ID: 1162069604

View in Genome Browser
Species Human (GRCh38)
Location 19:8145906-8145928
Sequence CAGTGTGAGCTGTATGAATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162069604_1162069612 2 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069612 19:8145931-8145953 CCCTGACCCTGGGGACAGGAAGG 0: 1
1: 0
2: 4
3: 58
4: 470
1162069604_1162069614 6 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069614 19:8145935-8145957 GACCCTGGGGACAGGAAGGCAGG 0: 1
1: 0
2: 3
3: 101
4: 572
1162069604_1162069610 -2 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069610 19:8145927-8145949 TGCACCCTGACCCTGGGGACAGG 0: 1
1: 0
2: 3
3: 30
4: 260
1162069604_1162069607 -9 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069607 19:8145920-8145942 CTCACACTGCACCCTGACCCTGG 0: 1
1: 2
2: 7
3: 61
4: 367
1162069604_1162069618 28 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069618 19:8145957-8145979 GACGCATAGTAATGTGGAGATGG 0: 1
1: 0
2: 0
3: 2
4: 78
1162069604_1162069617 22 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069617 19:8145951-8145973 AGGCAGGACGCATAGTAATGTGG 0: 1
1: 0
2: 0
3: 5
4: 98
1162069604_1162069608 -8 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069608 19:8145921-8145943 TCACACTGCACCCTGACCCTGGG 0: 1
1: 0
2: 3
3: 26
4: 274
1162069604_1162069609 -7 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069609 19:8145922-8145944 CACACTGCACCCTGACCCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 316
1162069604_1162069619 29 Left 1162069604 19:8145906-8145928 CCCCATTCATACAGCTCACACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1162069619 19:8145958-8145980 ACGCATAGTAATGTGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162069604 Original CRISPR CAGTGTGAGCTGTATGAATG GGG (reversed) Exonic
902688281 1:18093250-18093272 CAGATTGAGCTGTAGGAAAGAGG - Intergenic
902724977 1:18329469-18329491 GAGTATCACCTGTATGAATGAGG - Intronic
903533632 1:24051629-24051651 AAGTGTGTGTTGAATGAATGTGG + Intergenic
903929622 1:26854865-26854887 ATGTGTGCCCTGTATGAATGTGG + Exonic
904281610 1:29424410-29424432 TAGTGTGAGGTGTATGGAGGTGG - Intergenic
906815105 1:48870690-48870712 CAGTAGGAGCTGTAGGAGTGGGG - Intronic
907510257 1:54952736-54952758 GAGTGTGAGCTCTGTAAATGTGG - Intergenic
908209317 1:61883660-61883682 CAGGGAGAACTGTATGAATCCGG + Intronic
911754396 1:101536386-101536408 CAGTGGGAGATTTATGAATGAGG - Intergenic
912155910 1:106919608-106919630 CAGTGTTAGTTGTATCAATGAGG + Intergenic
913709927 1:121472853-121472875 CAGTGTGACCTGGATGTAAGAGG - Intergenic
915281731 1:154827397-154827419 CAGTGTGAGATTGAGGAATGAGG - Intronic
915802287 1:158807327-158807349 CAGTAAGATCTGTAGGAATGAGG + Intergenic
916340072 1:163723679-163723701 CTGTGTGAATTGAATGAATGTGG - Intergenic
918091262 1:181297188-181297210 CAGGGTGACCTGTTTGCATGAGG - Intergenic
918726234 1:187927892-187927914 CACTGCTAGCTGTATGAATGGGG + Intergenic
919080522 1:192860380-192860402 CATTGTGAGCTTTATGAAAGGGG - Intergenic
920321065 1:205123008-205123030 CAGGGTGCACTGTGTGAATGAGG - Intergenic
921311767 1:213851633-213851655 CAGTGTGAGATTTAAGAGTGGGG - Intergenic
922623032 1:227005910-227005932 CAGGGTGAGCTGTCTGATTACGG + Intronic
923373811 1:233339946-233339968 AAGTGTTTGCTGAATGAATGAGG - Intronic
1064333489 10:14416384-14416406 CAGTGTTAGCTGTTTCAATGAGG - Intronic
1064385907 10:14891279-14891301 CAGTGTGTGTTGTGTGAATGGGG + Intronic
1066031596 10:31432239-31432261 AAATGTATGCTGTATGAATGAGG + Intronic
1067229999 10:44399471-44399493 CAGTGAGAGCTGCATTAATGGGG + Intergenic
1068385666 10:56324092-56324114 CAGGTTGCGCTGCATGAATGGGG - Intergenic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1072022221 10:91413417-91413439 TAGGGTGAGATGTAGGAATGAGG - Intronic
1073138419 10:101232184-101232206 CAGTGTGAGGTGCAGGGATGTGG + Intergenic
1076032241 10:127169468-127169490 CATTTTTAGCTGTATGAATATGG + Intronic
1076617668 10:131766896-131766918 GAGTGTGTGGTGCATGAATGCGG + Intergenic
1077419531 11:2444126-2444148 CAGTGGGAGCTGTGTGGGTGGGG - Intergenic
1079948258 11:26769847-26769869 CGGTGTGTTCTCTATGAATGTGG + Intergenic
1080318841 11:30982396-30982418 CAGTCTGAGTTGTATGAAAAAGG - Intronic
1082222654 11:49659063-49659085 CAGAGTAAGATGGATGAATGGGG - Intergenic
1082278817 11:50247701-50247723 CATCGAGAGCTGCATGAATGAGG - Intergenic
1085292861 11:75412397-75412419 CAGTGGGGGCTTGATGAATGAGG + Intronic
1086234659 11:84614294-84614316 CAGTGGCAGCTTTATGAAAGAGG + Intronic
1086626393 11:88960143-88960165 CAGAGTAAGATGGATGAATGGGG + Intronic
1086754826 11:90547294-90547316 CTGTGAGACCTGTATGACTGGGG - Intergenic
1088100082 11:106144975-106144997 CTGTGTGAGCTCTGTGAAGGTGG - Intergenic
1090573446 11:128072961-128072983 GAGTGTGAGCTGTTTGCAAGAGG - Intergenic
1090913991 11:131146378-131146400 TAGTGTTAGATGAATGAATGAGG + Intergenic
1091322860 11:134664277-134664299 CAGTGTGAGCAGAATGTGTGTGG - Intergenic
1091806941 12:3363686-3363708 CAGTGTGAGCTTAATGAAAGCGG - Intergenic
1098577252 12:72056803-72056825 CAGTGTAGGCTGCATGAATATGG - Intronic
1101409234 12:104455643-104455665 CGGTGTGCGCTGTATTAATTTGG - Intronic
1101822476 12:108194736-108194758 GAATGTGAGCTCTATGAAAGAGG + Intronic
1102722140 12:115026207-115026229 CAGAGTTGGCTGTTTGAATGAGG - Intergenic
1103243624 12:119436210-119436232 CAGAATTAGCTGTATGATTGTGG - Intronic
1104728375 12:131091938-131091960 CTGTGTTTGCTGTATGAATGAGG + Intronic
1104770141 12:131356380-131356402 CAGAGTGAGCTGCAGGCATGGGG + Intergenic
1104908117 12:132226182-132226204 CAGTGTGGGGTGTATGTGTGTGG - Intronic
1107124276 13:36829342-36829364 CAGTGAGAGCTGAATGAAAAGGG + Intergenic
1109267164 13:60215209-60215231 CAGTCTCAGCCGTATGAGTGGGG - Intergenic
1110793804 13:79614009-79614031 CATTGTGGGCTGTATGTGTGAGG - Intergenic
1116072912 14:40072203-40072225 TAGTGTAAGCTCTATGACTGAGG - Intergenic
1118178903 14:63471241-63471263 TTGTGAGAGTTGTATGAATGAGG - Intronic
1118642384 14:67804792-67804814 CATTGTGAGCTGTGTGACTTTGG + Intronic
1119735758 14:76980715-76980737 CAGTATGAGCTGAGTGACTGTGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123054981 14:105565071-105565093 CCGTGTGAGCTGTGTGCACGTGG + Intergenic
1123079423 14:105684650-105684672 CCGTGTGAGCTGTGTGCACGTGG + Intergenic
1124154716 15:27215744-27215766 CAGTTTGTGCTGGATGAATGTGG + Intronic
1124370049 15:29099386-29099408 CAGTGTGTCCTGTGTGACTGCGG - Intronic
1125759700 15:42088222-42088244 CACTGTAAGGGGTATGAATGAGG + Intronic
1126347994 15:47717146-47717168 CACTGCGAGCTGGATGACTGAGG + Intronic
1126676264 15:51161494-51161516 CAGTGTGAGTTGTGGGACTGAGG - Intergenic
1127762106 15:62149623-62149645 ATGTGTGAGCTGGAGGAATGAGG + Intergenic
1127814953 15:62599794-62599816 GAGGGTGAGCTGTGTGAACGTGG + Intronic
1128783035 15:70375425-70375447 CAGTTTGAGCTCTATGGGTGAGG - Intergenic
1129120136 15:73391285-73391307 CAGTGGGAGCTGTCCAAATGGGG - Intergenic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1136231656 16:28889135-28889157 CAGAGTGAGCTGTCTGGCTGGGG - Intronic
1138002305 16:53294553-53294575 AACTGTTAGCCGTATGAATGAGG - Intronic
1138311091 16:56024591-56024613 CAGAGTGTGGTGTGTGAATGAGG - Intergenic
1140211321 16:72972846-72972868 CATGGAGAGCTGTAGGAATGGGG - Intronic
1141236271 16:82220357-82220379 GTGTGTGAGGTGTATGAATGTGG + Intergenic
1142652220 17:1361930-1361952 CAGTGTTAGCTGCTGGAATGAGG + Exonic
1145758774 17:27412728-27412750 CAGTGTTAGCTGCTGGAATGAGG + Intergenic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1148792338 17:50180399-50180421 CTGTGTGATATGGATGAATGGGG - Intergenic
1151030268 17:70729758-70729780 CAGTGTGAGCATTCTGAATTAGG + Intergenic
1151913291 17:77098739-77098761 CGGGGTGAGCTCCATGAATGAGG - Intronic
1152023493 17:77794230-77794252 CAGTGTGAAAATTATGAATGAGG - Intergenic
1153579037 18:6552880-6552902 CAGTGTGACCTGTATGGCTATGG + Intronic
1157441652 18:47716317-47716339 CAGTGTGAGCTATATGAACCAGG + Intergenic
1157589312 18:48826881-48826903 GATTGTAAGCTGGATGAATGTGG + Intronic
1158316411 18:56215504-56215526 AAGTGTGATCTTTATGAAGGTGG - Intergenic
1160307465 18:77753490-77753512 CAGTGTTAGCTTTATGCTTGAGG - Intergenic
1162069604 19:8145906-8145928 CAGTGTGAGCTGTATGAATGGGG - Exonic
1165354856 19:35297666-35297688 CAGTGTGTGGTGTATGTGTGTGG - Intronic
1165354893 19:35298107-35298129 CAGTGTGTGGTGTATGTATGTGG - Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
1166925175 19:46261893-46261915 CAGGGTCAGCTGTAAGACTGTGG - Intergenic
925164908 2:1709988-1710010 CAGTGTGTGCTGTTTGCATTGGG - Intronic
925537583 2:4933998-4934020 CACTGTGAGCTGGATGTCTGCGG - Intergenic
926482490 2:13417224-13417246 GAGTGTGAGTGGTATGACTGTGG - Intergenic
927146200 2:20168182-20168204 CAGGCTGAGCTGCCTGAATGGGG - Intergenic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
929773056 2:44909000-44909022 CAGTGTCAGCTTTATGGATAGGG - Intergenic
929807311 2:45158269-45158291 CAGTGTAAGCTCCATGAGTGTGG + Intergenic
935159685 2:100519056-100519078 CACTGTGGGCTGTATGAGGGAGG + Intergenic
935570943 2:104659587-104659609 CAGGTCGAGCTGAATGAATGGGG + Intergenic
935868035 2:107413102-107413124 CTTTGTCAACTGTATGAATGTGG + Intergenic
939013372 2:136873311-136873333 CGGTGTGAAATGTAAGAATGTGG - Intronic
942792253 2:179774141-179774163 GACTGTGATGTGTATGAATGTGG + Intronic
947195646 2:227564172-227564194 CACTGTGATGTGTCTGAATGTGG + Intergenic
947548867 2:231032426-231032448 CAATGTGAGCTGTATCTGTGGGG - Intergenic
948771206 2:240252021-240252043 CAGGGTGAGCTAGATGGATGGGG - Intergenic
1169912463 20:10658166-10658188 GACTGTGAGCTGGAGGAATGGGG + Intronic
1172322922 20:34010925-34010947 AACTGTGAGCTCTATGAAGGCGG + Intronic
1173309150 20:41881346-41881368 CAGGGTGAGCTATAAGAAAGTGG + Intergenic
1173397271 20:42691117-42691139 CAATGTCAGCTTTATGCATGTGG + Intronic
1174295743 20:49543811-49543833 GAGTGTCAGCTGTGTGAATTTGG + Intronic
1174538260 20:51269527-51269549 CAGCGTGTGCTGTGAGAATGGGG - Intergenic
1175991283 20:62790760-62790782 CGATGTGAGCTGCATGACTGAGG - Intergenic
1177101363 21:16900728-16900750 CAGTGTGAGGGGAAAGAATGAGG - Intergenic
1178494451 21:33075278-33075300 CCGTGTGAGCAGAAAGAATGTGG - Intergenic
1179602188 21:42486767-42486789 CAGAGTGAGGTGTATGGATGTGG + Intronic
1179831790 21:44001451-44001473 CAGAGTGAGCTGAAGGCATGTGG + Intergenic
1180026622 21:45167253-45167275 CAAAGTGAACTGTATGAATTAGG + Intronic
1181904248 22:26180913-26180935 CAGAGTGAGCATTCTGAATGGGG + Intronic
1181911680 22:26243401-26243423 CAGAGAGAGCTGAGTGAATGAGG + Intronic
1182035334 22:27193889-27193911 GCTTGTGAGCTGTATGAAAGAGG - Intergenic
949232845 3:1771965-1771987 CAGTGTGAGGTATTTGAAGGTGG + Intergenic
950652359 3:14415267-14415289 CAGTGTGAGCCTGTTGAATGTGG + Intronic
951179331 3:19640640-19640662 CAATGTGTGCTGCAAGAATGAGG + Intergenic
951448537 3:22810774-22810796 CAGTGAAAGCTATGTGAATGTGG + Intergenic
954377961 3:50204904-50204926 CAGTGAGAGATGCTTGAATGGGG - Intergenic
955958813 3:64318092-64318114 CAGTGTTAGCTGTTTTAAGGTGG - Intronic
956035390 3:65085145-65085167 CAGTGAGAACTGTTGGAATGAGG - Intergenic
959412648 3:106044693-106044715 TACTGTGTGCTGAATGAATGAGG + Intergenic
960161541 3:114355509-114355531 CATTGTGTGCTGGAGGAATGAGG - Intronic
964477746 3:157111731-157111753 GAGATTGAGCTGGATGAATGGGG - Intergenic
965072247 3:163929286-163929308 GAATGTGAGCTATATGACTGAGG - Intergenic
966111475 3:176407740-176407762 CAGTGTTTGCTGAAGGAATGAGG - Intergenic
971951347 4:33351845-33351867 TAGTGTGAGTAGAATGAATGCGG - Intergenic
973716304 4:53680556-53680578 CATTGTGAGTTGTATCAATTAGG - Intronic
975426872 4:74239630-74239652 AAGTGTGGGCTTTATGATTGTGG + Intronic
975893856 4:79062432-79062454 CAATGTGAGGTGTGGGAATGGGG - Intergenic
976353973 4:84093446-84093468 TAGTGTGATGTGTATGAGTGTGG + Intergenic
977578692 4:98701523-98701545 CAGTGGGAGATGTATGGATAGGG - Intergenic
983882186 4:172945673-172945695 CTGTGTGAGCTGTTTGTAGGTGG - Intronic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG + Intergenic
986771143 5:10974990-10975012 TAGTGGTAGCTGAATGAATGAGG + Intronic
990233216 5:53737907-53737929 CTGTGTGAGATGTCTGAGTGGGG - Intergenic
994944321 5:106366257-106366279 GTGTATGAGCTGTATGTATGGGG - Intergenic
998529571 5:142872141-142872163 CAGTGTATGCTGAATAAATGTGG - Intronic
998972329 5:147606380-147606402 CAGTTTGAGTTTTCTGAATGTGG + Intronic
1003730290 6:8814087-8814109 GAGTGTGAGCTCTTTGAAAGAGG + Intergenic
1006313156 6:33275714-33275736 CTTTGTGAGCTTTTTGAATGAGG + Intronic
1006906728 6:37537933-37537955 CCGTGTGAGCTGTGTGGCTGCGG + Intergenic
1008675495 6:53813646-53813668 CACTGTGAGCTGTAGGAATCAGG + Intronic
1011165928 6:84445822-84445844 AGGTGTGAGCTGTAAGAATAAGG + Intergenic
1014575757 6:123070145-123070167 AATTGTTAGCTATATGAATGAGG - Exonic
1016429869 6:143972177-143972199 AAATGCGAGCTGAATGAATGGGG - Intronic
1019102654 6:169643887-169643909 CAGTGTGACTTGTATGAACTGGG - Intronic
1019102829 6:169645957-169645979 CAGTGTGAGTCGTATGAACTAGG - Intronic
1022092470 7:27116534-27116556 CAATCTGAGCTCTATAAATGTGG + Intronic
1025152366 7:56568598-56568620 CAGTGTTAGCTGCTGGAATGAGG + Intergenic
1025764834 7:64434185-64434207 CAGTGTTAGCTGCTGGAATGAGG - Intergenic
1028460257 7:91084527-91084549 CAGTGGGAGCTGTGTGGAAGAGG - Intronic
1031125583 7:117770411-117770433 CAGTGTGTGCTGGCTGCATGGGG + Intronic
1032538567 7:132684890-132684912 CAGTGTGTGGTGGATGAGTGGGG - Intronic
1034968919 7:155407572-155407594 GAGTGTGGGGTGTGTGAATGTGG + Intergenic
1034968984 7:155407842-155407864 GAGTGTGGGGTGTGTGAATGTGG + Intergenic
1036908433 8:12729498-12729520 CAGTGTGAGCTTAGTGAACGGGG - Intronic
1037332253 8:17754822-17754844 CTGTATGAGCTCTGTGAATGTGG + Exonic
1037917671 8:22782351-22782373 CAGTGTGTGTTGAATGAATGAGG - Intronic
1038569327 8:28646917-28646939 TAGTGTATGCTGAATGAATGGGG - Intronic
1039826474 8:41178392-41178414 CAGTGTGGACTAGATGAATGAGG - Intergenic
1039992557 8:42501910-42501932 AAGTGTCAGCTGTATGTTTGGGG - Intronic
1040323249 8:46328950-46328972 CAGTGTGGCCTGTATGGGTGGGG - Intergenic
1040851693 8:51907510-51907532 CAGTGTGAGCCATATGAACGTGG - Intergenic
1041575626 8:59391503-59391525 GATTCTGAGCTTTATGAATGAGG - Intergenic
1041707208 8:60859279-60859301 CAGTGTTACCTGGATGAAAGAGG + Intronic
1045176193 8:99727654-99727676 CAGTGGGAGATGAATGAATCAGG - Intronic
1045804260 8:106138840-106138862 GAATGAGAGCTGAATGAATGGGG + Intergenic
1045845417 8:106629402-106629424 CAGTGTAAGTTCTATGAATAGGG + Intronic
1046943821 8:119956401-119956423 CAGTGTGAGCTTTAGGACTGAGG - Intronic
1047079227 8:121442080-121442102 CTGTTTGAGATGTATAAATGTGG - Intergenic
1050870412 9:10560942-10560964 AAGTGTGATCTTGATGAATGTGG + Intronic
1050910013 9:11056237-11056259 CAGTGTGACCTGGATGCAAGAGG + Intergenic
1051846903 9:21462249-21462271 TACTGTGAGCTGTGTGAATCAGG + Intergenic
1053559996 9:39182349-39182371 GAATATTAGCTGTATGAATGAGG - Intronic
1053748565 9:41230192-41230214 CAGTGTGTGGTGTCTGTATGGGG + Intergenic
1053824103 9:42002570-42002592 GAATATTAGCTGTATGAATGAGG - Intronic
1054137120 9:61436606-61436628 GAATATTAGCTGTATGAATGAGG + Intergenic
1054606471 9:67184794-67184816 GAATATTAGCTGTATGAATGAGG + Intergenic
1055170124 9:73247068-73247090 CAGTGTGTGCTGAATCAATAGGG + Intergenic
1057305629 9:93910578-93910600 CAGTGTGACCTGTGTCTATGGGG - Intergenic
1057961223 9:99459197-99459219 CACAGTGAGCTGTGTAAATGTGG - Intergenic
1058231760 9:102435056-102435078 CAGTTTGAGCAGAATTAATGTGG + Intergenic
1062303743 9:135890215-135890237 GGGTGTGAGCTGTATGTGTGTGG - Intronic
1203445536 Un_GL000219v1:51165-51187 CAGTGTGTGGTGTCTGTATGGGG - Intergenic
1186755824 X:12670535-12670557 CAGTTTGAGCTTTCTGCATGTGG - Intronic
1189163536 X:38835918-38835940 CAGTCTGAGCTGAAGAAATGTGG - Intergenic
1190905422 X:54722404-54722426 CAGTGTAAGCTCTATGAAGGTGG + Intergenic
1198736497 X:139791428-139791450 CAGTTTGGGCAGTATGAATCTGG + Intronic
1200334455 X:155335026-155335048 CTGTGTGAGCAGTAGGATTGGGG - Intergenic
1201305543 Y:12546894-12546916 CAGTTGGAGCTTTATGACTGTGG + Intergenic