ID: 1162069787

View in Genome Browser
Species Human (GRCh38)
Location 19:8146904-8146926
Sequence ACAAGGAGGTTGTAGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162069782_1162069787 -5 Left 1162069782 19:8146886-8146908 CCAGAGAGACAGACAGACACAAG 0: 1
1: 0
2: 4
3: 72
4: 532
Right 1162069787 19:8146904-8146926 ACAAGGAGGTTGTAGGGCAAAGG 0: 1
1: 0
2: 0
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162069787 Original CRISPR ACAAGGAGGTTGTAGGGCAA AGG Intronic
901650172 1:10738544-10738566 ACAAGGAGGCTGCAGGGCCATGG + Intronic
902936160 1:19766317-19766339 ACAAGGATCTTGTAAGGAAAAGG - Intronic
903239149 1:21971072-21971094 CCAAGGAGGTTATTGAGCAATGG - Intergenic
903243057 1:21996748-21996770 CCAAGGAGGTTATTGAGCAATGG - Intronic
903487387 1:23700563-23700585 AAAAGGAGCTTGAAAGGCAAAGG + Intergenic
903934703 1:26887445-26887467 ATAGGGAGGTTGTTGGGAAAGGG - Intronic
904470101 1:30730686-30730708 ACAAGGAGATTGAAGGGCCATGG - Intergenic
905295488 1:36951839-36951861 AGAAGGAGGTTGGAGGGCGGAGG + Intronic
906241416 1:44244630-44244652 ACAAGGAGGCTGAAGGGGAGGGG - Intronic
907373288 1:54016664-54016686 GCAGGGAGGTTGGAGGGCCAGGG - Intronic
907483669 1:54761897-54761919 ACAAGGAAGTTATAGAGCCAGGG - Intronic
908697884 1:66865382-66865404 ACACCCAGGTTGAAGGGCAATGG - Intronic
908730068 1:67216954-67216976 GGGAGGAGGTTGTAGGGTAAAGG + Intronic
909162021 1:72164049-72164071 ACAAGAAGGTTGGATGGGAAAGG + Intronic
910179893 1:84470845-84470867 ACAAGTATGTGGTAGGACAAAGG - Intergenic
910847659 1:91618843-91618865 AAAAGGTGGTTGTATGGAAAAGG - Intergenic
913609816 1:120500116-120500138 ACAAGTAAGGTGTAGGACAAAGG - Intergenic
914581375 1:149022125-149022147 ACAAGTAAGGTGTAGGACAAAGG + Intronic
915999307 1:160599458-160599480 ACATGGAGGATGTTTGGCAAGGG + Intergenic
919071948 1:192766975-192766997 AAAAGGAGATTGTAGGGGGAGGG + Intergenic
919969556 1:202565469-202565491 ACATGGAGTTTGGAGGGCAGGGG + Intronic
920089468 1:203441925-203441947 ACAAGGAGGATGGAGGAAAAAGG + Intergenic
921636722 1:217504226-217504248 ACAATGATGTTGTAGGAAAATGG + Intronic
924754951 1:246932101-246932123 AGAAGGAGGTGGGAGGGAAAGGG + Intergenic
1062823088 10:549342-549364 ACAAGGACGTCTTAGAGCAATGG - Intronic
1063270806 10:4508441-4508463 ACATGGAGGTTGGAGGAAAAGGG - Intergenic
1064494386 10:15893077-15893099 AGAATGAGGTTGTAGGGGATGGG - Intergenic
1068456710 10:57264521-57264543 ACTAGACGGTTGTAAGGCAAAGG + Intergenic
1068916813 10:62441820-62441842 ACTAGGAGGTGGCAGGGAAATGG + Intronic
1068962064 10:62877038-62877060 ACAGGGAGGCTGCAGGGGAAGGG - Intronic
1073205281 10:101766023-101766045 ACTAGAAGGTAGCAGGGCAAGGG - Intergenic
1074332733 10:112534662-112534684 ACAAAAAGGTTGGAGGGCGAGGG - Intronic
1074579057 10:114699219-114699241 AAAAGGAGGTTGTTGGAAAAGGG + Intergenic
1075337958 10:121622310-121622332 ACAAGAAGGATGGAGGGGAAGGG + Intergenic
1075352222 10:121734150-121734172 AGAAGGAGGATATAGGGGAAAGG + Intergenic
1078081001 11:8204735-8204757 ACAAGGAGGCCGTAAGGTAAGGG - Intergenic
1078246861 11:9581392-9581414 ACAAGCAGGTTGAAGGGAGAAGG + Intronic
1078361269 11:10669733-10669755 GCAAGGAGGGTGAAGGGTAAGGG - Intronic
1084946163 11:72639756-72639778 GCAAGGAGGATGAAGGGCAAAGG + Intronic
1085083722 11:73653035-73653057 ACATGGAGGTGGTGGGGAAAGGG - Intronic
1086573018 11:88306624-88306646 AGAAGGAGGATGGAGGGGAAAGG - Intronic
1088827041 11:113504685-113504707 ACAAGGAGGTTCTGGGGTTATGG - Intergenic
1090134480 11:124183090-124183112 TCAAGGAGGTTGTTGAGCAAAGG - Intergenic
1090489697 11:127147871-127147893 GCAAGGAGTCTGTGGGGCAAGGG + Intergenic
1091527913 12:1323966-1323988 ACAGGGAGGTGGGAGGGCAGGGG - Intronic
1095875097 12:47071419-47071441 AAAAGGAGGCAGGAGGGCAAAGG + Intergenic
1096069456 12:48766905-48766927 TCAAGGAGGTTGCAGGGAAAGGG + Exonic
1096258306 12:50075828-50075850 TCAAGGAGGCTGTGGGGAAAAGG + Intronic
1098046244 12:66403751-66403773 ACATAGAGATTGTAGGGGAAGGG + Intronic
1099622510 12:85022327-85022349 AGAATGAAGTTGGAGGGCAATGG + Intronic
1101201020 12:102436490-102436512 CCTAGGAGGTTATAGGGCAAAGG - Intronic
1102380635 12:112463474-112463496 ACAAAGAGCTTGTGTGGCAATGG + Intronic
1103496302 12:121364988-121365010 ACAGGGAGATTGGAGGACAAGGG - Intronic
1103905533 12:124325553-124325575 ATCAGGGGGTTGTAGGGGAATGG + Exonic
1106235099 13:27854556-27854578 ACAAAGACGGTGTAGAGCAAAGG - Intergenic
1106590567 13:31095025-31095047 GCAAGGAGTTTTTAGGGGAAAGG + Intergenic
1107774678 13:43825389-43825411 AAAAGGAGGGGGTAGGGCAAGGG + Intronic
1107774743 13:43825787-43825809 AAAGGGAGGGAGTAGGGCAAGGG + Intronic
1110774391 13:79390790-79390812 AAAATAAAGTTGTAGGGCAAGGG + Intronic
1111581142 13:90225321-90225343 ACAAGGAGGTTGAAGAGTGAGGG + Intergenic
1114320549 14:21543845-21543867 AAAGGGAGGTTGTGGGGGAAGGG + Intergenic
1114708611 14:24753720-24753742 ACATGGAGTTTCTAGGGCATGGG + Intergenic
1115682450 14:35756658-35756680 TCAGGGAGGTTGGAGGGGAAGGG - Intronic
1117346895 14:54841527-54841549 GAAAGGAGGTTGTTGGGCATGGG + Intergenic
1118001406 14:61526870-61526892 ACAAGGAGGCTGCAGGTCACGGG - Intronic
1121556368 14:94840862-94840884 ACAAGGAGATTACAGGGAAAGGG + Intergenic
1121969650 14:98344479-98344501 AAAAGGAGGTTGCAGGAAAAAGG + Intergenic
1122567061 14:102666920-102666942 AAAAGGGGGTTGTATGGAAAGGG - Intronic
1123915987 15:25027895-25027917 TAAAGAAAGTTGTAGGGCAAGGG + Intergenic
1124096371 15:26652090-26652112 ATAAGGGGGTTGTGGGGCTAAGG - Intronic
1128376031 15:67076676-67076698 GCAAGGAGACTGTAGGGCCAAGG + Intronic
1130096416 15:80859525-80859547 ACAAGGGCCTTGTGGGGCAAAGG - Intronic
1131653469 15:94428495-94428517 ACAAGGAATTTTTAGGGGAAGGG + Intronic
1133669591 16:8005377-8005399 ACAAAGAGGTTTCATGGCAAAGG + Intergenic
1133957544 16:10458118-10458140 ACAAGGAGGCTCTAAAGCAAAGG + Intronic
1136296567 16:29307402-29307424 GCAAGGAGGTTCTGAGGCAAGGG - Intergenic
1138445017 16:57058254-57058276 ACAAGGACTGTGGAGGGCAAGGG + Intronic
1141342186 16:83213404-83213426 ACAAGGAGGGGGTGGGGGAATGG - Intronic
1141873742 16:86807172-86807194 ACAAGGAGGCTGGAAGGCAGCGG + Intergenic
1142058191 16:88013713-88013735 GCAAGGAGGTTCTGAGGCAAGGG - Intronic
1143779899 17:9223883-9223905 GCAAGGAGGTAGGAGGGGAAGGG + Intronic
1144819045 17:18058624-18058646 ACAAGGCAGGTGTAGGGCAGTGG + Intronic
1146769522 17:35555864-35555886 AAAAGGAGATGCTAGGGCAAGGG - Intronic
1147556620 17:41483548-41483570 AAAAGGAGGAAGGAGGGCAAAGG - Intergenic
1148210599 17:45806285-45806307 TCAGGGAGGTTAAAGGGCAAAGG + Intronic
1148949583 17:51298847-51298869 AAAAGGAGGAAGTAGGGGAAGGG - Intergenic
1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG + Intronic
1151301297 17:73229037-73229059 TCAAGGAGGTTGCATGGCAGAGG + Intronic
1151309086 17:73282510-73282532 GGAAGGAGGTGGTAGGGCAGGGG + Intergenic
1151932303 17:77240386-77240408 ACAAGGAGATTGGAGAGCACTGG + Intergenic
1152966700 18:122650-122672 ACATGGGGCTTGGAGGGCAAAGG + Intergenic
1154927287 18:20949410-20949432 ACATGGGGCTTGGAGGGCAAAGG - Exonic
1157779618 18:50426072-50426094 ACCAGGAGGTTGGAGTGCAGTGG - Intergenic
1162069787 19:8146904-8146926 ACAAGGAGGTTGTAGGGCAAAGG + Intronic
1163503478 19:17689456-17689478 GCGAGCAGGTTGCAGGGCAAGGG - Intergenic
1163813092 19:19446927-19446949 GGAAGGAGGTTGAAGGGCAGTGG + Intronic
1164474525 19:28564960-28564982 ACAAGGTGGTTGTAAGACAGTGG - Intergenic
1165826562 19:38709074-38709096 AAAACCAGGTTTTAGGGCAAGGG + Intronic
1167051252 19:47080129-47080151 ACAAGGAGGTTCTAGGAGATTGG - Intronic
925645529 2:6031968-6031990 ACTAGGAGGTAGTTGGGCAAGGG + Intergenic
927272804 2:21231537-21231559 AGAGGGAGGATGTAGGGCAAAGG + Intergenic
930144452 2:47987081-47987103 TGAAGGAGGATGGAGGGCAACGG - Intergenic
934602116 2:95665670-95665692 AAAAAGAGATTGAAGGGCAAGGG - Intergenic
934724474 2:96606553-96606575 GGAAGGAGGGTGTAGGGGAAAGG + Intronic
935723892 2:106006456-106006478 AGGAGGAGGTTGTAGGGATATGG + Intergenic
937083629 2:119157252-119157274 GAAAGGAGGCTGCAGGGCAAGGG + Intronic
942785443 2:179696130-179696152 ATAAGCAGGTGGTAGGTCAAGGG + Intronic
942794945 2:179806937-179806959 ACTATGAGGATGTAGAGCAATGG + Intronic
943345887 2:186736228-186736250 ACCAGGCAGATGTAGGGCAATGG + Intronic
947123261 2:226839465-226839487 ACAGTGAGGTTGAAGGGCACAGG + Exonic
947351680 2:229252880-229252902 ACAAGGAGGTGGGTGGGGAAGGG + Intronic
948738877 2:240030023-240030045 ACAAGGACGTGGTAGCGCAGCGG + Exonic
948740951 2:240045666-240045688 ACAAGGACGTGGTAGCGCAGCGG + Exonic
1168989511 20:2082243-2082265 TGAAGGAGGTTGAAGGTCAAAGG + Intergenic
1169087540 20:2836649-2836671 AAAAGGAAGTTGTTGGGGAAGGG - Intronic
1169949452 20:11027248-11027270 AAAAGGAGGTTTCAGGGCATAGG - Intergenic
1172563170 20:35907046-35907068 ACAAGGGGGTGGTAGCTCAAGGG - Intronic
1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG + Intronic
1173230960 20:41197530-41197552 ACAAGGAGGTTGAAAGTAAAAGG - Intronic
1173708796 20:45136377-45136399 AAAAGGAGCTTGGAAGGCAAAGG + Intergenic
1175569140 20:60005991-60006013 AGGAGGAAGTTGTAGGGCCATGG - Intronic
1176085298 20:63293082-63293104 ACAGGAAGGGTGGAGGGCAAAGG + Intergenic
1181092733 22:20485287-20485309 ACAAGGTGGGTGTAGGGTCAGGG + Intronic
1182977203 22:34634571-34634593 AAAACGAGGTTGTAGGGGGATGG + Intergenic
1183738428 22:39656740-39656762 GCAAGGATGTGGCAGGGCAAAGG - Intronic
953334294 3:42080710-42080732 CCCAGGAATTTGTAGGGCAAAGG - Intronic
956296922 3:67725029-67725051 ACAAAGAGGTTGTGGGGGAGGGG - Intergenic
957198677 3:77103361-77103383 GCAAGGAGGTTGTGGTTCAAAGG + Intronic
960695444 3:120391495-120391517 ACTAGGAGAGTGTAGGGTAAGGG - Intergenic
961007733 3:123416098-123416120 CCAAGAAGGTGGAAGGGCAAAGG + Intronic
961349397 3:126289969-126289991 AAAAGGAGCATGTAGGGGAATGG + Intergenic
961714689 3:128850189-128850211 AGAAGGAGGTGGCAGGGCAGAGG + Intergenic
962132686 3:132698751-132698773 ACAGGCAGGTTGTGGGGAAAAGG - Intronic
965638839 3:170812092-170812114 AGGAGGAGGTTATAGGGCTATGG - Intronic
968513161 4:1004079-1004101 ACAAAGAGGTTGAAGGTCGATGG - Exonic
970116894 4:12707473-12707495 ACAGTGAGGAAGTAGGGCAAAGG + Intergenic
971147489 4:23994727-23994749 GAAAGAAGGCTGTAGGGCAAGGG + Intergenic
974802490 4:66836236-66836258 AGAAGGAGGTTGGAAAGCAATGG + Intergenic
975350217 4:73337930-73337952 AAAAGGAGATTGTAGGGTGATGG - Intergenic
975528119 4:75373528-75373550 AGAAGGAGGTGGTAGGACCAGGG + Intergenic
976278698 4:83305167-83305189 ACAAAGAGTTCGTAAGGCAAAGG + Intronic
976332128 4:83844719-83844741 ACAAGGAGGTGATAGAGCCATGG + Intergenic
978138756 4:105294464-105294486 CCAGAGAGGTGGTAGGGCAAAGG - Intergenic
982913567 4:161176311-161176333 ACACTGAATTTGTAGGGCAAAGG + Intergenic
983160853 4:164412639-164412661 ACAAACAGGTTGTTGGCCAAAGG - Intergenic
985070437 4:186162446-186162468 TCCCGGAGGTTGGAGGGCAAGGG - Intronic
985131769 4:186745753-186745775 ACATGGGGGTTGCAGGGGAAGGG - Intergenic
985663835 5:1171683-1171705 ACAAGGGGGCTGTGAGGCAAAGG - Intergenic
985667516 5:1189149-1189171 TCAAGGAGGGTTGAGGGCAATGG + Intergenic
986784535 5:11101356-11101378 TCAACAAGGTAGTAGGGCAATGG + Intronic
986987173 5:13513167-13513189 ACTAGGTTGTTGTATGGCAAGGG + Intergenic
987000545 5:13655579-13655601 GCAAGGAGGGTGTAGGGTCATGG - Intergenic
987000598 5:13655845-13655867 GCAAGGAGGGTGTAGGGTCATGG - Intergenic
987085680 5:14465505-14465527 AAAAGGAGGGGGTGGGGCAAGGG - Intronic
987245856 5:16047969-16047991 ACAAGGAGACTGGAGGCCAAGGG - Intergenic
991021665 5:61985698-61985720 ACCAGGATGTTGTAGGGAAGAGG - Intergenic
991339099 5:65585815-65585837 TCAAGGTGGTGGTTGGGCAATGG + Intronic
992534521 5:77685437-77685459 ACAATGAGGGTATAGGGAAATGG - Intergenic
994452318 5:99957812-99957834 ACAAGGATGAAGTAGGGAAATGG - Intergenic
994694458 5:103056876-103056898 AGAAGGAGGGTGTAAGGCACAGG + Intergenic
996086691 5:119312089-119312111 GAAAGAAGGTGGTAGGGCAAAGG + Intronic
997604202 5:135162391-135162413 TCAAGGAGGTGGCATGGCAAGGG + Intronic
997638786 5:135435088-135435110 ACAATGAAGTTGAAGGGAAAGGG + Intergenic
998598470 5:143559396-143559418 ACAAGGGGGTTCAAGGGAAAAGG + Intergenic
1000496777 5:161993848-161993870 AGAAAGAGGTTGTGGGGGAAAGG + Intergenic
1001090599 5:168737395-168737417 ACCAGGAGGTAGGAGGGCACAGG - Intronic
1005186669 6:23170330-23170352 ACAAGAAGGTTGGAGGGGACTGG - Intergenic
1005480425 6:26250069-26250091 ACAAGGAGGGTGGAGGGTTAGGG - Intergenic
1006375972 6:33671812-33671834 AGAAGGAGGTGTCAGGGCAAAGG - Intronic
1007595972 6:43051482-43051504 ACAAGGTGGATATAGGCCAAAGG - Intronic
1007783430 6:44266903-44266925 AAAATGAGGTTGCAGGGGAAGGG - Intergenic
1013790011 6:113825846-113825868 ACCAGGATGTTGTAGGGGATTGG - Intergenic
1014301480 6:119687492-119687514 AGAAGGAGCTTGCAGGGCCACGG - Intergenic
1015754245 6:136591699-136591721 AAAAGGAGGGTGAAGGGCAAAGG - Intronic
1016137577 6:140564138-140564160 ACAAACAGGGTGTTGGGCAAAGG - Intergenic
1016377534 6:143438617-143438639 ACAATGAAGTTGTAGGGAAGGGG - Exonic
1018697978 6:166405557-166405579 ACAAGGAGGTTGTCAGGCTCAGG + Intergenic
1018804713 6:167249740-167249762 ACAAGGGTGTTTTAGGACAATGG - Intergenic
1019466488 7:1192370-1192392 AGAAGGATGTTATAGGGTAAAGG - Intergenic
1019960230 7:4452943-4452965 AGAAGGAGGTTGTAGGTGAGAGG - Intergenic
1021652266 7:22843836-22843858 CCAAGAAGGGTGAAGGGCAAAGG - Intergenic
1023022515 7:36022841-36022863 AGATGGAGGTGGGAGGGCAAGGG + Intergenic
1024171331 7:46791045-46791067 ACAAGGAGGGTGAAGGGAAGAGG + Intergenic
1026079306 7:67203295-67203317 ACAGGCAGGTTGAAAGGCAAAGG - Intronic
1026206295 7:68260699-68260721 AGAAGGAGGATGGAGAGCAAGGG - Intergenic
1026434361 7:70382074-70382096 CAAGGGAAGTTGTAGGGCAATGG - Intronic
1026697521 7:72608658-72608680 ACACGCAGGTTGAAGGGCAAAGG + Intronic
1029204630 7:98861979-98862001 ACAATGAGTTTGTAAGGCCATGG - Intronic
1029418031 7:100455942-100455964 GGAAGGAGGTTGGAGGGCAACGG - Intergenic
1030359854 7:108583569-108583591 ACAAGGAGTTTCCAGGGCCAAGG - Intergenic
1031100667 7:117476234-117476256 CCAAGGAGGTTGTAGGGAAGAGG + Intronic
1032133524 7:129252407-129252429 ACAAGTAGGTTTTAAGCCAAAGG - Intronic
1032252759 7:130272037-130272059 GGATGGAGGTTGTAGGGCCAAGG + Intronic
1032425897 7:131821876-131821898 ACAAGGAGGTTAAAGATCAAGGG + Intergenic
1037517876 8:19651890-19651912 ACAGCGAGGTTGTAGAGAAAAGG - Intronic
1038131325 8:24734796-24734818 AAAAGGAGGTTTCAGGGCAAAGG + Intergenic
1038311563 8:26449491-26449513 AGAGGGAGGTTGTAGGGGAGAGG + Intronic
1038932335 8:32208222-32208244 TCGAGGAGGTTGTAAGGAAATGG + Intronic
1039690514 8:39860055-39860077 ACAAAGAGTCTGTTGGGCAAAGG - Intergenic
1043435983 8:80236819-80236841 AAAAGCAGATTGTATGGCAATGG - Intergenic
1047105354 8:121725301-121725323 ACAAGGACACTGTAGGGCACAGG - Intergenic
1047169411 8:122476643-122476665 AGAAGGAGGTGGGAGGGGAATGG - Intergenic
1047425024 8:124737317-124737339 AAAGGGAGGTTGTGGGGAAATGG - Intergenic
1055720056 9:79163399-79163421 ACTAGGAGGTAGGAGGGTAAGGG - Intergenic
1056212990 9:84382224-84382246 ACAGGGGGGTTCTAGGGCTATGG + Intergenic
1056247955 9:84717014-84717036 ACAAGGAGGTGGAAGGGTAGAGG + Intronic
1057079752 9:92164352-92164374 CCAGGGAGGGAGTAGGGCAAGGG - Intergenic
1059061202 9:111037553-111037575 AACAGGAGGTTGTAAGGCAAGGG - Intronic
1059275661 9:113094786-113094808 ACAAGGATGGTGCAGGGCAATGG + Intergenic
1060807762 9:126588256-126588278 ACAGGGAGGCTGGTGGGCAAAGG - Intergenic
1062298551 9:135849296-135849318 ACAAAATGGTTGTAGGGCACAGG + Intronic
1185626535 X:1486803-1486825 GCCAGGAGGGTGTAGGGGAAGGG - Intronic
1187698529 X:21943216-21943238 CCAAGGAGGTTTAAGGACAAAGG - Intronic
1187821998 X:23297692-23297714 AGAAGGAGGGTGTAGTGGAAGGG + Intergenic
1188574346 X:31628415-31628437 AGAAGGGGATTGGAGGGCAAAGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189200602 X:39192758-39192780 AAAAGAAGGTTCTAGGGAAAAGG + Intergenic
1190817045 X:53938228-53938250 GCAAGCAGGCTGTAGGGCCAGGG + Exonic
1190887764 X:54544232-54544254 CCAAGGAGGTTGTGGAGAAATGG + Exonic
1192608967 X:72548553-72548575 ACAAGGAGGTGGCAGGGTAGGGG - Intronic
1193164643 X:78265722-78265744 ACAGGGTGGTTGTCGGGCAGAGG + Intergenic
1193769189 X:85568498-85568520 CCATGGAGGGGGTAGGGCAATGG + Intergenic
1195272282 X:103243375-103243397 ACAAGGAAGTTGGCGGGCACAGG - Intergenic
1196592482 X:117503190-117503212 AGAAGGAGGTGGTTGGTCAATGG + Intergenic
1197243950 X:124149038-124149060 ACAAGGAGGTTGTGGGGGTGGGG + Intronic
1197341634 X:125282880-125282902 ACAATCATGGTGTAGGGCAAAGG + Intergenic