ID: 1162068535

View in Genome Browser
Species Human (GRCh38)
Location 19:8140073-8140095
Sequence CTGCAAAAGCAAGAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 528}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162068531_1162068535 -6 Left 1162068531 19:8140056-8140078 CCTCCAAAGTCACACAGCTGCAA 0: 1
1: 0
2: 4
3: 44
4: 293
Right 1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG 0: 1
1: 1
2: 1
3: 40
4: 528
1162068532_1162068535 -9 Left 1162068532 19:8140059-8140081 CCAAAGTCACACAGCTGCAAAAG 0: 1
1: 0
2: 23
3: 186
4: 1188
Right 1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG 0: 1
1: 1
2: 1
3: 40
4: 528
1162068530_1162068535 19 Left 1162068530 19:8140031-8140053 CCAGACGAGGAGAGATCAACAGA 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG 0: 1
1: 1
2: 1
3: 40
4: 528
1162068529_1162068535 20 Left 1162068529 19:8140030-8140052 CCCAGACGAGGAGAGATCAACAG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG 0: 1
1: 1
2: 1
3: 40
4: 528
1162068528_1162068535 24 Left 1162068528 19:8140026-8140048 CCTGCCCAGACGAGGAGAGATCA No data
Right 1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG 0: 1
1: 1
2: 1
3: 40
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162068535 Original CRISPR CTGCAAAAGCAAGAGGAGGA CGG Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
902161250 1:14532159-14532181 CTGGGAAAGAAAGAGCAGGATGG - Intergenic
902270274 1:15299362-15299384 CTGCAAAAGCAAAACTATGAGGG - Intronic
902377223 1:16035459-16035481 CTGGAAAAGCAAGGGGGTGATGG + Intergenic
902382403 1:16058718-16058740 CTGGAAAAGCAAGGGGGTGATGG + Intronic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902787658 1:18743543-18743565 ATCCAGAAGCAAGAGGAAGATGG - Intronic
903186258 1:21631003-21631025 CTGCAGAGGCCAGAGGAAGAAGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904092658 1:27956093-27956115 CTGCGGAGGCCAGAGGAGGAGGG + Intronic
905395285 1:37662710-37662732 CAGCAAAGGCCAGAGGAGTAAGG + Intergenic
905602935 1:39269568-39269590 CTGCCATAGCCAGAGGAGGAGGG - Intronic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
907212082 1:52832609-52832631 CTACAAAAGAAAAAGGGGGAAGG - Intergenic
907234897 1:53037614-53037636 GTCCAAAAGCAAGTGGTGGATGG + Intronic
907454269 1:54565106-54565128 CTTCAAAAGCAAGGGGAGGGTGG - Intronic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
909838156 1:80283879-80283901 CTGAAAAAGCAAGAAAAAGAAGG + Intergenic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910236097 1:85037985-85038007 CACCAAAAGCAAGAGGTGGTAGG + Intronic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
910817635 1:91309069-91309091 CTTCAAAAGGAAGAAGATGAAGG + Intronic
911483655 1:98477412-98477434 CTGAAAAAGTAAGATAAGGAAGG - Intergenic
912045723 1:105453043-105453065 CTCCTACAGCAAGAGGAGGAGGG + Intergenic
912449520 1:109760586-109760608 CAGGCAGAGCAAGAGGAGGATGG - Intronic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
912816480 1:112832823-112832845 TCCCAGAAGCAAGAGGAGGAAGG + Intergenic
913423343 1:118697986-118698008 CTGCAATAGCCACAGGAGGTAGG - Intergenic
914329094 1:146649394-146649416 CTCCAAGAGGAAGAGGAAGAGGG + Intergenic
914764098 1:150622752-150622774 CTGCAAAAGCAGGAAGGGGCAGG + Exonic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
915043554 1:152990431-152990453 CAGCAAACTCAAGGGGAGGAGGG - Intergenic
915983579 1:160440313-160440335 AAGAAAAAGCAAGAGAAGGAAGG - Intergenic
916292309 1:163180365-163180387 CTGCAATAGGAAGAGGAAAATGG - Intronic
918665872 1:187150339-187150361 CTCCAAAAAACAGAGGAGGAGGG - Intergenic
918671308 1:187220243-187220265 CTGAAAAAAATAGAGGAGGAGGG - Intergenic
918784118 1:188742840-188742862 CCACAAATGCAAGAGGAAGAGGG + Intergenic
919105701 1:193147901-193147923 CTGTAAAAGCCAGAGAAGAAGGG + Exonic
919465427 1:197918356-197918378 GGGCATAAGCAATAGGAGGACGG + Intronic
919638814 1:200029793-200029815 CTGCAATACCAGGAGGCGGAGGG - Intronic
920219042 1:204382575-204382597 CTTCAAATGCAAGAGGAAAAGGG - Intergenic
920364507 1:205440960-205440982 CTGCAAAATGAAGAGGAAGAAGG - Intronic
920913329 1:210237395-210237417 CTGCGGAAACGAGAGGAGGAGGG + Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921082001 1:211748386-211748408 CTTCAAAAGCAACTGGAGGCCGG + Exonic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
921941945 1:220850687-220850709 CAGCAAAAGCAATAGTAAGAAGG - Intergenic
921970709 1:221146256-221146278 CTCAAAAAGAAAGAGAAGGAAGG + Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
923352172 1:233119081-233119103 GTGCAAAAGCAATTCGAGGAAGG + Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
923980899 1:239322255-239322277 ATGCAAAAGCTTCAGGAGGATGG + Intergenic
924162262 1:241245348-241245370 CGGCAGGAGCAAGAGGAGGGGGG - Intronic
924826129 1:247540685-247540707 ATGCAAGAGCAAGTGGGGGAGGG + Intronic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
1063699468 10:8370587-8370609 CTGCAAGGGCAAGTGGAAGATGG + Intergenic
1064191359 10:13208689-13208711 CTCCAAAAAAAAGAGGAGGAAGG + Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065446384 10:25805866-25805888 TTCCGAAAGTAAGAGGAGGAAGG + Intergenic
1065586554 10:27224124-27224146 AGGCCAAAGCAGGAGGAGGATGG + Intronic
1065875062 10:29990512-29990534 GTGCAGAAGCAAGGGGTGGAGGG - Intergenic
1066353951 10:34664092-34664114 CGGCAGAAGCGAGATGAGGAAGG - Intronic
1067795947 10:49322379-49322401 CTGCAAAAGAAAAAGGTGCAGGG - Intronic
1068022196 10:51598946-51598968 CTGAAACAGGAAGAGGAAGAGGG + Intronic
1068451214 10:57191643-57191665 CAGCAAAAGCCGTAGGAGGAGGG - Intergenic
1069291552 10:66786371-66786393 GGGTAGAAGCAAGAGGAGGAAGG - Intronic
1070080492 10:73181399-73181421 CAGCAAAAGCAATACTAGGAGGG - Intronic
1070164385 10:73886942-73886964 CTGGAGAAGGAAGAGCAGGAAGG - Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1070889477 10:79931285-79931307 GAGCAAAAGCAAGGGAAGGATGG + Intergenic
1071416347 10:85445221-85445243 CATCAATAGCAAGAGGTGGAAGG + Intergenic
1071963213 10:90826581-90826603 GTTTAAAAGCAAGAGGATGAAGG + Intronic
1072591264 10:96831000-96831022 ATGCAAATGCAAGGGTAGGAAGG - Intergenic
1072653264 10:97312149-97312171 CTGCAAAAGAACGAGGAGATGGG - Intergenic
1072982922 10:100114914-100114936 CTGCAGAAGCTAGAGGAGGGGGG - Intergenic
1073341573 10:102748807-102748829 CTGCTAGGGCAAGAGGAAGATGG + Intronic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073381568 10:103081687-103081709 TTGCAAGTGCTAGAGGAGGAAGG - Exonic
1073541946 10:104322081-104322103 CTGCAAAATGCAGAGGAGGGAGG + Intronic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1074183230 10:111080611-111080633 CTGCCAAAGTCAGGGGAGGAGGG + Exonic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074434782 10:113424767-113424789 ATGCAAAGGGAAGAGGAAGAAGG + Intergenic
1074563195 10:114552757-114552779 CTGCAAAAGTAAGTTGAAGAAGG + Intronic
1074868028 10:117556120-117556142 CTGCAAACCCAAGAGGTGGGTGG + Intergenic
1075614594 10:123882291-123882313 CTGTAAAGGCCAGAGGAGGAAGG + Intronic
1075887317 10:125912357-125912379 AAGCTAAAGGAAGAGGAGGAGGG - Intronic
1076465875 10:130681377-130681399 TAGCACAAGCAAGAGCAGGATGG - Intergenic
1077201700 11:1310617-1310639 TCCCAAAAGCACGAGGAGGAAGG - Intergenic
1077357339 11:2124535-2124557 CTGCAGCAGGAAGAGGTGGAGGG - Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078174110 11:8955880-8955902 CTGGAAAGGCAAGGAGAGGAGGG + Intronic
1078534518 11:12162431-12162453 CTGCAAAGGTAAGACTAGGAGGG - Intronic
1078883116 11:15472689-15472711 CTGCAGAAGCAAGAGGTGTGAGG - Intergenic
1079494207 11:21022874-21022896 CTCCAAAAGAAAGGGGATGATGG + Intronic
1079834072 11:25309045-25309067 GAGCAGGAGCAAGAGGAGGAAGG - Intergenic
1080786368 11:35478531-35478553 GGGAAACAGCAAGAGGAGGAGGG + Intronic
1080798859 11:35590640-35590662 CTGCTATAGCATCAGGAGGAGGG - Intergenic
1080945577 11:36969948-36969970 CGGCCAAAGTAAGAGGATGAAGG - Intergenic
1081806688 11:45894740-45894762 CTCCAGGAGCAAGGGGAGGAAGG + Intronic
1082665417 11:55970698-55970720 CTGCAAAAGCATGAGTTGAATGG + Intergenic
1083460749 11:62809801-62809823 CGGCAAAAGAAAGAGGGGAAAGG + Intronic
1083481888 11:62954229-62954251 CTGCAAAAGCAATAGTTGCATGG + Intronic
1083562683 11:63685742-63685764 CTCCAAAACCAAGAGGAGCTTGG - Intronic
1084569592 11:69951458-69951480 GTGCAGAGGCGAGAGGAGGAAGG - Intergenic
1085101077 11:73800591-73800613 CTGCAAGTGGAAGAGGAGGATGG - Intronic
1085852206 11:80134528-80134550 CTGCAAAAGCAAGACTAAGGGGG - Intergenic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087350356 11:97023554-97023576 CTGCAAAAGCAATACTAAGAGGG + Intergenic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1089871198 11:121673825-121673847 GTGAAAAGGCAAGAGGAGCAAGG + Intergenic
1090011825 11:123051972-123051994 CTGAAAAAGAAAGAGGCGTAGGG - Intergenic
1090446649 11:126770191-126770213 CTGAAGAAGCAAGGGGAGGTGGG - Intronic
1091324408 11:134675119-134675141 CACCAAAAGTAAGAGGTGGATGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092330021 12:7577794-7577816 CTTTAAAAGCAAGAGGCGGAAGG - Intergenic
1093239461 12:16652066-16652088 CAGCAACAGCAAGAGAGGGAGGG + Intergenic
1093255280 12:16858890-16858912 ATGAGAAAGCAAGAGGAGCATGG + Intergenic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1095506728 12:42906298-42906320 CTGCATATGCAAGAGGGGTAAGG + Intergenic
1095523510 12:43096530-43096552 AGGGAAAAGCAAGAGGAGAAAGG - Intergenic
1096487948 12:51996296-51996318 CTGCCAAAGCTTGTGGAGGAGGG + Intronic
1097544246 12:60978940-60978962 CTGCGGAAGCTCGAGGAGGATGG - Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1097786474 12:63765505-63765527 TTGCAAAAGCCAGAGAGGGAGGG - Intergenic
1098065714 12:66614092-66614114 CTGAAAAAGGAAGAGGAGAAAGG - Intronic
1099370825 12:81827643-81827665 CTGCCAAAACAAGAGGTGGGAGG - Intergenic
1100014298 12:89990255-89990277 CTGAAAGACCAAGAGGTGGAAGG - Intergenic
1101250024 12:102924013-102924035 CTGCAAAATCCAGAGGACGTAGG + Intronic
1101325552 12:103712436-103712458 CTGCACAGGCAAGCGAAGGAAGG + Exonic
1103023847 12:117557944-117557966 CTGCAAAAGCAAGACGAATCTGG - Intronic
1103517386 12:121516118-121516140 CTTAAAAAGCAAGCTGAGGACGG + Intronic
1104023363 12:125008612-125008634 CTGCATTAGAAAGAAGAGGAGGG - Intronic
1104749930 12:131231878-131231900 GAGCAAGAGGAAGAGGAGGAGGG - Intergenic
1104838013 12:131804459-131804481 CTGCAAAAGCAAGATGAAGCTGG - Intergenic
1104917898 12:132275447-132275469 CAGCAAGACCAAGAGGAGCACGG + Intronic
1105284255 13:18992015-18992037 CACCAAAAGAAAGAGCAGGAAGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107588509 13:41879305-41879327 CAGCAGCAGAAAGAGGAGGAGGG - Intronic
1108260737 13:48653218-48653240 AGGTAAAAGCAAGAGAAGGAGGG + Intergenic
1109516657 13:63451566-63451588 CAGTAAAAGCAAGACTAGGAGGG + Intergenic
1110098260 13:71559956-71559978 CTGCACCAGCAAGAGAGGGAAGG + Intronic
1110974446 13:81811650-81811672 CAGCAAAAGCAATACTAGGAAGG + Intergenic
1110988221 13:82002215-82002237 CTACAAAACCAAGATGGGGAAGG - Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113404204 13:110022915-110022937 CTGCACAACCTAGAGGAAGATGG + Intergenic
1114422762 14:22598420-22598442 CTGGAAAAGGAAGAGCGGGAAGG - Intronic
1114569443 14:23656232-23656254 CAGCAAAGGCAAGAGAAGAAGGG + Intergenic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1118388598 14:65277779-65277801 CTGCATGTGCAAGAGGAGAAAGG - Intergenic
1118728815 14:68652278-68652300 CAGCAAGAGCAAGAGGCGGCTGG - Intronic
1119031934 14:71199617-71199639 CTCCAAAGGGAAGAGGATGATGG + Intergenic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119117223 14:72035610-72035632 CAGCAAAAGCAATACTAGGAAGG - Intronic
1119822492 14:77629830-77629852 ATGCAAAAGGAATAGAAGGAGGG + Intergenic
1122126308 14:99580403-99580425 CTGGAAAAGCAAGCAGAGGGCGG + Intronic
1122286365 14:100655040-100655062 CTGCAAAGGCACCAGGAGGGAGG - Intergenic
1122330239 14:100907023-100907045 CTGCAAAATGGAGAGGTGGAAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123016145 14:105376667-105376689 CTGCAGGAGCAATAGGAGGCGGG - Intronic
1202870805 14_GL000225v1_random:161642-161664 AAGCTAAAGGAAGAGGAGGAGGG + Intergenic
1125181392 15:36883909-36883931 CTGCAAAAGGAAAGGGAGGGGGG + Intergenic
1125689321 15:41583886-41583908 ATGCAAAAGCAATAGGAGAGTGG - Intergenic
1127407968 15:58672825-58672847 CTGAAAAAAAAAGAAGAGGAAGG + Intronic
1127661573 15:61104393-61104415 TTGCAAACACAACAGGAGGATGG + Intronic
1127922238 15:63503377-63503399 CGGCCAGAGCGAGAGGAGGAAGG - Intergenic
1128013715 15:64323221-64323243 ACACAAAAGCAAGAGGAGGCTGG - Intronic
1128029460 15:64466938-64466960 CTGCTAGAGCAAGGGGAGGGGGG - Intronic
1128061149 15:64736766-64736788 CTGCAAAGGTATCAGGAGGAGGG - Intergenic
1128775104 15:70314172-70314194 CTGCCATGGCAAGATGAGGAAGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129155230 15:73713533-73713555 AGGCTAGAGCAAGAGGAGGAAGG - Exonic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1130784360 15:87079911-87079933 CTGCAAAAGTAAGAAAAGTAAGG + Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131823487 15:96296376-96296398 CTCCAACAGCAATAGGACGATGG + Intergenic
1132334980 15:101042519-101042541 CAGTAAAAGCCACAGGAGGATGG - Intronic
1132758191 16:1496129-1496151 CGGGAAAGGCAAGAGAAGGAAGG - Intronic
1132828255 16:1915571-1915593 TTAGAAAAGCAAGAGGAGGGTGG - Intronic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133945524 16:10344722-10344744 TCCCAAAAGCAAGAGAAGGAAGG + Intronic
1134636086 16:15793120-15793142 GGGCTAAAGTAAGAGGAGGAGGG - Intronic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1135003981 16:18801869-18801891 CTGCGAAAGCCAGACGAAGAGGG - Intergenic
1136110741 16:28062693-28062715 CCGCGAAAGGAAGAGGAGGAGGG + Intronic
1136957739 16:34804237-34804259 CTGCATCAGCAAGTGCAGGAGGG - Intergenic
1138646274 16:58427361-58427383 CTGCAAAAGAGAAAGAAGGAAGG - Intergenic
1138690884 16:58767516-58767538 AAGAAAAAGCAAGAGGGGGATGG + Intergenic
1139119872 16:64003228-64003250 TTCCAAAAGATAGAGGAGGAGGG + Intergenic
1139262363 16:65606926-65606948 GTGCAAGAGGAAGAGGCGGAGGG + Intergenic
1140554848 16:75910010-75910032 CTGCAAAAGAAACAGCAGGCTGG + Intergenic
1140806005 16:78532949-78532971 CTGATGAAGCAAGAGTAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141320328 16:83002426-83002448 CTGCAAAATCAAGATGTTGATGG - Intronic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143325323 17:6094761-6094783 TGGCAGAAGCAAGAGAAGGAAGG + Intronic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1145985482 17:29043142-29043164 CGGCTAAAGGACGAGGAGGAAGG - Exonic
1146953155 17:36920561-36920583 ATGGAAAAGCAAGAGGAGAAAGG - Intergenic
1147438060 17:40430116-40430138 ATGCTAAAGAAAGAGAAGGAAGG + Intergenic
1149511135 17:57242674-57242696 CCACAAAAGTAAGAGGATGATGG + Intergenic
1149944042 17:60901317-60901339 CTGCATAAGCAAGAAAAGAAAGG - Intronic
1150143996 17:62752772-62752794 GAGCAAAAGCAAAAGGAAGAGGG - Intronic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1153362267 18:4210617-4210639 CTGCAGATGAAAGAGGACGATGG + Intronic
1153444753 18:5158513-5158535 ATGCAAAGGGAAGAGGAGGAGGG - Intronic
1154955087 18:21245649-21245671 CTGCAAAATCAAAAACAGGAAGG - Intronic
1155523132 18:26689332-26689354 CTGGAAGAGTAAGAGGGGGAAGG - Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156504574 18:37581198-37581220 GAGCAAAAGAAAGAGGAAGAGGG - Intergenic
1156513334 18:37659974-37659996 CTGCAAAGGGAAGAGAAGGTGGG + Intergenic
1157729133 18:49988711-49988733 CTGGGAAGGAAAGAGGAGGATGG + Intronic
1157867107 18:51196977-51196999 CTGGAAGAGGACGAGGAGGAGGG - Exonic
1158174553 18:54639765-54639787 CTGCAAAAGAAAGATTAGGAAGG + Intergenic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1161477338 19:4493962-4493984 CCGCTACAGGAAGAGGAGGAGGG - Exonic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162346128 19:10119172-10119194 CTGCAAAAGGCAGCGTAGGAAGG + Intronic
1162422716 19:10574962-10574984 GTGGAAAAGGAAGAGGTGGAGGG - Exonic
1164834641 19:31349560-31349582 CTCCAGAGGCCAGAGGAGGAGGG + Intergenic
1165069163 19:33245708-33245730 AGCCAAAAGCAAGAGGAGGCTGG - Intergenic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1165855611 19:38878041-38878063 CTGCCCAGGCAAGAGCAGGAAGG + Intronic
1166248217 19:41546115-41546137 GGGCACAAGCAAGTGGAGGAGGG - Intergenic
1166507561 19:43380683-43380705 CTACAAGACCAAGATGAGGAAGG - Intergenic
1166591153 19:44000483-44000505 AGGCAAAAGCAGTAGGAGGAGGG + Intergenic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
925385938 2:3461748-3461770 CTGCAGAAGCCAGAGGGGGCTGG - Intronic
925405288 2:3602096-3602118 CTACAAAAGCCAGGGGAGGGTGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926724118 2:15984255-15984277 CTGGAGAAGCAAGAGGGAGAAGG - Intergenic
927897284 2:26791746-26791768 CTGCAAAGCCCAGAGGAGGGCGG + Intronic
928389998 2:30902250-30902272 CAGCCAAAGCAAGAGGAGTTGGG - Intergenic
928609608 2:32978743-32978765 TTCCAAAAGATAGAGGAGGAGGG - Intronic
929100393 2:38306346-38306368 TTCCAAAAACCAGAGGAGGAGGG + Intronic
929197365 2:39199226-39199248 CTAGAAAACCTAGAGGAGGATGG + Intronic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930000989 2:46861316-46861338 CTGCAAAACCAAGGTGTGGAGGG - Intergenic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
931121257 2:59222842-59222864 CTGCAAAAGCAAAGAGGGGAAGG + Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
931587139 2:63841214-63841236 CTGCTAAAGGAAGAGGAAGGTGG + Intronic
932497730 2:72154844-72154866 CTGCCAGAGAAAGAGGATGAGGG - Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
933322801 2:80798064-80798086 TGGCAAAAGCAATAGGAGGTGGG + Intergenic
934987896 2:98900501-98900523 TTTGAAAAGCCAGAGGAGGAGGG - Intronic
935321220 2:101891143-101891165 CTGCAAAAGCAAGAAAAGAGAGG - Intronic
935575333 2:104703656-104703678 CTGCAAAGAGGAGAGGAGGATGG + Intergenic
935750007 2:106223575-106223597 AAGCAAGAGAAAGAGGAGGAGGG + Intergenic
935981634 2:108634056-108634078 CTCCAAAGGAAAGAGGAGGGAGG + Intronic
936026114 2:109032307-109032329 CTGCAAAACAAAGAGGGGGTGGG - Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936368981 2:111886862-111886884 TTGCAAAAGCAAATGAAGGAGGG + Intergenic
936976359 2:118225408-118225430 CCCCAAAATCAAGGGGAGGATGG - Intergenic
937031862 2:118747518-118747540 CTGGAAGAGGAAGAGGTGGAGGG - Intergenic
937269839 2:120642311-120642333 CTGCAAAAGCAAGAACAAAAAGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
939098289 2:137862875-137862897 ATGCAAAAGAAAGAGGAGGGAGG + Intergenic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939238363 2:139526674-139526696 CTAAAAAGGCAAGAAGAGGAAGG + Intergenic
939253625 2:139715457-139715479 TCTCAAAAGCAAGAGGAGAAAGG + Intergenic
939273910 2:139974974-139974996 TTCCAAAAGATAGAGGAGGAAGG + Intergenic
939622829 2:144441139-144441161 CAGCTAAAGGAAGAGAAGGAAGG - Intronic
940425718 2:153529518-153529540 CTCCAAAAAATAGAGGAGGAGGG + Intergenic
940559570 2:155277950-155277972 CAGCAAAAGCAATAGTAAGATGG - Intergenic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941096533 2:161244614-161244636 CAGCAAAAGCGAGGGGAGGGGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942322292 2:174746181-174746203 GTCCAAGGGCAAGAGGAGGAGGG - Intergenic
942970155 2:181949025-181949047 CTCCAAAAACAAGAGGATAAAGG - Intergenic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
945485972 2:210396039-210396061 CTCCTAAAGCTAGAAGAGGATGG + Intergenic
946322931 2:218963976-218963998 CTGAGAAGGCAAGGGGAGGAGGG + Intergenic
946716504 2:222559183-222559205 GTGCAACAGCGAGAGGAGCAGGG - Exonic
947525697 2:230875495-230875517 CTGCGGAAGCAAGAAGAGCAGGG - Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948158135 2:235801103-235801125 TAGCAAAAGCAAGGGGAGGCTGG - Intronic
1169628969 20:7603983-7604005 CTGCAAAAGCAACGGTAAGAGGG + Intergenic
1169776643 20:9262442-9262464 CTGCAAAAGGAAGAGCATGGAGG + Intronic
1170022294 20:11849944-11849966 CTGCAGAACAAAGAGGAGGTTGG - Intergenic
1170751324 20:19148734-19148756 CTACACAAGCAAGAGGAGAGTGG + Intergenic
1171034587 20:21705365-21705387 TTCCCAAAGCTAGAGGAGGAAGG + Intergenic
1171130907 20:22652275-22652297 CTGCAGAAAAAAGAGGAGGATGG - Intergenic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1173021271 20:39269656-39269678 CTGCAGAGTCAAGAGCAGGAAGG - Intergenic
1173137587 20:40453048-40453070 CTGAAGGATCAAGAGGAGGAGGG - Intergenic
1173899969 20:46580580-46580602 CAGTAAAAGCCAGAGGTGGAAGG + Intronic
1174872602 20:54197135-54197157 CTGCGAAGACATGAGGAGGAGGG - Intergenic
1175674455 20:60934730-60934752 CTGCAAACGGAAAATGAGGATGG - Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176362059 21:6006177-6006199 CTCCAAAAGGAGGAGGAGGAGGG + Intergenic
1178773999 21:35531540-35531562 CTGCAAAACCGTGAGTAGGATGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179236725 21:39554093-39554115 GAGCAGAAGGAAGAGGAGGAGGG - Intergenic
1179325400 21:40338172-40338194 GTGCAAAAGGAAGTGGACGAGGG - Exonic
1179644380 21:42766746-42766768 CTGAAAAACCAAGGGAAGGAGGG + Intronic
1179761459 21:43532368-43532390 CTCCAAAAGGAGGAGGAGGAGGG - Intronic
1181618676 22:24072489-24072511 CTCCAAAACCCAGCGGAGGAAGG + Exonic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1182465726 22:30514883-30514905 CTACAAAAGCAGGAGTAGGGGGG + Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182646437 22:31813621-31813643 CTCTAAAAGCAACAGGAAGAAGG - Intronic
1182996110 22:34813862-34813884 CGGCAAAAGAATGAGGATGAGGG + Intergenic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1184487914 22:44792304-44792326 CTGAAAAAGCAACTGGAGGCCGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185370899 22:50460426-50460448 CAGCAAAGGTGAGAGGAGGAGGG + Intronic
951067261 3:18281345-18281367 CTGCAAAAGCCAGAGAAGAAAGG + Intronic
951144154 3:19206383-19206405 CTGCAAAAGCATAAGGGGAAAGG + Intronic
951283700 3:20783233-20783255 CTCCAAAAACATGAGGAGGAGGG + Intergenic
951519687 3:23599718-23599740 GTCCACAGGCAAGAGGAGGATGG + Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
952008506 3:28871733-28871755 TTCCAAAAACTAGAGGAGGATGG - Intergenic
953072496 3:39535623-39535645 TTGCAAATGCAAGAGGAACAAGG - Intergenic
953078299 3:39591961-39591983 GTGCAAAAGTAAGAATAGGATGG + Intergenic
953241791 3:41155967-41155989 CTGGAATAGCAAGGTGAGGAAGG + Intergenic
953537836 3:43789495-43789517 CTGAAAAAAAAAGAGGAAGAGGG - Intergenic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
956004438 3:64763438-64763460 TGGCAAAAGCAAGAGCAAGAGGG + Intergenic
956042878 3:65164045-65164067 CTACAAAATTAAGAGGAGGAGGG - Intergenic
958195090 3:90234359-90234381 CTGTAAAGGTAAGAGCAGGATGG - Intergenic
958513346 3:95078296-95078318 CTGAAAAAGCAAGACTAGAAAGG - Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959519842 3:107313022-107313044 TTGCAAAAACTTGAGGAGGAAGG - Intergenic
959662434 3:108883942-108883964 GTGCAAAAGCACAAGGGGGAAGG - Intergenic
959666203 3:108924675-108924697 CTCCAAAAGCTAGAGAAAGAGGG - Intronic
960140489 3:114147558-114147580 CTGAAAAAGCAAGGGGAGAGGGG + Intronic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
960666252 3:120111831-120111853 CTCAAAAAGCAAGAGGGTGAGGG + Intergenic
961412196 3:126730538-126730560 CTGCAAAGGAAAGAGAAGAAAGG - Intronic
961600957 3:128061754-128061776 GTGAAAAGGCAAGAGGGGGATGG + Intronic
961747065 3:129070954-129070976 CTGTAAAATGGAGAGGAGGAAGG - Intergenic
961834907 3:129649602-129649624 TTGCCAAAGCAAAAGGAGGCTGG + Exonic
962518340 3:136174571-136174593 GAGCAAAAGGAAGGGGAGGATGG + Intronic
962739910 3:138355987-138356009 CTGCAAAAGCCAGCGAAGGCTGG + Intronic
963403694 3:144835921-144835943 CTGCAATATAAAGAAGAGGAGGG - Intergenic
965380457 3:167981751-167981773 CTGTAAAAACAAGAAGAAGAAGG - Intergenic
965885247 3:173437490-173437512 GTTCAAAAGCAGGAGGAGCAAGG - Intronic
965998180 3:174912589-174912611 CTGCGAAAGCTAGAAAAGGAGGG - Intronic
967599585 3:191369896-191369918 CTGCAAAGACAAGAGGAGAATGG - Intronic
967932003 3:194696706-194696728 CTGCAGACGCAAGAGAGGGAAGG - Intergenic
968106840 3:196007287-196007309 CTGAAAAAGAAAGAGAAAGAAGG - Intergenic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
968945047 4:3659185-3659207 CTCCAAAAGCGGGAGGATGAAGG + Intergenic
969176258 4:5401076-5401098 CTGCAGAAACAAGAGGGGAATGG + Intronic
969208328 4:5665584-5665606 CAGCACAAGGGAGAGGAGGAAGG + Exonic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
970601337 4:17643091-17643113 CTGGAAGAGCAAGAGCAGGGGGG + Intronic
970603025 4:17655199-17655221 CAGCAAGGGAAAGAGGAGGAAGG - Intronic
971797512 4:31247243-31247265 CAGCAAAAGCTATAGTAGGAGGG + Intergenic
971903024 4:32686945-32686967 CTGCAAAAGCAAATGGTGGTGGG + Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972639595 4:40913575-40913597 CCGCAAAAGCACCAGGAGTATGG - Intronic
973056332 4:45663971-45663993 TTGCAAAAGCAACTGAAGGAGGG - Intergenic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973857828 4:55031222-55031244 CGGCAAAGGCAAAAGGAGGTGGG - Intergenic
974909320 4:68097406-68097428 CAACAAAAGCAAGAGGAGAATGG - Intronic
975263308 4:72331065-72331087 CTGCAAAAGCAAAGGGGGAAAGG + Intronic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976315993 4:83659724-83659746 CTTAATAAGCAAGAGCAGGAAGG + Intergenic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
978415833 4:108474915-108474937 GAGCAGAAGCAAGAGGAAGAGGG - Intergenic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980856192 4:138443249-138443271 CTGCAATAGCAACAGGAGTGAGG - Intergenic
980907292 4:138961028-138961050 ATTCAGAAACAAGAGGAGGAGGG - Intergenic
981013808 4:139952698-139952720 CTTCTAGAGCAAGAGGAGGTGGG - Intronic
981123864 4:141083410-141083432 GTAGAAAAGGAAGAGGAGGAGGG - Intronic
982094103 4:151905314-151905336 CTGGAATAGAAAGAGGAAGAAGG + Intergenic
982532281 4:156559891-156559913 CAGCAAAAGCAATACTAGGAAGG - Intergenic
982764250 4:159325806-159325828 CTGGAAAAGGAAGAGGAAGTAGG + Intronic
982893751 4:160890200-160890222 ATGCAGAAGCAAGAGAAAGAAGG + Intergenic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
983872101 4:172834537-172834559 CTGCCAAGGAAAGAAGAGGATGG + Intronic
983930907 4:173452353-173452375 GAGCAAAAGCAAGAGGAGGATGG + Intergenic
984196422 4:176663114-176663136 CTCCAAAATCAAGATGATGAAGG - Intergenic
984929616 4:184835169-184835191 GTGCAAATGGAAGTGGAGGATGG - Intergenic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988376492 5:30441972-30441994 CTCCAAAAAACAGAGGAGGAGGG + Intergenic
988715675 5:33824915-33824937 CTGCAAAAGCCACATGATGAAGG + Intronic
989334969 5:40305365-40305387 CTGCAAAATGAAGATGATGATGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990106968 5:52276682-52276704 GTGGAAAAGGAAGAGGAAGATGG - Intergenic
991726917 5:69545011-69545033 CTGCAAAGGGAAGAGCAGGAAGG + Exonic
991868040 5:71082863-71082885 CTGCAAAGGGAAGAGCAGGAAGG - Intergenic
991953434 5:71969459-71969481 ATGTAAAAGCAAGATTAGGAAGG + Intergenic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992133645 5:73720549-73720571 GGGAAAATGCAAGAGGAGGAAGG + Intronic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
994105270 5:95940960-95940982 CTGCAAAAAGAAGGGGGGGAGGG + Intronic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994660301 5:102645699-102645721 CTCCAAAAAATAGAGGAGGAGGG + Intergenic
995897301 5:117029832-117029854 CAGCTGAAGGAAGAGGAGGAAGG - Intergenic
996127771 5:119746024-119746046 CAGCAAAAGCATGAGAAGGCAGG - Intergenic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
996930347 5:128878941-128878963 CTCCAAATGCAAGTGGAAGAAGG + Intronic
997073973 5:130650093-130650115 TTCCAAAAGCAATAGAAGGAAGG - Intergenic
998459032 5:142295677-142295699 CGGCTTAAGCAAGAGCAGGAAGG - Intergenic
998962540 5:147504031-147504053 CTGCAAATGGAAGAGGCAGAAGG - Intronic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999383164 5:151136000-151136022 CTGCAGAAGCAATGGCAGGAAGG + Intronic
999724350 5:154422785-154422807 CTGCCAAAACAAGAGGAGATGGG + Intergenic
999900841 5:156085419-156085441 TGGCAAAAGCCAGAGGAAGAGGG - Intronic
1000022653 5:157331996-157332018 ATTTAAAAGCAAGAGGATGAAGG - Intronic
1000181571 5:158816791-158816813 CTGAAAAAAAAAGAGGAGAAAGG + Intronic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001487088 5:172127545-172127567 CTCCCAAGGCAGGAGGAGGAAGG - Intronic
1002123805 5:177026305-177026327 CTTCAGAAACAAGATGAGGAAGG - Intronic
1002637410 5:180615207-180615229 CTCCAAAAGGAAGTGGAGAAGGG - Intronic
1002942317 6:1728825-1728847 CAGAAAAAGAAAGAGGAGAAAGG - Intronic
1003522359 6:6868912-6868934 CTCCCAAAGAAAGAGCAGGAAGG + Intergenic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1005342682 6:24858099-24858121 CTGCAAAAGCAGGAGGGGAGAGG - Intronic
1005854517 6:29850591-29850613 CTGCAGCAGCGACAGGAGGAGGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006922769 6:37637374-37637396 CTGCAACGCCAAGAGGAAGATGG + Exonic
1007077183 6:39075280-39075302 CTGCTAGAGCAGGAGGAGGGAGG + Intronic
1007095971 6:39213443-39213465 ATACAAAATCAAGATGAGGAGGG - Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1008111834 6:47503360-47503382 GTGAAAAAGCTACAGGAGGAAGG + Exonic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1014073616 6:117211900-117211922 TGGCAAAAGCAAGAGCAAGAAGG + Intergenic
1014288739 6:119534075-119534097 CTGCAAGGGCTACAGGAGGATGG - Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014371059 6:120608128-120608150 CTTAAAAAGCCAGAGTAGGATGG + Intergenic
1014907815 6:127051159-127051181 CTGCCAATCCAAGAGGAGCATGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1017700300 6:157063065-157063087 CTTCAAATCCAAGATGAGGATGG - Intronic
1017723543 6:157261223-157261245 CTGCAAATGCAAGTGCAAGAAGG - Intergenic
1017889683 6:158628071-158628093 TTACAAAAGCAAGAGCAGGGAGG + Intronic
1018051818 6:160015895-160015917 CAGCAAAAGCAGGAGCAAGACGG - Intronic
1018279767 6:162172893-162172915 CTCCAGAAGAAAGAGGAAGAAGG + Intronic
1018316998 6:162566740-162566762 TTCCAAAAGACAGAGGAGGAGGG + Intronic
1018648360 6:165969292-165969314 CTGCCAAAGATAGAGGAGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020124272 7:5524317-5524339 CTCCAAGAGAAAGAGGAAGAGGG - Intergenic
1021226961 7:18039188-18039210 CTGCAAAATCGAAAGCAGGACGG + Intergenic
1021932830 7:25598659-25598681 CTGCTGAAGAAAGAGGATGAAGG + Intergenic
1022185312 7:27961600-27961622 CTGCAAGAGCCAGAGGTGGCAGG + Intronic
1022495835 7:30852574-30852596 ATGCTAAAGAAAGAGGAAGAAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023363650 7:39441425-39441447 CAGAGAAAGCAAGAGGAGCAAGG + Intronic
1023451274 7:40288206-40288228 TTCCAAAAGCAAGGAGAGGAGGG - Intronic
1023588179 7:41752516-41752538 TCCCTAAAGCAAGAGGAGGAAGG + Intergenic
1023998517 7:45176647-45176669 GAGCAAAGGCATGAGGAGGAAGG + Intronic
1024404918 7:48967913-48967935 TTGCAAAGGGAAGAGGAGAAAGG + Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1028806802 7:95037112-95037134 CTGGAAAAAAAAGAGGGGGAGGG + Intronic
1029805354 7:102990355-102990377 CTGAAAAAGCAAGACAAGAAGGG + Intronic
1029872021 7:103704553-103704575 CTTCAGAAGCAAGGGGAGGTGGG - Intronic
1030209379 7:106981246-106981268 CAGCAAAAGCAGGAGCAAGAGGG - Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1030855494 7:114550410-114550432 CTTCAAAAGAAAGATGAGGCCGG - Intronic
1031979581 7:128116029-128116051 CTGCAAATGCAGGAGGAGATAGG + Intergenic
1032119457 7:129145450-129145472 CTGGCAAAGAAAGAAGAGGAAGG + Intronic
1032417512 7:131748028-131748050 CTGCATATGTCAGAGGAGGAAGG + Intergenic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1033165790 7:139037648-139037670 CTAGAAAAGCAAGACGAGGTGGG + Intergenic
1033980338 7:147156510-147156532 CAGCAAAAGCAAGAGAAGTCAGG - Intronic
1034383909 7:150722241-150722263 ATTCAAGAGGAAGAGGAGGAGGG + Exonic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034610639 7:152365212-152365234 CTTCAAAAGCAACAGTAGGCTGG + Intronic
1034946492 7:155265754-155265776 CTGCAAGAGGAAGAAGAGGGCGG - Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1038341161 8:26686203-26686225 CTACAAAAGCACCATGAGGAAGG - Intergenic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1038743347 8:30234766-30234788 CTGCAAAGGTATGAGGAAGAGGG - Intergenic
1038911169 8:31966347-31966369 CTGGAAAAGCAATAAGAGTAGGG + Intronic
1039506601 8:38056957-38056979 CTGAAAAACCCAGAGGAGGCTGG - Intronic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1042676992 8:71332398-71332420 CAGGAAATGCAAGAGGAGCACGG - Intronic
1044394829 8:91698914-91698936 TTCCAAAAACTAGAGGAGGAGGG - Intergenic
1044613283 8:94115287-94115309 CTACATTAGGAAGAGGAGGAGGG - Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045722835 8:105133788-105133810 TTGCAACAGAAAGAGGAAGAAGG - Intronic
1047691327 8:127357747-127357769 CAGGAAAAGAAAGAGAAGGAAGG - Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048533852 8:135274348-135274370 AGGCAAAGGCAAGAGGTGGAAGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1049820366 8:144629757-144629779 CTGCGACAGGAAGAGGAGGAGGG + Intergenic
1050684665 9:8154233-8154255 CAGCAAAAGCATGGCGAGGAAGG - Intergenic
1050845498 9:10212236-10212258 AAGCAAAAGAAAGAGTAGGATGG + Intronic
1054771594 9:69088868-69088890 CTCAGAAAACAAGAGGAGGAAGG + Intronic
1054894546 9:70294109-70294131 ATTTAAAAGCAAGAGAAGGAGGG + Intronic
1055493088 9:76826143-76826165 CAGCACAAGCAATAGGAAGAAGG + Intronic
1055789638 9:79910130-79910152 CTGCCCAAGGGAGAGGAGGAGGG + Intergenic
1056095378 9:83248059-83248081 CTCCAAAAGGAGGAGGAGCAGGG + Exonic
1056427614 9:86492779-86492801 ATGCAAAAGCAAGAGCCAGAGGG - Intergenic
1057006224 9:91562937-91562959 AGGCAAAAGCAAGAGGAGACAGG - Intergenic
1057722681 9:97545612-97545634 CTGCAGAGCTAAGAGGAGGACGG - Intronic
1058478603 9:105367654-105367676 CTGCAAAAGCAAAAGGTGCCTGG - Intronic
1059924586 9:119195649-119195671 CTGCAGAAGTAACAGCAGGAAGG - Intronic
1060421498 9:123472693-123472715 CTGCAGAAGCAAGCAGAGTATGG + Intronic
1060433149 9:123568324-123568346 CTGCAAAAAAAAGAAGGGGAGGG - Intronic
1061105267 9:128525290-128525312 CTGCGAAGACAAGAGGAGGCAGG + Exonic
1061323849 9:129850094-129850116 CTACAAAAGCAAGAGGAAGCAGG + Intronic
1061484152 9:130911889-130911911 CTGCAAAGGGAAGATGGGGATGG + Intronic
1062021079 9:134319698-134319720 CTGCAAATGAAACAGGAGGCTGG + Intronic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1203733650 Un_GL000216v2:114943-114965 AAGCTAAAGGAAGAGGAGGAGGG - Intergenic
1188754117 X:33939147-33939169 AAGCAAAAGCAAGAGGTGGTGGG - Intergenic
1188891587 X:35617843-35617865 CCATAAAAGCAAGAGGAGAAAGG + Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189984671 X:46543662-46543684 CTGCCAAAGAAGGAGGAGCATGG - Intronic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1192611757 X:72573702-72573724 CTGCAGAAACAAGAGGAGGTAGG - Intergenic
1192635953 X:72817972-72817994 CTTCAAAAGGTAGAGGAGGAGGG - Intronic
1192645761 X:72902833-72902855 CTTCAAAAGGTAGAGGAGGAGGG + Intronic
1192793429 X:74406561-74406583 TGGCAAAAGCAGGAGGAAGAGGG + Intergenic
1193928137 X:87516388-87516410 CTACAAAAACAAGAGGGGAAAGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195778290 X:108432537-108432559 CTTAAAAAACAAGAGGAGGCCGG + Intronic
1195869709 X:109473197-109473219 CAGCAACAGGAAGTGGAGGAGGG - Intronic
1196193334 X:112815983-112816005 CTGCAAAATGAAGAGCAGGCAGG + Intronic
1196195297 X:112832938-112832960 AGGCAACAGCAGGAGGAGGAGGG - Intronic
1196230950 X:113220503-113220525 ATGCAAATACAAGAGGAAGAAGG + Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1197668365 X:129248000-129248022 ATGCAAAAGCAACAGGAGCTAGG + Intergenic
1197908453 X:131452765-131452787 CTGCAAAAAGTAGAAGAGGAGGG - Intergenic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1198233594 X:134716109-134716131 CTGGAAAGGAAAGGGGAGGAGGG - Intronic
1198500504 X:137240620-137240642 CTACAAAAACAAGTGGAGAAAGG + Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198625448 X:138567399-138567421 CTGCAACAGAAAGATGAGAAGGG - Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1199197609 X:145049421-145049443 ATGCAAAATGTAGAGGAGGAGGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1200043379 X:153386649-153386671 CGGCAAAAACAATAGGTGGAAGG - Intergenic
1200271416 X:154688181-154688203 CTGCAAAAGACAGAAGAGAATGG + Intronic
1200628045 Y:5546202-5546224 CTGCAATAGAAAGTGGTGGAGGG + Intronic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1202627361 Y:56873476-56873498 AAGCTAAAGGAAGAGGAGGAGGG + Intergenic