAGTGAGGATAGGACAAGG - Intergenic
1121696062 14:95913314-95913336 CTGTCGGGGAGTGGGGGACAAGG - Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1122117599 14:99535579-99535601 CTGTGGGTGAGGTCGGGCCCAGG + Intronic
1122138305 14:99647099-99647121 CGGTGGTTGAGGTGGGGACATGG + Intronic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122195516 14:100082164-100082186 ATGCGGGGGAGGGGGGGACAGGG - Intronic
1122270197 14:100565536-100565558 GTGTGGGAGAGGAGGGGGCCAGG + Intronic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122679933 14:103451895-103451917 CTGCGGGAGAGGAGAGGACACGG - Intronic
1122773781 14:104108375-104108397 CTGTGAGTCAGGAGGAGACGAGG - Intronic
1122785974 14:104163437-104163459 CTTTGGGCGACGAGGGCACAAGG + Intronic
1122885361 14:104708151-104708173 CTGTGGTTGAGGTGGGGACGGGG + Intronic
1122892959 14:104741540-104741562 GTGGGGGTGAGGACGGGATATGG - Intronic
1122903949 14:104793419-104793441 CTGTGGTTTAGGAGGGGCCTGGG - Exonic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123162797 14:106295812-106295834 CTGTGGCTGAGGAGATTACAGGG - Intergenic
1123648901 15:22463325-22463347 CAGTGGATGTGGAAGGGACAGGG - Intronic
1123729435 15:23132360-23132382 CAGTGGATGTGGAAGGGACAGGG + Intronic
1123747603 15:23329842-23329864 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124279965 15:28353693-28353715 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124302734 15:28557918-28557940 CAGTGGATGTGGAAGGGACAGGG - Intergenic
1124723945 15:32138430-32138452 GTGGGGGTTGGGAGGGGACATGG - Intronic
1125060210 15:35410965-35410987 TTCTAGGTGAGGAGGGGCCAAGG - Intronic
1125249478 15:37683106-37683128 CTGTCTTTGAGGAGGTGACATGG + Intergenic
1126143354 15:45455175-45455197 CTGGGGGTGGGGAGGAGGCAGGG - Intergenic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1127254816 15:57280715-57280737 TTGGGGGTGGGGTGGGGACATGG + Intronic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1127335459 15:57979502-57979524 CTGTGGAGGAGAAGGGGTCAAGG - Intronic
1127485346 15:59413174-59413196 CTGTGGGAGATGGGGGAACATGG + Intronic
1127551688 15:60044782-60044804 TTGTGGGTGAGGAGAGGAGGTGG - Intronic
1128072832 15:64807989-64808011 CTGCGGGGGAGGAGTGGAGATGG + Intergenic
1128217413 15:65944142-65944164 CTGGGGGTTAGGAGGTGGCAGGG + Intronic
1128262293 15:66240972-66240994 CTTTGGCTGGGGAGGGGCCACGG - Intronic
1128578420 15:68791745-68791767 CAGAGGGGAAGGAGGGGACAGGG + Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129205975 15:74037197-74037219 CTGAGGGTGAGGCTGGGACAAGG - Intronic
1129245682 15:74277403-74277425 CGGTGGGCGTGGAGGGGCCATGG + Intronic
1129674244 15:77623684-77623706 CTGAGGAGGAGGAGGGGAAAGGG - Intronic
1129785853 15:78309580-78309602 CTATGTGTGGAGAGGGGACAGGG + Intergenic
1129821156 15:78602835-78602857 ATGGGGGTGGGGAGGGTACAGGG - Intronic
1130257320 15:82331867-82331889 CTAGGGCTGGGGAGGGGACAGGG - Intergenic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130550724 15:84888663-84888685 CCCTGGCTGAGGAGGGGACTGGG - Intronic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130937967 15:88486147-88486169 CTATGGGTGATGAGGGGTGATGG + Intergenic
1131058649 15:89391145-89391167 GTGGGGGTGGGCAGGGGACAGGG + Intergenic
1131078038 15:89510685-89510707 TTGGGGGTGAGGAAGGGAGAGGG + Intergenic
1131091032 15:89625183-89625205 CTGTGGGAGAGGCGGGGGCAGGG - Exonic
1131460441 15:92614053-92614075 CTGTGGCTGAGACGTGGACATGG - Intergenic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1132283232 15:100638838-100638860 CTGTGGGAGAGTGGGGGACAAGG - Intronic
1132503983 16:297687-297709 CTGTCAGTGAGGAGGGGGCTTGG - Intronic
1132573944 16:656279-656301 CTGTGGGTGGGGTGGGGTCAGGG - Intronic
1132582734 16:693046-693068 CTGTTGCTGAGGAGGGGGCTGGG - Exonic
1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738157 16:1397557-1397579 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738186 16:1397644-1397666 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738215 16:1397731-1397753 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738244 16:1397818-1397840 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132825656 16:1904057-1904079 CCGTGGGTGAGTTGGGGGCATGG - Intergenic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133235543 16:4385787-4385809 GTGAGGATGAGGAGGGGACGGGG + Intronic
1133741658 16:8656377-8656399 CTGTGGGGGAAGTGGGGAAAAGG - Intergenic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134070422 16:11256606-11256628 CTGCAGGGGAGGAGAGGACAGGG - Intronic
1134903794 16:17961901-17961923 TTGTGGGTTAGGTGGGGACTTGG + Intergenic
1135627928 16:24012418-24012440 CTCTCAGTGAGGATGGGACATGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136187544 16:28597017-28597039 CTGCGGGCGAGGAGGGCACAAGG - Intronic
1136190017 16:28609951-28609973 CTGCGGGCGAGGAGGGCACGAGG - Exonic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136416639 16:30108265-30108287 CTGGGGGTGGGGTGGGGACGTGG + Intronic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136561090 16:31039700-31039722 CTGTGGGAGAGGAGGGGGTCAGG - Intronic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1137579176 16:49622944-49622966 CTGTGGGTGACGGGAGTACAGGG - Intronic
1137671838 16:50283795-50283817 GTGTGGGTGAGGGAGTGACAGGG + Intronic
1137687029 16:50393389-50393411 CTGGGGGTAAGAGGGGGACAAGG - Intergenic
1138214766 16:55193934-55193956 GTGTGTGTGGGCAGGGGACAGGG - Intergenic
1139332623 16:66205325-66205347 CTGTGAGTTCGGATGGGACAAGG + Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139675366 16:68519701-68519723 CTGGGGGTGGGGTGTGGACAGGG + Intergenic
1139696794 16:68680816-68680838 CAGTGGGTGAGGGGTGGTCAAGG + Intronic
1141137712 16:81477506-81477528 CAGTGGGAAAGGAGGGGACCTGG - Intronic
1141552561 16:84815926-84815948 TTGTTGGAGAGGAGGGGGCAAGG - Intergenic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141645832 16:85367060-85367082 CAGTGGGTGAGCAGAGGCCACGG - Intergenic
1141984288 16:87570145-87570167 CTGGGGGGCGGGAGGGGACAAGG + Intergenic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1142133482 16:88441382-88441404 GTGGGAGAGAGGAGGGGACAAGG - Intergenic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1142894281 17:2964183-2964205 CTGTGGGAGAGGAGCTGCCAGGG + Intronic
1143084537 17:4405918-4405940 CAGTGGTTCAGGAAGGGACACGG - Intergenic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143280658 17:5751946-5751968 CAGTGGGAGAGGCAGGGACAAGG + Intergenic
1143685773 17:8514516-8514538 GTGGGGCTGAGGAGGTGACAGGG - Intronic
1144145053 17:12389294-12389316 CTGTGAGGGAGCAGGGAACAGGG + Intergenic
1144701654 17:17344517-17344539 CTGGGTGTGAAGAGGGGACAGGG + Intronic
1144733124 17:17540133-17540155 CCGTGGGTGGGGATGGGGCAGGG + Intronic
1144839746 17:18178625-18178647 CCCTGGGGGAGGTGGGGACAAGG + Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145004924 17:19332396-19332418 CTGGGGGTGAGGAAGAGCCAGGG + Intronic
1145104120 17:20100812-20100834 CTGTTGGTGGGTAGGGGGCAAGG - Intronic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145278763 17:21453623-21453645 ATGTGGGCTGGGAGGGGACACGG - Intergenic
1145409222 17:22641742-22641764 TTTTGGAGGAGGAGGGGACAGGG + Intergenic
1146149778 17:30457632-30457654 GTGTTGGTGAGGAGAGGATATGG - Intronic
1146642051 17:34549006-34549028 CTCTGGGGGAGGAGGGGCCGAGG - Intergenic
1146668284 17:34719578-34719600 CTGCGAGCGGGGAGGGGACAGGG - Intergenic
1146671827 17:34743133-34743155 CTGTGGGTTAGGAGGGGTGGAGG - Intergenic
1146947686 17:36884946-36884968 CTGAGGGTGAGGAGGGGCCCGGG - Intergenic
1147047406 17:37763719-37763741 CTGTCGGTGGGTAGGGGGCAAGG - Intergenic
1147357065 17:39906469-39906491 CTGGGGGTGAGCTGGGGAGATGG - Intronic
1148025962 17:44587808-44587830 CCGTGGGTCAGCAGAGGACAGGG - Intergenic
1148140009 17:45321615-45321637 CTGTAGAAGAGGAGGGGCCATGG + Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148458141 17:47821846-47821868 CTTGGCGGGAGGAGGGGACAGGG - Intergenic
1148746346 17:49920365-49920387 GCCTGGGTGAGGATGGGACAGGG - Intergenic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148848214 17:50541328-50541350 CTGTGGGTGAGCAGGGCAAGGGG + Exonic
1149168787 17:53784764-53784786 CTGTCGGTGGGTAGGGGGCAGGG + Intergenic
1149414371 17:56443517-56443539 CTGCGGGTGAGGAAGGGAAGAGG - Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150219923 17:63490388-63490410 CAGGTGGTGCGGAGGGGACATGG + Intronic
1150247764 17:63689135-63689157 CTGTGGGGCAGAAGAGGACATGG - Intronic
1150279157 17:63918869-63918891 CAGTGGGAGAGAAGGGGCCAGGG - Intergenic
1150291217 17:63983456-63983478 CTGTGGGTGGGGACGGGAAGGGG + Intergenic
1150494698 17:65598244-65598266 CTGTTGGTCAGGAGAGGATAGGG + Intronic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150964996 17:69958225-69958247 CTGTGGGTGAGAAAGAAACATGG + Intergenic
1150984032 17:70175218-70175240 ATGTGGGTGAGAAGGGGCAACGG + Exonic
1151045180 17:70911588-70911610 CTGTGGATGAAGAGTGGTCATGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152380711 17:79941122-79941144 CGGGGGGTGAGGAGGGGCCGGGG + Intronic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1152593955 17:81229245-81229267 CTGGGGGTGGGGTGGGCACAGGG + Exonic
1152863511 17:82709356-82709378 CGGTGGGGGGGCAGGGGACAGGG - Intergenic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1153544470 18:6191983-6192005 AGGGGGGGGAGGAGGGGACAGGG - Intronic
1153833681 18:8945255-8945277 CTGAGGGAGAGGAAGGGACCAGG + Intergenic
1154029992 18:10745216-10745238 CTATGGGTGGGGAAGGGACCTGG - Intronic
1154171505 18:12056379-12056401 CTATGGGTGAGGTGGGGGCTAGG - Intergenic
1154430453 18:14304204-14304226 GTGTGGGTGAGGATGAAACATGG + Intergenic
1154529597 18:15330695-15330717 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1155428981 18:25735869-25735891 CGGAGGGTGAGGATGGGGCAGGG - Intergenic
1155763205 18:29591734-29591756 CTGTCGGGGAGTAGGGGAAAAGG + Intergenic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160381825 18:78463512-78463534 ATGTTGGTGAGGAGGTGAAATGG - Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160657937 19:282860-282882 CTGTGGGCGGGGCGGGGACAAGG - Intronic
1160896365 19:1403968-1403990 CAGGGGCTGGGGAGGGGACAGGG + Intergenic
1161028275 19:2046572-2046594 CCGAGGGGGAGGAGGGCACAGGG - Intronic
1161030146 19:2054238-2054260 CTGTGGGAGAGGACAGGACCTGG - Intergenic
1161064474 19:2230935-2230957 CTGTGGGTGTGCTGGGGCCAGGG + Exonic
1161142037 19:2653794-2653816 GGCTGAGTGAGGAGGGGACACGG - Intronic
1161236447 19:3200763-3200785 CTGGGGCTGGGGAGGGGACCAGG - Intronic
1161238823 19:3210730-3210752 GTGAGGGTGGGGAAGGGACAGGG + Intergenic
1161283520 19:3457793-3457815 ATGGGGGCGGGGAGGGGACATGG + Intronic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1161580368 19:5077496-5077518 CTGTGGGTGAAGTGGGTACCGGG + Intronic
1161719756 19:5896239-5896261 GGGAGGGTGGGGAGGGGACAGGG + Intronic
1161734633 19:5983950-5983972 CTGTGGGTGAGGAATGGGAAGGG - Intergenic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1161980465 19:7627655-7627677 TGGTGGGTGGGGCGGGGACAGGG - Intronic
1161981694 19:7633375-7633397 CTGGGGGTGGGGTGGGGGCAGGG + Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162148616 19:8629393-8629415 ATGTGGGAGAGGTGAGGACAGGG + Intergenic
1162511775 19:11123362-11123384 CTCTGGGTGAAGAGGGGCCTAGG - Intronic
1162520326 19:11175821-11175843 CTGAGGATGAGGAGAGGCCACGG + Intronic
1162566130 19:11446618-11446640 GTGTGGGGGAGGAGGGGAATAGG - Intronic
1162799067 19:13101151-13101173 CTGTGCCTGAGGCGGGCACATGG + Exonic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163188604 19:15658821-15658843 CTGTGTTTGAGGCGGGGACGGGG + Intronic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163640758 19:18460807-18460829 CTGTGGTGGAGGAAGAGACATGG - Intronic
1163732168 19:18955460-18955482 CTGGGTGAGAGGAAGGGACAGGG - Intergenic
1163754962 19:19101147-19101169 CTGTGGGGGAGCAGGGGACTTGG + Intronic
1164415713 19:28045125-28045147 CTGTGCCTCAGGAGGGGACCTGG - Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164912775 19:32026152-32026174 CTGTGGTCGAGGGGCGGACATGG - Intergenic
1165343310 19:35227547-35227569 CTGGGGGAGAGGAGGGGAAGGGG + Intronic
1165767087 19:38358363-38358385 CTGTGGGCCAGGAGGGGCCCAGG + Intronic
1165879501 19:39032254-39032276 CTGCGGGAGAGGAAGGGTCAAGG + Intronic
1166228870 19:41414026-41414048 CTGGGGGTGTAGAGGGGACCGGG - Intronic
1166248926 19:41552257-41552279 CTGTGATTGAGCAGGAGACAAGG - Intronic
1166688866 19:44811037-44811059 GTCTGAGGGAGGAGGGGACAGGG + Intronic
1166750277 19:45161216-45161238 CTGCTGGTGTGGGGGGGACAGGG + Intronic
1166762806 19:45235343-45235365 CTGTGACTGAGGAGGGGATCTGG + Intronic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1166960066 19:46491929-46491951 CTGTGGGTGGGGAGGGCCCCAGG - Exonic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167253507 19:48414188-48414210 CTAAGAGGGAGGAGGGGACAAGG + Intronic
1167267308 19:48489989-48490011 CTCTGGGAGAGCAGGGCACACGG - Intronic
1167354373 19:48994077-48994099 ATCTGGGGGAGAAGGGGACATGG + Intronic
1167423051 19:49415026-49415048 CTGTGGGTGTGGAGTGGATGGGG - Intronic
1167966942 19:53155771-53155793 CTGTGAGTGAGGCTGGTACATGG + Intronic
1168132731 19:54331673-54331695 CTGTGGGAGAGGAGACCACAGGG + Intergenic
1168135317 19:54347131-54347153 ACGTGGGTGAGGAGGGCTCAAGG + Intergenic
1168153331 19:54460548-54460570 GTGAGGGTGAGGGGGGCACAGGG + Intronic
925220030 2:2131621-2131643 GTGGGGGTGAGGTGGGGCCATGG + Intronic
925293989 2:2765918-2765940 GTATGGGGAAGGAGGGGACAGGG - Intergenic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
925917026 2:8614189-8614211 CTGTTGGCAAAGAGGGGACAAGG + Intergenic
925972948 2:9120263-9120285 ATGTGGGTGAAGGGTGGACAAGG - Intergenic
926324192 2:11770263-11770285 CTGTGGGTGGGGTGGGGCCTTGG + Intronic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
928265271 2:29805990-29806012 ATGTGAGTGAGGAGGTGAAATGG + Intronic
928703308 2:33921086-33921108 CTGAGAGTGAGGAGGAGAAAAGG - Intergenic
929438335 2:41946100-41946122 CTGGAGGGGAGGAGGAGACAGGG + Intronic
929533850 2:42768298-42768320 CTCAGGAGGAGGAGGGGACAAGG + Intronic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930376509 2:50573950-50573972 ATGTGGATGAGGAGGGGTCATGG + Intronic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
930683275 2:54280363-54280385 GTGTGGGTGGGAAGGGGGCATGG + Intronic
930724233 2:54667044-54667066 CTGTGGCTGCGGAGAGGACGAGG - Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
933580454 2:84120214-84120236 ATGGGGGTGAGGAGAGGAAAGGG + Intergenic
933720389 2:85393988-85394010 CTGGGGGTGAGGATGAGTCAGGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935005953 2:99077294-99077316 CTGAGGGTGAGGCAGGGGCATGG - Intronic
935050229 2:99518966-99518988 CTGGGGGTGAGGTGGGGAGTGGG - Intergenic
935328973 2:101962387-101962409 CGGAGGGCGAGGAGGGCACAGGG + Intergenic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
937061753 2:118985300-118985322 GTGTGGCTGGGGTGGGGACAGGG - Intronic
937856024 2:126672536-126672558 CTGCAGGTGCTGAGGGGACAGGG - Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
937988078 2:127647599-127647621 CTGGGGGTGGGAAGGGGCCAAGG - Intronic
938288173 2:130135888-130135910 CTGTGAGTGAGGACGGGCCTGGG + Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
938739844 2:134220701-134220723 AGGAGGGTGAGGAGGGGAGAAGG - Intronic
938901066 2:135798762-135798784 CAGTGGGTGAGGAGAGGATTTGG - Intronic
939146769 2:138425043-138425065 CTGGGGGTGAGGGGAGGGCAAGG + Intergenic
939176240 2:138751013-138751035 GTGGGGGTGGGGAGGGGACGTGG - Intronic
940373510 2:152927556-152927578 CTGTGGGTTAGATGGGTACAAGG + Intergenic
940877658 2:158914200-158914222 TTGTGGCTGAGAAGGGGAGAAGG + Intergenic
940890547 2:159031305-159031327 CTGTGGGGAAGGAAGGGCCATGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941070114 2:160945979-160946001 CTGTGGGTTTGGAAGAGACATGG + Intergenic
942888545 2:180959217-180959239 CTGTGTTTGAGATGGGGACATGG - Intergenic
943089575 2:183357959-183357981 GTGTGGATCAGAAGGGGACAGGG - Intergenic
943227062 2:185191323-185191345 CTGTCGGTGGGTGGGGGACAAGG - Intergenic
944482676 2:200174227-200174249 GTGTGGGGGAAGAGGGGACATGG - Intergenic
944770193 2:202906369-202906391 GGGTGGGGGAGGAGGGGACAGGG - Intronic
945574186 2:211509179-211509201 CTGTCGGGGAGTGGGGGACAAGG + Intronic
945769402 2:214021943-214021965 CTTTAGGTGATGAGGGGAAAAGG - Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946307085 2:218862126-218862148 GAGTGGGGGAGGAGGTGACACGG + Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946764066 2:223023822-223023844 CAGTGGTTGAGGAGGGGCAATGG + Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947517942 2:230823447-230823469 CCTTGGGTTAGGAGGGGACTTGG - Intergenic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
947722875 2:232380117-232380139 CTGTGCATGAGGAGGGGGCACGG + Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
947736373 2:232457497-232457519 CTATGCATGAGGAGGGGGCACGG + Intronic
947926384 2:233925831-233925853 CTTTGGGAGACGAGGGGAGAGGG + Intronic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948528366 2:238587424-238587446 CTGTGGGGGAGGGGGGACCAAGG + Intergenic
948687344 2:239677530-239677552 CTGTGTGTGTGCAGGGGCCAGGG - Intergenic
948753513 2:240145638-240145660 CTGGGAATGAGGAGGGGACGTGG + Intergenic
948786458 2:240355403-240355425 CTGAGGTTGAGGAAGGGACAGGG - Intergenic
948846904 2:240687610-240687632 CTGTGGGTGGGGGGTGCACACGG + Intergenic
948890062 2:240903239-240903261 CTGTGGGTCAGGACTGGGCAGGG + Intergenic
949025132 2:241764177-241764199 CTGTGGGAGGGGCGGGGACTGGG + Intronic
1168745568 20:236878-236900 TTTTGGTTGGGGAGGGGACAGGG - Intergenic
1168773100 20:428584-428606 CTGAAGGTGAGGCTGGGACAGGG + Exonic
1169029077 20:2394431-2394453 CCCTGGGTGGGGAGAGGACAGGG - Exonic
1169064714 20:2688464-2688486 CTGAAGGTGAGGAGGGGCCCGGG - Intergenic
1169073440 20:2748001-2748023 CTGTGTCTGAGGAGTGTACATGG + Intronic
1169209581 20:3758736-3758758 TTGGGGGTGACGAGGGGACAAGG - Intronic
1169430110 20:5528857-5528879 GTGTGGGAGAAGAGAGGACAAGG - Intergenic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171317086 20:24204827-24204849 CTGAGAGTGAGGTTGGGACAAGG - Intergenic
1171422249 20:25025051-25025073 CTATGGGCGAGGAAGGGAGATGG + Intronic
1171812560 20:29757023-29757045 CTGGGGGAGAAGAGGGGACAAGG + Intergenic
1171868639 20:30508767-30508789 CTGCGGGAGAAGCGGGGACAAGG + Intergenic
1171906681 20:30905264-30905286 CTGGGGGAGAAGAGGGGACAAGG - Intergenic
1172222053 20:33280780-33280802 GGGTGGGGGAGCAGGGGACAAGG - Intronic
1172811026 20:37648236-37648258 CTCTGTGTGAGCAGGGGGCAGGG + Intergenic
1172975960 20:38906114-38906136 CTGTGGGGGAGGCCGGCACAGGG + Intronic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174116907 20:48232479-48232501 CTTTTAGTGAGGAGGTGACATGG - Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1175940740 20:62536445-62536467 CTTTTGGTGAGGGGAGGACAGGG + Intergenic
1176169664 20:63691116-63691138 CTGTGGGTGAGGTGGGGTGGAGG - Intronic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176551347 21:8223836-8223858 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1176570256 21:8406835-8406857 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1176578165 21:8451022-8451044 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1177157393 21:17513167-17513189 TAGTGGGTGAGTAGGGGCCATGG + Exonic
1177518173 21:22181707-22181729 CTGTTGGTGAGAAGGCAACATGG - Intergenic
1178351395 21:31874585-31874607 TGGTGGGTGATGAGGGGGCAGGG - Intronic
1178536049 21:33411312-33411334 GGGTGGGTGGCGAGGGGACAAGG - Intronic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179236342 21:39550402-39550424 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179585204 21:42370238-42370260 CTGTGGCTGAGAGGGGGACGTGG - Intergenic
1180070356 21:45432757-45432779 CTGTGGGTCAGGGTGGGACATGG + Intronic
1180081944 21:45491107-45491129 CGGTGGGTGAGGAGGCGCCCGGG - Intronic
1180315255 22:11272131-11272153 CTGGGGGAGAAGCGGGGACAAGG + Intergenic
1180340092 22:11611339-11611361 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180717906 22:17884377-17884399 GTGTGGGTGGGGACAGGACATGG + Intronic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181118977 22:20652775-20652797 CTATGGGTGAGGGGGCGTCAAGG + Intergenic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181390768 22:22579333-22579355 GTGGGGGTGGGGATGGGACAAGG + Intergenic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181797388 22:25320090-25320112 CTGTGGGTGGGGTGGGGGCTGGG - Intergenic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183139227 22:35920535-35920557 TTTTGGTTGAGAAGGGGACATGG - Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183291084 22:37002388-37002410 ATGGGGGTGAGGAGGGGAAACGG + Intronic
1183303778 22:37071189-37071211 CTGTGGGGGGCGGGGGGACATGG - Intronic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183357829 22:37368936-37368958 CTGTGTGGGATGGGGGGACAGGG - Exonic
1183366863 22:37411448-37411470 CCCTGGGTGAGGAGGGGAAGCGG + Intronic
1183404972 22:37625944-37625966 CTCTGGGTGAGGAAGGGGCCAGG + Exonic
1183753183 22:39734043-39734065 TGGGGGGTGGGGAGGGGACAAGG - Intergenic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184597907 22:45525520-45525542 CTGTGGGTGAGGGGTGGGCTGGG - Intronic
1184615169 22:45633038-45633060 CTGTGGGGGCGGGGGAGACAGGG + Intergenic
1184718741 22:46296926-46296948 CTTTGGGTAAGGTGGGGTCAGGG + Exonic
1184729603 22:46365381-46365403 CTGTGGATGCGCGGGGGACAGGG + Intronic
1184773726 22:46612920-46612942 CTGTGGGTGAGCAGGGGCTGTGG - Intronic
1184834286 22:47012007-47012029 CTGGGGGCGGGGTGGGGACAAGG - Intronic
1185269517 22:49922702-49922724 GTGTGGGTGAGGAGCGGCCCGGG + Exonic
1185371146 22:50461479-50461501 CTGGGGGAGAGGGGGCGACAGGG + Intronic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203256370 22_KI270733v1_random:140780-140802 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950016346 3:9757428-9757450 AAGCAGGTGAGGAGGGGACAGGG + Exonic
950137091 3:10589103-10589125 CTGTAGGTGGGGATGGGTCAGGG + Intronic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
950153931 3:10708323-10708345 GTGGGGGTGGGGCGGGGACAGGG - Intergenic
950212697 3:11135761-11135783 TTGTGGGTGGGGTGGAGACAGGG - Intergenic
950520089 3:13493029-13493051 CTGTGGGTGAGGCTAGGACTGGG - Intronic
950640356 3:14344542-14344564 CTGAAAGGGAGGAGGGGACATGG + Intergenic
950652596 3:14416586-14416608 CTGGAGGTGAGGTGTGGACAAGG - Intronic
951038655 3:17963715-17963737 CTGTGTGTGTGGATTGGACATGG + Intronic
951496327 3:23331581-23331603 AAGATGGTGAGGAGGGGACAAGG + Intronic
952049700 3:29369539-29369561 GTGAGGGTGAGGAGGAGAGAGGG + Intronic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
954063399 3:48088161-48088183 GTGGGGGTGGGGAGGGTACAGGG - Intronic
954075606 3:48177152-48177174 GTGTGGGTTAGGAGGGACCATGG - Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954671665 3:52294357-52294379 CTGAGGGTGTGGAGGGGCCCTGG + Intergenic
954700362 3:52447702-52447724 CCGTGGGGGTGGAGGGGGCATGG - Intergenic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG + Intronic
954981238 3:54747408-54747430 CTATGGCTGTGGATGGGACATGG + Intronic
955002088 3:54937008-54937030 CTGTGTGTGAGGAGGTGCTAAGG + Intronic
955026285 3:55171000-55171022 CAGCATGTGAGGAGGGGACAAGG - Intergenic
956029277 3:65019704-65019726 AGATGGGTGAGAAGGGGACAGGG + Intergenic
956186898 3:66571260-66571282 CTGTGGGTTAGGTGGGGGTAGGG - Intergenic
956250936 3:67233004-67233026 CCTTGGTTGAGGAGGGGACCTGG - Intergenic
956894288 3:73643950-73643972 CTGTGAGTGGGGATGGGACTGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957227477 3:77468561-77468583 TTGTGGGTGAGGACAGAACACGG + Intronic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960607520 3:119522388-119522410 TGGAGGCTGAGGAGGGGACAGGG + Intronic
960697490 3:120410318-120410340 CTGTGGGTGAAAAGGGCACTGGG + Intronic
960854925 3:122092838-122092860 CTGTGGATGATGAGGAGTCAGGG + Intronic
960907422 3:122615388-122615410 TTGTAGGTGAGCAGGGGGCAGGG - Intronic
961194802 3:124992584-124992606 CTGGGGGTGAGGAGGGGCAGGGG + Intronic
961214273 3:125147563-125147585 CTGCGGATGAGGAGGGGATCCGG - Intronic
961393159 3:126568653-126568675 CTGCTGGGGAGGAGGGGTCAGGG + Intergenic
961492211 3:127263874-127263896 CTGGAGGTGAGGGGGGGACCTGG - Intergenic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961774871 3:129277853-129277875 CTGTGGGTGCAAGGGGGACAGGG - Intergenic
962986928 3:140544701-140544723 CTCAGGGTGGGGAGGGGGCAGGG + Intronic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964645139 3:158950937-158950959 CTGTGGGTTGGGAAGGGTCAGGG - Intergenic
964858210 3:161170547-161170569 CTGTGTGTGATGGGGTGACACGG + Intronic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967470762 3:189858951-189858973 CAGAGGCTGAGAAGGGGACACGG + Intronic
967507606 3:190270758-190270780 CTGTCGGTGAAGTGGGGAAAGGG - Intergenic
968576310 4:1367842-1367864 GTGTGTGTGGGGTGGGGACAGGG - Intronic
968647835 4:1749078-1749100 CGTTGGGTGGGGAGGGGGCACGG - Intergenic
968737309 4:2304123-2304145 CTGTGTGTGAGGAGGGGCAGGGG - Intronic
968756162 4:2417593-2417615 ACGTGGGTGGGGAAGGGACAAGG + Intronic
968814532 4:2815134-2815156 CTGAGGGTGATGATGGGCCATGG - Intronic
968887220 4:3341335-3341357 GTATGGGGGAGGAGGGGACAAGG + Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
968938647 4:3626516-3626538 CTGTGGGTGAATAGGAGGCAGGG - Intergenic
968948487 4:3678050-3678072 CTGAGGGTGAGGAGGAGAGGAGG + Intergenic
969268340 4:6080808-6080830 CTGTGCTGGAAGAGGGGACAGGG + Intronic
969414163 4:7047986-7048008 CTGTGGGTGATGTGGGAACGTGG + Intronic
969664344 4:8548468-8548490 CTATGGGTGCAGAGGGAACAAGG + Intergenic
971453469 4:26821772-26821794 CTGTGTGTGATGAGCAGACAGGG - Intergenic
972265194 4:37453315-37453337 GAGTGGGTGAGGAGGGGACGGGG + Intergenic
973561723 4:52143859-52143881 GTGTGGGTGAGAAGGGGAGGTGG - Intergenic
973706000 4:53581079-53581101 TTGGGGGTGGGGTGGGGACACGG - Intronic
974312897 4:60235035-60235057 CTGTGGGTGGGGGGGGGTCCAGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
976161998 4:82211384-82211406 CTGGGGGTCAGGAGGAGACCTGG - Intergenic
977759378 4:100713066-100713088 TAGTGGGTGAGAAGGGGATAAGG + Intronic
978268986 4:106865121-106865143 CTGTTGGTGGGTAGGGGTCATGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
982117633 4:152110907-152110929 CTCAGGGTGGGGTGGGGACAGGG - Intergenic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
982581755 4:157187931-157187953 CAGTGGGGGAGGGTGGGACATGG - Intergenic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
982741437 4:159061299-159061321 CTGAAGGTGATGAGGGGACAGGG - Intergenic
982810859 4:159824409-159824431 CTGTGGGCTAGTAGGAGACAAGG - Intergenic
984678340 4:182576989-182577011 GTGTGGGTGGGGCTGGGACAGGG - Intronic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
985868633 5:2536438-2536460 CTGTGGGTGAGGAGAGGCCAGGG - Intergenic
985938059 5:3111735-3111757 TGGTGGGTGAGGTGGGTACAGGG + Intergenic
985957686 5:3276996-3277018 CTGAGGGTGCCGAGGAGACAAGG + Intergenic
986076591 5:4344228-4344250 ATGTTGGGGAGTAGGGGACAAGG - Intergenic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986676133 5:10187436-10187458 TTGTGGGTCAGGTGGGGACTTGG + Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987758284 5:22125257-22125279 CTGTCGGGGAGTGGGGGACAAGG - Intronic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
988434602 5:31159238-31159260 CTGGGGGTGAGGGAGGGATATGG - Intergenic
989143838 5:38228627-38228649 GTGGGGGTGAGGATGGGACTGGG + Intergenic
990536205 5:56725235-56725257 CTGTCGGTGAGTAGGGGGCTAGG + Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
992657984 5:78929409-78929431 CTGTGGGTGAAGAGGGGGTCAGG - Intronic
994497728 5:100535176-100535198 CTGTTAGTGAGGAGCGGTCAAGG - Intergenic
994808300 5:104479695-104479717 CTGTGGCTCAGCAGGGTACAAGG - Intergenic
995734545 5:115285946-115285968 TTGTGGGGGATGAGGGGAAAAGG + Intronic
995785433 5:115822713-115822735 CTGTGGGTGGGTTGGGGGCAAGG - Intergenic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997516135 5:134491203-134491225 CTGTGGGTGAGAAGGGGGCTAGG - Intergenic
998133481 5:139662661-139662683 CCGTGGTTGAGGAGGAGAGAGGG + Intronic
998461826 5:142315156-142315178 CTGGGGGTGGGGTGGGGAAAAGG + Intronic
998474577 5:142409437-142409459 CTGTGGGGAAGGCGGGGACCAGG + Intergenic
998715817 5:144883579-144883601 CTGTTGGGGAGTGGGGGACAAGG - Intergenic
999213904 5:149915535-149915557 CTGAGGGTCAGCAGAGGACAGGG - Intronic
999245046 5:150149700-150149722 CTCTGGGCCAGGAGGGGCCAGGG + Intronic
999309282 5:150541427-150541449 CTGGGGGTGGGGATGTGACAAGG + Intronic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1001023825 5:168206528-168206550 CTGGGGTGGAGGAGGGGGCATGG + Intronic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001401254 5:171447856-171447878 TTGTGGGTGAGGGAGGGGCAGGG + Intronic
1002050115 5:176565769-176565791 CTGTGGGTCAGGACCTGACATGG - Intronic
1002285819 5:178162067-178162089 CTAGGGGTGAGGAGGGAACGAGG + Intergenic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002838107 6:882580-882602 CTGGGGCTCAGGTGGGGACATGG - Intergenic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1005280336 6:24267165-24267187 GTGAGGGTGAGGAGTGGAGATGG + Intronic
1005673006 6:28125853-28125875 CTGTGAGTGATCAGGGGATATGG + Intronic
1005883031 6:30074768-30074790 CTGAGGGTGAGGAGGGGTCCTGG - Intronic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006313178 6:33275873-33275895 CTGAGGATGAGGTGAGGACAAGG + Exonic
1006418517 6:33919317-33919339 CAGGGAGGGAGGAGGGGACAAGG - Intergenic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1006579643 6:35069319-35069341 CTGTGGATGGGGCAGGGACAAGG - Intronic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1006669180 6:35719036-35719058 CTGTGAGTTGGGAGGGGGCAAGG - Intronic
1007589235 6:43011548-43011570 CTGTGGGTGAGGAGCAGGTAGGG - Exonic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1011374158 6:86672487-86672509 TTCTGGGTGAGGTGGGGACTTGG - Intergenic
1011580752 6:88861317-88861339 GTGTTGGTGAGTAGGGGGCATGG - Intronic
1012047773 6:94300760-94300782 CTGTGCGTGAGGAGAAGAGAGGG + Intergenic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012950982 6:105517605-105517627 CTGTGAGGGAGGCGGGGAAATGG + Intergenic
1012967555 6:105691249-105691271 ATGTGTGTGGGGAGGGGTCAGGG + Intergenic
1013367943 6:109448964-109448986 CTGTAGGGGAGGAGGAGTCAGGG + Intronic
1013822240 6:114168407-114168429 CAGTAGGTGAGGAGAGGCCATGG - Exonic
1014353152 6:120368840-120368862 CTGTTGGGGAGGAGGGGGTAAGG + Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1015602944 6:134928197-134928219 GTCAGGGTGAGGAGGGGAAAAGG - Intronic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016519980 6:144936183-144936205 CCTAGGGTGAGGAGGGGATAGGG + Intergenic
1016869695 6:148804383-148804405 GTGTGTGTGAGGGGGGGTCATGG + Intronic
1016935766 6:149448541-149448563 TGGTGGGGGAGGAGGGGGCAGGG - Intronic
1017036931 6:150275330-150275352 CTGGGGATGGGGTGGGGACAGGG - Intergenic
1017047419 6:150360235-150360257 CTGTCGGTGGGTGGGGGACAAGG - Intergenic
1017650529 6:156577400-156577422 CTGTGTGTGATGGGGGGAAAGGG + Intergenic
1017708465 6:157146176-157146198 CTGTGGCAGAAGAGGGGAAAGGG - Intronic
1017749685 6:157479797-157479819 CTCTGGGCCAGGAGGGGACCAGG - Intronic
1017768750 6:157628604-157628626 CTGGAAGTGAGGAGGGGAAAGGG - Intronic
1018170678 6:161140725-161140747 CTGGCCGTGAGGAGGGGCCAGGG + Intronic
1018828438 6:167424144-167424166 CAGCGGGTGAGGAGGAGCCACGG - Intergenic
1019131954 6:169883370-169883392 CTCTGGGTTATGAGGGGATAAGG + Intergenic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019390779 7:785680-785702 CTCTGGCTCAGGTGGGGACAAGG - Exonic
1019437362 7:1028896-1028918 CTGGGGGAGATGGGGGGACATGG - Intronic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1020439483 7:8201988-8202010 CTGGGGGTAGGCAGGGGACATGG - Intronic
1021195401 7:17668628-17668650 CTGTTGGGGAGTAGGGGACTGGG + Intergenic
1022483734 7:30761295-30761317 CTGTGGGGGAGGTGGGGAAGAGG + Intronic
1022734555 7:33063389-33063411 CTGGGGGTGAGGAGGGGCGCAGG + Intergenic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1024314112 7:47998169-47998191 CTGTGGGTGAGAATGTAACATGG - Intronic
1024596386 7:50941119-50941141 CTGTGGATGAAGAGAGGAAACGG - Intergenic
1024604640 7:51013653-51013675 CTGTGGGGGACGAGGGGAGGAGG - Intergenic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1025813396 7:64889325-64889347 CTGTTGGGGCGGAGGGGACGCGG - Intronic
1025819332 7:64947690-64947712 GTGTGGGGGCGGAGGGGACGCGG + Intergenic
1025913005 7:65842442-65842464 CTGGGGGTGAGGAGGGGAATGGG + Intergenic
1026082033 7:67230483-67230505 TTGTGTTTGAGGAGGGTACAAGG - Intronic
1026312778 7:69202148-69202170 CTGTGGATGAGAGAGGGACAGGG - Intergenic
1026695033 7:72583506-72583528 TTGTGTTTGAGGAGGGTACAAGG + Intronic
1026771836 7:73207001-73207023 CGGGGAGTGAGGAGGGGTCAGGG + Intergenic
1027012704 7:74760397-74760419 CGGGGAGTGAGGAGGGGTCAGGG + Intronic
1027075336 7:75185656-75185678 CGGGGAGTGAGGAGGGGTCAGGG - Intergenic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029601118 7:101563959-101563981 CTGTGAGCCAGGAGGGGACCTGG - Intergenic
1029635981 7:101784040-101784062 ATGTGGGTGGGCAGGGGACAGGG + Intergenic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1031083681 7:117281892-117281914 ATGTGGTGGAGGAGAGGACATGG + Intronic
1032443669 7:131961865-131961887 GGGAGGCTGAGGAGGGGACAAGG - Intergenic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032506358 7:132437602-132437624 CTCTTGGTGCGGAGGGTACAGGG - Intronic
1032859396 7:135863005-135863027 CTGCAGGTGAGGAGGAGACTGGG - Intergenic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033996237 7:147353294-147353316 CTGTCGGGGAGTAGGGGAAAGGG - Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034376523 7:150649619-150649641 CTGTGTGTGAGTGGGGGTCATGG + Intergenic
1034628964 7:152515873-152515895 CTGTGGGTCAGATGGGGACTTGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034901253 7:154909379-154909401 CTCTGGCAGAGGAGGGGACTGGG + Intergenic
1034958908 7:155352134-155352156 CTGCTGGTGTGCAGGGGACACGG + Intergenic
1035473312 7:159125385-159125407 CCCTGGGTGAGGAGGACACAAGG + Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037087878 8:14875463-14875485 CTTTGGATAAGGAAGGGACAAGG + Intronic
1037431882 8:18822213-18822235 CTTTGGTTGAGAAGGGGCCATGG + Intronic
1037678277 8:21071266-21071288 CTGTGGGTGGGAAGGTGACTTGG + Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1040438464 8:47416769-47416791 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040446399 8:47499786-47499808 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040999547 8:53437397-53437419 TTCTGGGTCAGGAGGGGACTTGG - Intergenic
1041698612 8:60763453-60763475 GTGTGGGTGGGGAGCGGTCAGGG + Intronic
1041900082 8:62972822-62972844 CTGTTGGGGAGTGGGGGACAAGG - Intronic
1043555214 8:81422267-81422289 ATTTGGGTGAGGAGGACACAGGG - Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1044817745 8:96130523-96130545 TTGATGGTGGGGAGGGGACAGGG - Intergenic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048297521 8:133225393-133225415 CTGTGGGTGAGGTGGAGGCATGG + Exonic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049113406 8:140664595-140664617 CAGTGGATGAGGAAGGCACATGG - Intronic
1049251923 8:141593854-141593876 CTGAGGGTGAAGAGGGGTCTGGG + Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049292465 8:141811862-141811884 CTGTCAGTGAGGAGCGGCCAGGG - Intergenic
1049779942 8:144424334-144424356 CTGTGGCTGAGGAGGGGTTGGGG - Intronic
1050348403 9:4716246-4716268 TTGTGGGTGAGGTGGGGAGCTGG - Intronic
1052003476 9:23317496-23317518 CTGTCGGTGGGTAGGGGACTAGG - Intergenic
1052149316 9:25094021-25094043 CATTTGGTGAGGAGGGGGCAGGG + Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052691374 9:31820659-31820681 CTGGGGGTGGGGAGAGGCCACGG - Intergenic
1053143653 9:35697611-35697633 TTGGGGTTGGGGAGGGGACAGGG + Exonic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053192717 9:36086729-36086751 CTCTGGGTCAGGTGGGGACTTGG - Intronic
1053334141 9:37249092-37249114 ATGTGGGAGAGGTGGGGAGATGG + Intronic
1053443086 9:38131632-38131654 CTGTTTGGGAGGAGGGGACGGGG + Intergenic
1053707311 9:40768477-40768499 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1054417227 9:64889245-64889267 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1054452096 9:65408820-65408842 CTGTGGGTGAATAGGAGGCAGGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054827855 9:69590783-69590805 GTGGGGGTGGGCAGGGGACATGG + Intronic
1056112581 9:83410295-83410317 CTGTGGGGGAGGGAGGGACAAGG - Intronic
1056753569 9:89368463-89368485 CTGGGAGGGAGGAGGGGCCATGG - Intronic
1057313992 9:93957655-93957677 CAGGGGGTGAGGAAGGGGCAGGG - Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1058104477 9:100955069-100955091 CTGATGGTGAGGATGAGACATGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059282340 9:113145676-113145698 CTGGTGGTGGGGAGGGGTCAGGG - Intergenic
1059447586 9:114348490-114348512 CTGTGAGTGGAGAGCGGACAGGG + Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059543256 9:115151582-115151604 TTGTGGGTGAGAAGAGGATATGG + Intronic
1060548095 9:124472311-124472333 CAGAGGGTGAGAAGGGCACAGGG - Intronic
1061002441 9:127910059-127910081 CTGGGGGTGGCGGGGGGACAGGG + Intronic
1061033655 9:128101684-128101706 CTGTGCGTGTGGAGGGGGCGGGG + Intronic
1061120800 9:128641143-128641165 CTGTGGCTGAGGTAGGGACACGG - Intronic
1061146687 9:128803799-128803821 CTGGGGGTGGAGAGGGGTCAAGG + Intronic
1061277651 9:129578764-129578786 CTCTGGGGGAAGAGGGGATAAGG - Intergenic
1061419218 9:130464217-130464239 CTGATGGGGAGGAGGGCACAGGG + Intronic
1061577970 9:131519481-131519503 CTGCAGGTGAGGAGCGGCCAGGG + Exonic
1061678729 9:132232215-132232237 CTGGGGGCCAGGTGGGGACAGGG - Intronic
1061962733 9:133996621-133996643 ATGTGGGTGGGGAGGTGACGAGG + Intergenic
1062040901 9:134403848-134403870 GTGTGGGTGAGGAGCAGACGCGG + Intronic
1062185649 9:135216871-135216893 GTGTGAGTGAGGAGGGGGAAGGG + Intergenic
1062200545 9:135300570-135300592 ATGTGGAGGGGGAGGGGACAAGG + Intergenic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062530391 9:136997029-136997051 GTGTGGGTGAGCAGGAGAAATGG + Intergenic
1062715864 9:138009811-138009833 CTGGAGGTGAGGATGGAACAGGG + Intronic
1203472526 Un_GL000220v1:122480-122502 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1185716472 X:2346796-2346818 CTGTCGGGGAGTAGGGGACTGGG - Intronic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186906006 X:14111211-14111233 ATGAGGCTGAGGAGGTGACAAGG - Intergenic
1187566180 X:20451721-20451743 GTGTGGCTGAGGCGGGGAGAAGG - Intergenic
1187760778 X:22581539-22581561 CTGTGGGTGGGTTGGGGGCAAGG + Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188913971 X:35887511-35887533 TTGTCAGTGAGGAGGGGGCACGG + Intergenic
1189008387 X:37018966-37018988 CCTGGGGTGAGGAGAGGACAAGG - Intergenic
1189040340 X:37536044-37536066 CCTGGGGTGAGGAGAGGACAAGG + Intronic
1189256561 X:39644530-39644552 CTGTGGGGGAGGCTGAGACATGG + Intergenic
1189698748 X:43694290-43694312 CTGTGGGTCCGGAGGCTACAGGG + Intronic
1190375625 X:49785708-49785730 CTGAGGCTGATGAGGAGACAAGG + Intergenic
1190597974 X:52065764-52065786 CTGTGGGGGAAGAGCGGGCATGG - Intronic
1190610850 X:52188309-52188331 CTGTGGGGGAAGAGCGGGCATGG + Intronic
1190879044 X:54479670-54479692 CTGGGGGTGGGGTGGGGAAAGGG + Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1193981601 X:88187617-88187639 CTCTGCGTGAGGAGAGGAAATGG + Intergenic
1194239293 X:91423868-91423890 CTGTGGATGAGGGATGGACAAGG + Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195246854 X:103002767-103002789 CTGTGTGTGAGGCTGGGACTTGG + Intergenic
1195869689 X:109473048-109473070 ATGTGGGTGGGGTGGGGGCAGGG - Intronic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1195896317 X:109749346-109749368 CCTTGGGTGAGGATGGGACTGGG + Intergenic
1195939966 X:110159874-110159896 CTTAGGGTGAGGAGGTGAAAGGG + Intronic
1196106253 X:111899092-111899114 TAGTGGGTGAGGAGAGGGCAAGG - Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1196804093 X:119569387-119569409 CTGGGGGGGCGGAGGGGGCAGGG + Intergenic
1196927969 X:120652630-120652652 CTGTCGGTGGGTAGGGGGCAAGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197765210 X:130055694-130055716 CTGTGGTTTAGCAGGGGACGGGG + Intronic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198382988 X:136101553-136101575 CTGTGGATGAGGATGGGAAGAGG + Intergenic
1199482539 X:148312858-148312880 ATCTGGGTGAAGAGGGTACATGG - Intergenic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic
1199827511 X:151515325-151515347 ATGGGGAAGAGGAGGGGACAAGG - Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1200084248 X:153595571-153595593 CTGTGGGTGTGGCGTGGGCATGG - Intronic
1200887860 Y:8288288-8288310 CTGTTGGTGAATGGGGGACAAGG - Intergenic
1201074769 Y:10178798-10178820 CTGGGGGAGAAGTGGGGACAAGG - Intergenic
1201320509 Y:12693581-12693603 CTTTCAGTGGGGAGGGGACAAGG + Intergenic
1202257456 Y:22936829-22936851 CTTTGGGTGGGGTGGGGACTTGG + Intergenic
1202381974 Y:24281196-24281218 CCTTGGCTGAGGAGGGGGCAAGG - Intergenic
1202410446 Y:24570576-24570598 CTTTGGGTGGGGTGGGGACTTGG + Intergenic
1202460335 Y:25099496-25099518 CTTTGGGTGGGGTGGGGACTTGG - Intergenic
1202488810 Y:25388929-25388951 CCTTGGCTGAGGAGGGGGCAAGG + Intergenic