ID: 1162075874

View in Genome Browser
Species Human (GRCh38)
Location 19:8186951-8186973
Sequence AAAAAGTTATATGTGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162075871_1162075874 20 Left 1162075871 19:8186908-8186930 CCTGGATGACAGAGTGAGACTGT 0: 90
1: 2219
2: 17427
3: 59418
4: 117120
Right 1162075874 19:8186951-8186973 AAAAAGTTATATGTGGGTCCAGG 0: 1
1: 0
2: 2
3: 28
4: 242
1162075870_1162075874 24 Left 1162075870 19:8186904-8186926 CCAGCCTGGATGACAGAGTGAGA 0: 1938
1: 35486
2: 87083
3: 159679
4: 173574
Right 1162075874 19:8186951-8186973 AAAAAGTTATATGTGGGTCCAGG 0: 1
1: 0
2: 2
3: 28
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162075874 Original CRISPR AAAAAGTTATATGTGGGTCC AGG Intronic
902431339 1:16365982-16366004 AAAAAGTTATTTATGTGGCCGGG - Intronic
904744009 1:32700025-32700047 AAAAAGGTATGTTTGGGGCCGGG - Intronic
908952551 1:69578979-69579001 AAAAAGTTGTATTTTAGTCCTGG + Intronic
911021932 1:93397827-93397849 AAAAAGTTATATGTTTGGGCTGG - Intergenic
912404490 1:109425912-109425934 AAAAAGTTAAACGTGCTTCCTGG - Intronic
915965368 1:160302875-160302897 AAAAACTTATATGAAGGGCCGGG + Intronic
917754650 1:178087181-178087203 CTAAAATTATATGTGGGGCCAGG + Intergenic
918279441 1:182989480-182989502 AAAAAGTTATTGGTGGGGCATGG + Intergenic
919111998 1:193232246-193232268 AAAAAGTTTTATGAAGCTCCTGG + Intronic
919271412 1:195352185-195352207 AAAAACTAATATGTAGGACCGGG - Intergenic
919335964 1:196234243-196234265 AAGAGATGATATGTGGGTCCAGG - Intronic
919629903 1:199950408-199950430 AAAAAATTAAATTTGGGACCAGG + Intergenic
919777315 1:201202641-201202663 AAAAAGGTAGATATGGGTCCAGG - Intronic
921531636 1:216289704-216289726 AAAACTTTATATCTGGGGCCAGG + Intronic
922280808 1:224122065-224122087 AAAAAATTCTATTTGGGGCCAGG - Intronic
924009241 1:239646531-239646553 AAAAGGTAATATGTGGCTTCAGG + Intronic
924366887 1:243303775-243303797 CAAAAGTTATACATGGGGCCAGG + Intronic
1064391784 10:14948577-14948599 AAAAGGGTATATTTGGGGCCAGG + Intronic
1065385354 10:25128300-25128322 AAAAAGGTTTATGTGGCTCATGG - Intergenic
1067541986 10:47161439-47161461 AAAATGTTGTGTGTGGGTCCCGG - Intergenic
1068886807 10:62106326-62106348 AAAAATTTAAATGTAGGGCCGGG + Intergenic
1069262207 10:66412752-66412774 AAAAATTAATATTTGGGGCCAGG - Intronic
1070576115 10:77680348-77680370 AAAAATATATAAGTGGGTCCAGG - Intergenic
1070578213 10:77696675-77696697 AAAAAGTTTTATGTTGCTTCAGG - Intergenic
1081295584 11:41383315-41383337 AAAAAGTTGTCTATAGGTCCAGG - Intronic
1081518974 11:43863054-43863076 AAAAAGTTCTATTTGGGGCCAGG + Intergenic
1083035667 11:59635126-59635148 AAAAACTCATATGTGAGGCCAGG - Intergenic
1084689153 11:70715098-70715120 AAAATGTTATAGGTGGGGCTGGG - Intronic
1086848310 11:91779006-91779028 AAACAGATTTAAGTGGGTCCAGG - Intergenic
1089579423 11:119472036-119472058 CAAAAGTCATATGTGAGTCTTGG - Intergenic
1091404163 12:198597-198619 AAAAAGTTATATTTGAGTGGTGG + Intronic
1093775386 12:23067770-23067792 AAAAAGCTATGTGTGTTTCCTGG - Intergenic
1094501678 12:31026906-31026928 AACATCTTATATGTAGGTCCTGG + Intergenic
1095070978 12:37846250-37846272 AAAAAGATATTTCTGGGTGCAGG - Intergenic
1095650891 12:44607735-44607757 AAAAATTTGTAAGCGGGTCCTGG + Intronic
1096721609 12:53527186-53527208 AAAAAGTTACATGTGAGGCCAGG + Intronic
1097007262 12:55928220-55928242 AAAAAGCTATATGAGGGTGGAGG - Intronic
1097126508 12:56780562-56780584 AAAAAGTTCTAAGTGAGGCCGGG + Intronic
1099474358 12:83090012-83090034 AAAATGTTAAATGTGGGAACTGG - Intronic
1100291414 12:93218236-93218258 AAAATGTTAGATGTGGCCCCTGG - Intergenic
1101122147 12:101593535-101593557 AAAAAGATATATATGGGGCCTGG - Intronic
1105066728 12:133207511-133207533 AAAAAGAGATATATGGGGCCAGG + Intergenic
1106218280 13:27722265-27722287 GAAAAGTTATCTGTGGGGCTGGG - Intergenic
1108556250 13:51595739-51595761 AAAAACTTAGATGTGGGCCAAGG + Intronic
1109384057 13:61604341-61604363 AAAAAGTTACCTATGGGTCAAGG - Intergenic
1114393636 14:22337128-22337150 CAGAGGTTATATGTGGGCCCTGG - Intergenic
1115239045 14:31236680-31236702 AAAAAGTTATATGTGTTGGCCGG - Intergenic
1116355158 14:43919147-43919169 AAAAAGGTAAATGTGTGTCATGG + Intergenic
1117205128 14:53434440-53434462 AGAAAGTTATAGGTGAGGCCAGG + Intergenic
1119065092 14:71517492-71517514 AAACAATTATATGTGTCTCCGGG + Intronic
1121855431 14:97265248-97265270 AAAAAGTTATACGTGTGTCCTGG - Intergenic
1122029701 14:98903224-98903246 AAAAAGGTTTATGTGGCTCACGG - Intergenic
1125494216 15:40175801-40175823 TAAAAGTTATGTAGGGGTCCAGG - Intronic
1125627105 15:41117469-41117491 AAAAAGTTAAATTTGTGTCAGGG + Intergenic
1125799911 15:42436487-42436509 AAAAAGTTAGATGATGGACCAGG - Intronic
1126301247 15:47198719-47198741 AAAAAGTTAAATTTGAATCCTGG - Intronic
1126599580 15:50415428-50415450 AAAAAATTACTTGTGGGGCCAGG + Intergenic
1128047709 15:64633573-64633595 AAAACTTTATTTATGGGTCCAGG - Intronic
1129101751 15:73271609-73271631 TAAAAGTTATATTTGGGGCTGGG + Intronic
1129931376 15:79413715-79413737 AAAGAATTATCTGTGAGTCCTGG + Intronic
1131688978 15:94806245-94806267 AAAAAGTTGTTTCTGGGGCCAGG + Intergenic
1131736706 15:95340260-95340282 AAAAGGTTTTATATGGGGCCAGG - Intergenic
1134539618 16:15054389-15054411 AGAAAGTTAGATGGGTGTCCCGG - Intronic
1135109777 16:19681553-19681575 AAAAAGGTGTATGTGAGTCTGGG - Intronic
1135152120 16:20017630-20017652 ATAAAGTTATCTGTGGGTTGTGG + Intergenic
1135976052 16:27109596-27109618 AAAAAGTGATATGTGGGGGTTGG + Intergenic
1136027384 16:27477762-27477784 CAAAAGTTACATGTGGGGCCAGG + Intronic
1137315746 16:47320365-47320387 ACAGAGTTATATGTGTGTACTGG - Intronic
1140328904 16:74033196-74033218 AAAGAGTTATATGTTGGGCTTGG + Intergenic
1141938388 16:87257362-87257384 AAAAAGTTTTAAGAGGGGCCAGG + Intronic
1142361073 16:89627285-89627307 AAAAAGTCAGATGTGGGATCAGG + Intronic
1144229620 17:13188528-13188550 AATAAGTTGTTTCTGGGTCCTGG - Intergenic
1146254476 17:31382742-31382764 AAATAGTTACATGTGGCTACTGG + Intergenic
1148643119 17:49203014-49203036 AAGGCGTTAAATGTGGGTCCTGG + Intronic
1151740397 17:75978386-75978408 ATAAAGTTATATGTGTGGCCGGG - Intronic
1152402385 17:80075258-80075280 AAAAAGTAATATTTTGGGCCAGG - Intronic
1152591184 17:81213262-81213284 AAAAATTAATAAGTGGGGCCAGG + Intronic
1153919855 18:9778764-9778786 CAAAAGTTATATGTGTGGCTGGG - Intronic
1156491996 18:37501761-37501783 AACAAGTTATGTGTGGGACTCGG + Intronic
1158178698 18:54687391-54687413 AAAAGTTTATTTGTGGGGCCAGG + Intergenic
1158327627 18:56328050-56328072 AAAAGGTTACAGGTGTGTCCAGG + Intergenic
1159356451 18:67342809-67342831 AAAAAGGTGTATTTGGCTCCTGG + Intergenic
1162075874 19:8186951-8186973 AAAAAGTTATATGTGGGTCCAGG + Intronic
1163150616 19:15411107-15411129 AAAAATTTTTATTTGGGGCCAGG - Intronic
1164128657 19:22341667-22341689 TGACAGTCATATGTGGGTCCTGG + Intergenic
1164170820 19:22723667-22723689 TGACAGTCATATGTGGGTCCTGG - Intergenic
1164795727 19:31026388-31026410 AAAAAATTATATGTGTGTGGTGG - Intergenic
1165414719 19:35685623-35685645 AAAAAGTAATAGATGGGGCCAGG - Intergenic
1166053632 19:40275701-40275723 AAAAAGCCATATGTGAGTCCGGG + Intronic
1166647594 19:44543643-44543665 TCAAAGTTACATGTGAGTCCAGG - Intergenic
1167934666 19:52896724-52896746 AAAAAGAAATACCTGGGTCCTGG + Intronic
1168597793 19:57693202-57693224 AAAATCTGATATGTGGGGCCAGG + Intronic
925910235 2:8569221-8569243 AAAATGTGATCTGAGGGTCCCGG - Intergenic
926556967 2:14369571-14369593 AAAAAAAGATATGTGTGTCCCGG + Intergenic
926955730 2:18293924-18293946 AAAAATTAATATGGAGGTCCTGG + Intronic
928025853 2:27738013-27738035 ACAGAGTTATCTGTGGGGCCTGG + Intergenic
930606686 2:53500216-53500238 AAAAAGGTATATGCAGTTCCGGG - Intergenic
930709620 2:54537958-54537980 AAACAGTTCCATGTGGTTCCAGG - Intronic
930869139 2:56152115-56152137 AAAAGGATATATGAGTGTCCAGG - Intergenic
933033012 2:77355795-77355817 AATAAATTATAGGTGGGACCAGG + Intronic
933744717 2:85562079-85562101 AAAAAGTTAGCTGTGTGTCGTGG + Intronic
934493538 2:94778725-94778747 AAAATGTTAAAAGTGGGGCCAGG - Intergenic
935376054 2:102399100-102399122 GAAAAGTTATTTGTTGGTCCTGG - Intergenic
936487123 2:112935457-112935479 AAATAGGTATATGTGGGCCATGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
941821750 2:169850547-169850569 AAAAAGTTATAATTGAGGCCGGG + Intronic
943187915 2:184637885-184637907 AAAAAGTTATATGAAGGAGCAGG - Intronic
944814811 2:203364564-203364586 AAAAAGTTATTTGGGGCTCAAGG - Intronic
944907348 2:204275822-204275844 AAAAAGTTAAATTTGGGACAAGG - Intergenic
945003785 2:205379772-205379794 AAAAATATATGTGTGGGGCCAGG + Intronic
945136118 2:206629365-206629387 AACAAATTAAATGTGGCTCCAGG - Intergenic
945325149 2:208473140-208473162 AGAAAGTTTTATTTTGGTCCTGG + Intronic
946271870 2:218601057-218601079 AAAAAGTAATAAGTGAGGCCGGG + Intergenic
947205579 2:227658137-227658159 AAAAAATTACCTGTGGGTGCTGG + Intergenic
947470105 2:230393575-230393597 AAAAATTTATATGTGGGAAGTGG - Intronic
948898274 2:240939202-240939224 AAAAAATTATAAATGGGTACTGG + Intronic
1169747801 20:8961134-8961156 AAAAAGGTTTATTTGGCTCCTGG + Intronic
1170971387 20:21119854-21119876 AACCATTAATATGTGGGTCCTGG - Intergenic
1176188327 20:63793889-63793911 AAAAAGTTATCTGTCAGGCCAGG + Intronic
1176847574 21:13888303-13888325 GAAAAGTTAAAAGTGGGGCCAGG - Intergenic
1177033982 21:16018943-16018965 AAATAGTTATATCTGGGTAAAGG + Intergenic
1177917839 21:27112984-27113006 AAAAAGTTATGTGTGTGTTGGGG - Intergenic
1178218505 21:30628030-30628052 TAAAAGCAATATGTGTGTCCAGG + Intergenic
1178395478 21:32239037-32239059 AAAAAATTATATATGTGTACTGG + Intergenic
1179276513 21:39896864-39896886 CAAAATTCATATTTGGGTCCAGG - Intronic
1181946755 22:26523966-26523988 AAAAATTTATGTCTGGTTCCAGG - Intergenic
1182373180 22:29826604-29826626 AAAAAGTAATATATGTGGCCAGG - Intronic
1183373116 22:37446721-37446743 AAAAAGTTAAATATAGGGCCGGG - Intergenic
949953961 3:9252282-9252304 AAAAAGTTTTATTTGGCTCATGG - Intronic
951919480 3:27838655-27838677 AAAAATCTATATGTGGGGCCGGG - Intergenic
952372525 3:32737015-32737037 AAAAAGTTACATGGGAGGCCGGG + Intronic
956264585 3:67382657-67382679 AAAAAGTTATTTATGGATGCTGG - Intronic
957910130 3:86609317-86609339 AAAGAGTTTTATGTGGCTCATGG + Intergenic
959771632 3:110105952-110105974 AAAAAGATATAAGTTGGTCATGG - Intergenic
960521967 3:118665292-118665314 AAAAAGTTTTAAGTGACTCCAGG - Intergenic
961763475 3:129189413-129189435 AAAAAATTATATGGGGGTGGTGG - Intergenic
963421587 3:145067531-145067553 AAAAAGTTATATTTGTATCCAGG + Intergenic
964172052 3:153782662-153782684 AATATGTTAACTGTGGGTCCAGG - Intergenic
964998325 3:162917490-162917512 AAAAAGTTCACTGTGGCTCCTGG - Intergenic
965277548 3:166704869-166704891 GAAAAGAAATGTGTGGGTCCAGG - Intergenic
965903064 3:173667953-173667975 AAGAAGTTATATATGTTTCCAGG - Intronic
966205354 3:177400521-177400543 AAAAAGTCATATGTGTGGCCAGG - Intergenic
967136312 3:186515702-186515724 AAAAGGTTAGGAGTGGGTCCAGG - Intergenic
967167490 3:186795284-186795306 AAAATTTTATATGTGGGGCCAGG - Intronic
967417761 3:189238046-189238068 AGAATGTTACATGTGTGTCCTGG + Intronic
968056765 3:195697669-195697691 AAGAGGATACATGTGGGTCCAGG - Intergenic
970147770 4:13054862-13054884 AAAAAGTTATATGTGGAGGAAGG - Intergenic
970455351 4:16218105-16218127 AAAAAGGTTTATTTGGGGCCGGG + Intronic
970604078 4:17663230-17663252 AAAAAGATATATGTGAGGCCGGG - Intronic
971540063 4:27804701-27804723 AAAAAGTTAGATGGGCGTGCTGG - Intergenic
974732836 4:65891615-65891637 AAAAAGTTAAATTTGTGTCTTGG + Intergenic
975955072 4:79827103-79827125 CAACAGTTATCTGTGGCTCCAGG + Intergenic
976798854 4:88964972-88964994 AAAAAGATATATTTGTGTGCTGG + Intronic
977655881 4:99520073-99520095 AAAAAATTAAATGTGGGTTTTGG - Intronic
978324189 4:107532987-107533009 AAAAATTTTTATGTGGACCCAGG + Intergenic
978931077 4:114312659-114312681 AAAAAGGTATATTTGGCTCATGG - Intergenic
979474717 4:121141558-121141580 AAAATGTTATATGTTGTTCAAGG + Intronic
981252586 4:142622178-142622200 AAAAAGCTCAATGTGGGCCCGGG + Intronic
982679587 4:158412919-158412941 GAAATGTTAAATTTGGGTCCTGG + Intronic
984015388 4:174419620-174419642 AAAAATATATATCTGGGGCCAGG - Intergenic
984553928 4:181191926-181191948 CAAAAATCATATGTGGGTCTGGG + Intergenic
984786967 4:183576100-183576122 CAACAGTCATATGTGGCTCCTGG - Intergenic
984902073 4:184594266-184594288 AAAAAGTTATATGTGGATTTTGG - Intergenic
985838276 5:2286828-2286850 AAAAAGCTATAGGTAGGTACAGG - Intergenic
987860515 5:23481072-23481094 GAAATGTTTTATGTGGGCCCTGG + Intergenic
990652561 5:57918595-57918617 AAAAAGTCATATGTTGGTGAGGG - Intergenic
991095893 5:62739300-62739322 AAAAATTTATTTTTGGGGCCAGG - Intergenic
993300760 5:86206531-86206553 AAAAACTTATATATGGGGCCGGG - Intergenic
993390380 5:87313617-87313639 AAAAAGTTACTTGTGGATACTGG - Intronic
994722511 5:103397023-103397045 ACAAAGTTAAATGTAGTTCCCGG - Intergenic
996068468 5:119107039-119107061 AAAAAGTTATCTTTGGGGCTGGG + Intronic
996229564 5:121044816-121044838 AAAAAGTTATATCTGTTTTCTGG - Intergenic
996801456 5:127408066-127408088 AGAAAGGTAAATGTGGGTCAAGG + Intronic
997534171 5:134603899-134603921 AAAAATTTGTATATGGATCCAGG + Exonic
997654647 5:135545929-135545951 AAAAAGCAATGTGTGGGCCCAGG - Intergenic
998220009 5:140269607-140269629 AAAAAGTTAAAGGCGGGTCACGG - Intronic
998799162 5:145851338-145851360 AAAAAGTCAAATGTAGGCCCAGG + Intergenic
999448651 5:151661843-151661865 AAAAAGTTACATGTGGGTAGTGG + Exonic
999607720 5:153334205-153334227 AGACATTTATATGTGGGGCCGGG - Intergenic
1000075098 5:157777431-157777453 AAAAAGTTAGGTGTGGGGCCAGG + Intergenic
1000297943 5:159928538-159928560 AAAAAGTTAAATGGGGCTCTAGG - Intronic
1002285511 5:178160260-178160282 AAAAATTCATCTCTGGGTCCGGG - Intergenic
1002950529 6:1805980-1806002 ATAAAAATATATGTGGGTTCTGG + Intronic
1003830089 6:9999534-9999556 AAAAATTTATATGTCTGTCTTGG + Intronic
1004955887 6:20727164-20727186 AAACAGTTACCTGTGGGTCAAGG - Intronic
1005658208 6:27965929-27965951 AAAAATATCTATGTGGGTCATGG - Intergenic
1006319279 6:33310524-33310546 AAAAAAGTATATTTGGGGCCAGG + Intronic
1010946288 6:81976835-81976857 AAAAAGATTTAAGTGGGTCATGG - Intergenic
1011001615 6:82595300-82595322 AAAAAGTTGTAGGTAGGTCTAGG + Intergenic
1013098766 6:106970159-106970181 AAAAAGGTTTATGTGTGTCGAGG + Intronic
1014200426 6:118603113-118603135 AAAAAGTCTTATCTGGGGCCTGG - Intronic
1014333310 6:120098900-120098922 AAAAAATGATAGTTGGGTCCAGG + Intergenic
1014416282 6:121188850-121188872 AAAAAGATAAATGTGGGCTCTGG + Intronic
1014821279 6:125990949-125990971 AAAAATTTTTTTGGGGGTCCGGG + Intronic
1014833256 6:126127417-126127439 AGAAAGATATATTTGGGTTCTGG + Intergenic
1016488996 6:144575309-144575331 AAACAGTTATTTTTGGGTGCTGG - Intronic
1016703881 6:147084493-147084515 AAAAAGATAAATCTGGATCCAGG - Intergenic
1016991644 6:149933828-149933850 AAAAAGTAACATGTGTGTCCTGG + Intergenic
1017378688 6:153801337-153801359 AAAAAGTTATATGTTGTGCTAGG + Intergenic
1018428367 6:163703328-163703350 AGAAAGTTCTGTGTGGCTCCAGG - Intergenic
1020604753 7:10322907-10322929 AAAATGCTATATTTGGGTTCTGG - Intergenic
1021171160 7:17399284-17399306 CAAAATTTATATGTGGGGCCAGG - Intergenic
1021556268 7:21921925-21921947 CAAAAGTCATATGGGGGACCAGG + Intronic
1021632355 7:22659655-22659677 AAAAATTTCTAAGTGAGTCCAGG - Intergenic
1022687012 7:32606684-32606706 CAAGAGATATATGTGGGGCCAGG + Intergenic
1023599946 7:41872313-41872335 ACACAGTTATATGTGGGTTAGGG - Intergenic
1025727344 7:64078922-64078944 AAAAGGTTTTATGTGGATCTCGG + Intronic
1026359907 7:69593901-69593923 AAAAAGTTACATCTGTGTTCAGG - Intergenic
1027149886 7:75725490-75725512 TAAAAGTTATCTTTGGGTGCAGG - Intronic
1030534942 7:110754551-110754573 GAAAAGTTATTTTTGGGTCTAGG + Intronic
1030759928 7:113337734-113337756 ACATAGGTATATGTGTGTCCTGG - Intergenic
1031561198 7:123240613-123240635 TAAAACTTATATGTGGGTAAAGG - Intergenic
1031672113 7:124562509-124562531 AAAAATTTATCTGTTGTTCCAGG + Intergenic
1032498384 7:132380151-132380173 AAAAAGTTATCTGTAGTTCCCGG - Intronic
1032599814 7:133281546-133281568 AAAAAGTTATCTATGAGTCAAGG - Intronic
1035154978 7:156905030-156905052 AAAAAGTAATAGGTGGGGCGTGG - Intergenic
1035713514 8:1736935-1736957 AAACAGGTATATGTGGCTCATGG + Intergenic
1037035713 8:14164005-14164027 AAAAAGGTAAAAGTGGGACCAGG - Intronic
1038335975 8:26645848-26645870 AAAGAATTATAAGTGAGTCCTGG - Intronic
1038385684 8:27142431-27142453 CAAAAGTTATATGTGGGGCCAGG + Intergenic
1039579428 8:38651562-38651584 AAAGACTTAGGTGTGGGTCCTGG + Intergenic
1039747843 8:40446949-40446971 AAAAAGATATTTGTGGCTGCAGG + Intergenic
1040020146 8:42733960-42733982 AAAAAGTGATCTGTTGGGCCAGG + Intronic
1040664260 8:49613125-49613147 AAAAAGTTACCTGTGGATCAAGG - Intergenic
1040911429 8:52522721-52522743 AAAATCTTAGATGTGAGTCCAGG - Intergenic
1041120452 8:54580910-54580932 AAAAATGTATATGTTGGGCCAGG - Intergenic
1041965850 8:63675327-63675349 AATAATTTATCTGTGGGTCGAGG + Intergenic
1042504439 8:69544560-69544582 AAAAAGTGATTTGTTGGGCCAGG - Intronic
1042997339 8:74715754-74715776 AAAAAGTAATGTGTTGGTCCAGG + Intronic
1043665660 8:82809141-82809163 AGAAAGTTATATATGCATCCTGG - Intergenic
1043970192 8:86520005-86520027 AAAAAGCTATATCTGGGGCCAGG - Intronic
1044086066 8:87943515-87943537 AAAACTTTATATGTGTGTCCAGG + Intergenic
1046445195 8:114310358-114310380 ATAAAGTTATCTGAGGGTACTGG + Intergenic
1049552315 8:143266238-143266260 AAAAAGTTATAAGTAGCGCCGGG - Intronic
1049904901 9:207299-207321 AAAAAGTCAGATGTGAATCCAGG + Intergenic
1050739095 9:8799906-8799928 AAAAAGTTTTTTGTGTGTCTGGG - Intronic
1051132332 9:13876219-13876241 CAAAAGTTATATTTGAGGCCGGG + Intergenic
1052509620 9:29398845-29398867 AAGAAGTGATATGTTGGGCCGGG - Intergenic
1052880084 9:33596500-33596522 ATAAAGTTAAAGGTGGGGCCTGG + Intergenic
1053495889 9:38547717-38547739 ATAAAGTTAAAGGTGGGGCCTGG - Intronic
1054739258 9:68788192-68788214 AAAAAGGAATGTGTGGGCCCAGG + Intronic
1054891042 9:70252144-70252166 AAAAAATTACACGTGGGGCCGGG - Intergenic
1056586003 9:87927531-87927553 ATAAAGTTAAAGGTGGGGCCTGG - Intergenic
1056610879 9:88125412-88125434 ATAAAGTTAAAGGTGGGGCCTGG + Intergenic
1057485311 9:95478303-95478325 AAAAAGTTCTACGTGATTCCAGG + Intronic
1057675818 9:97135237-97135259 ATAAAGTTAAAGGTGGGGCCTGG - Intergenic
1058961173 9:109994212-109994234 AAAAATTTGCATGTGTGTCCAGG + Intronic
1061650589 9:132045827-132045849 AAAATGTTATCTGTAGGTTCTGG + Intronic
1062249467 9:135587083-135587105 AACAAGGTTTATGTGGGTCAGGG - Intergenic
1062594133 9:137290104-137290126 AAAAATATATATGTGGGGACCGG - Intergenic
1185915627 X:4031512-4031534 AAAAAGTTATGTGTTGTTCATGG + Intergenic
1186037585 X:5441522-5441544 AAAAAGGCATATCTGGGGCCAGG + Intergenic
1186045826 X:5535746-5535768 AAAAAGTTATCTACGGGTCTAGG + Intergenic
1186057681 X:5667322-5667344 AAAAAGTTACATATTGGTCTTGG - Intergenic
1186705063 X:12132246-12132268 AAAAAGTTAAAAGTGGCCCCTGG + Intergenic
1187459303 X:19471555-19471577 AAAAAATGATATCTGGGGCCGGG - Intronic
1188164995 X:26851397-26851419 AAAAACTAATAAGTGGCTCCAGG - Intergenic
1190847562 X:54208417-54208439 AAAAAGGTATATATTGGGCCGGG - Intronic
1191632808 X:63341004-63341026 AAAAAGTTATACTAGGGGCCAGG + Intergenic
1191721652 X:64234670-64234692 AAAAAGAAATCTCTGGGTCCAGG - Intergenic
1192783352 X:74315785-74315807 AAAAAGTTACCTATGGGTCCAGG + Intergenic
1193103668 X:77643767-77643789 AGAAAGCCATATGTGTGTCCAGG + Intronic
1194090539 X:89579006-89579028 AAAATATTATATGTGCTTCCAGG - Intergenic
1194725053 X:97386147-97386169 AAAATGTTATATTTGTTTCCTGG - Intronic
1195925258 X:110018158-110018180 AAACAGTTGTATGGGGCTCCAGG + Intronic
1195965538 X:110426914-110426936 AAAAAGTTAAATGTGTTACCAGG - Intronic
1196408342 X:115389724-115389746 CAAAAGTTATACTTGGGGCCGGG - Intergenic
1196794366 X:119490332-119490354 AAAAAGTCATATGAGGGGCTGGG + Intergenic
1197041001 X:121934955-121934977 AAAAAGTTATATGTGGGAAAGGG - Intergenic
1197221997 X:123923096-123923118 ATAAACTTATATGTGTGTGCTGG + Intergenic
1197604538 X:128569579-128569601 AAAAAATTATATGTGTGTACAGG - Intergenic
1197667596 X:129240425-129240447 AGAAAGTTGTGTGTGGGTGCAGG + Intergenic
1198939319 X:141935392-141935414 AAACAGTGATAGTTGGGTCCTGG - Intergenic